data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAABAAAABAACAYAAADsjJNeAAUjUElEQVR42uy9e9BUxbX3v1GCGtQy0RgEQgAPhsRgeX u1xCuI8RbjBaLiDTmKUTFi5IhagrxekoAaFfXIGwqIgudErSi+Ri7xBITwgygFGDSiVkDP6x9JKlqVOknln8Syf/m2 rnFNz94ze891d/e3rE/NPLd58Ok9vXt9eq3ViUmMIYQQQgghhBBCSNgk/CMQQgghhBBCCCEUAIQQQgghhBBCCKEAII QQQgghhBBCCAUAIYQQQgghhBBCKAAIIYQQQgghhBBCAUAIIYQQQkrKkZfdYXE/f9CYCyrw70QIIRQAhBBCCCEkAAFw 34a/1UgABP6TF2yyX9MSIEsYEEIIoQAghBBCCCEeSIC0nX58bvsHpkoC4HshBkQEUAYQQggFACGEEEIICQC3FEAEgG QHiAzg34oQQigACCGEEEJIgFIAgb9kB1ACEEIIBQAhhBBCCAk8MwACIK2HACGEEAoAQgghhBASUBaAZAIwC4AQQigA CCGEEEJIwAIAu/8UAIQQQgFACCGEEEICRZoBUgAQQggFACGEEEIICTj41wJAGgGmHSVICCGEAoAQQgghhHi++49HfQ oAswAIIYQCgBASCPvuu68l2r/BpzMuIYQEzVFD9m4Y/Mvuv/ucAoAQQigACCGBCIA1a9bEKwGqZ13SgP33398S798g +QReCyQcCZD885p2a/91CQCDf0IIoQAghAQkAN59913z1FNPxSkBamdeksGBBx5oduzYEbEASGzsTwFAfBcAggT/V9 +7yPzmD3+tpP5DAIgEYPBPCCEUACTCRT/gjh8FAAWA3+yxxx6WaAVAy2MctgCQBnAM+MLnvecftkACaAGw91ePrkgA 7v6TIqBRpFwrCSUpIeURALL4a2UByFTfeHf94pUA4e/6iQR46KGHKAECnh8w97/++utN3wdkLpgyZYqfEqDlcdZzQR KkAJAUcAZ9YTP12MHmvPPOM8uWLbMSwBUAEviHfB0kn/zH66E9wb+eOyYf9nkrASgCCCmJAMDiTxaAXOTzIsu76F+8 eHHEEiAJXgKIAMA4RykB0mfgYAXATTfdZB5++OFC9wEJ/nGNBCMACo2zG/wnpQ3iWwnc2PE9HkQAzFr8nJUAQ8ZPsy JAJEAMi2wKgPZLADw+ePkYK5lEBPDvQ0iPSwCw4MPiT+8CRSUDsv/ahAIgegGAMoAoJUBE84JIgFmzZhWSACIAbrnl FjNu3Dhz5plnRiYB0gRA0pWAvmjwLhT92WZ+J/GXwYM/zgIAUg6gJUDoO7iJ+o/XQ2ssvO4ss2rONTb4/697rzPDhw 83o0ePtsQoAHhtkVIKACz6sPiTbICoMgLq/8VJHQHw6quvUgBE0guAEkDmBEqANAEwZswYfwVA0xKg+wIg72687Pin HeGWN5ivl/bPvgBhSwAZX1cCgNCDNwZo7Qv+X196t71+jj32WBv4r1ixwtx5553RCYDE+Y/XCCmFAHAlwM9//nNLK3 WhQUkAvllTF/5Y9MebBZBEmwUQ1VhHKAAw9991113mmWeeqTv36/R/zAUXXnihOeGEE8zFF18cThZA3bk/K/jvjgQo susvzdu0BADN/l5pCMeygHDBuKLjPx6Rti2NAVnDTRql/OsTJXCt4PGxxx6rlJcMP2+qLTGR6wiZJdz9J6RHAkBLAC z+8IgF4NatW83LL79s9ttvP0oAXoCVhf8ZZ5wRsQBIohIAyPKIVgJkzgVJ0AIA8/9tt91m1q5dmymBtQCYPn26ueyy y8IUAJnzf+8EQJGa/7RMAAR2zQgAyQiQ4NCVAMwKCEsA6PGVYI3jS9I4++yzq+r95aQogGsHu/4QAHhE8L/9T3+zn0 fwL+Ul/q8Ls9aJFACk5AJAFoEI/LH4AyICRAIEnw2QbxS8D+o0rQgALyVAy+OZRCMBXAEQnQSoOw+EKwHkHiAyeN68 eVVzvw7+v//975sbb7zRCgCUAHgrAApJgEbBf1LKgK4dEsANEPUjz4gPbzcXHH/88TVjHl/GX/jCp1mBh0Ae14kIIz x//PHH7T1BSwABwT6ySoB8LgwJUG+dWN4x51xHAVC1CMTODxZ/N998s10ALliwwH5u9erVlACeSwAEdWvWrLFBHSgq AzCZjx8/3u76BSEACo9rPAIgKwsAyM2dEiA8CYDML8z7mP+nTp1qZsyYYebMmWO/BhEcrADIPf/7JwC0BBABIAv2Vh eQusyAi8qwQPB/6aWX5i4/CTfjL3wBIIIQAXzenxs6dKhF7/7jegG4J1xwwQUVASA9JCTYf23JXWbzwlnm//3fhypi IIzrw6/7AedrCoDUcgAs/rQE+NnPfmZ+/etfUwIEIAFkR1dEgCsDsoSACAAs+rH4D04CNBzjhFkAMUmAHMFgaAIAGV /IAtASANx3333mBz/4gf0euQZcAXD55ZdbATBw4MBw537jvwDQAXu70sW5kAwTBHPbt2+vyJ0iAWIoEiCJpOyjqABA 4K4lAK4TlAPgviACQK6b3/zhrxXQVBI/++ZP55hnb5/ksQColgC9OBWmXWU+nOsoACqLQKR9YudHSwAsAB988EHz0k sv2Z0gIUoB8MkiMPE4sANI58ZCXssABHwgTQQ0EgDeNAgq9s6LVgBoCfC73/2uphQgjkyAuCQA5nRIAEhfkQDXXnut ueqqq8x1111n7wu4R+D97woAnQVw6qmnmiOPPNIS4vzfaC4oY92n3unjoo/kyfiT4F8yR+K6bsIP/ls57hNBP35mwo QJVgJg/YfrBeDe4M43CPKl7l8kwC/v+24AjSWrJYAv60E3Y4v3BAqAigRA2icEABZ/qAn94Q9/aAUA0r8nTZpkTjnl FFsWQAngd3CnJUA9EYDFAI77woL+G9/4hpk8eXJdCeBFx+AWFvqxZQG8+eabtnxErhMRAOFLgLzXSFgSAGVfIgEw/1 955ZXmmmuusXP/t771LfOlL33J7LPPPpVrQATAFVdcYQUA7hujLp5utv3+f0z/gcOjkQBaAJR9wU9InjKAtFIP9gAI I/hv9rhP3fhPJADWCVnNR3WJkCsBwrgu4sgUIREIAJEA2PXHzo8s/hD8iwCgBAhPAtQTAQjydIkAPsbCP00CHD+wrx k+fLh9ndKLgCKL/ZyLf3nDhtD1VRr5bNmyxbzzzjtVAsCVAHnw1u63SRT5UgqAeR1lX7gHQP5i/ge4H2DuP+200+z5 ziIBcC/QZQAXXXSRFQD7HznOfP6fCz6vygIK3Zn9EgCEtCIB4uzzELYESPu4UYo45ndp/qeDe33UqM4ccU8O0RKA10 Q5MwJIxAIAQT1qPpH2KYs/AQtAHOsBtAQIqjSgwDcnad/voQRwswEAUr+x+4sA0OXwww+3i39XAHz431usAFi4cGFl FzAICZBz8e+rAEgL2JH1gesD441rQbIA5Hq59dZbqySAPM+i3KIgI2hvMS28OXovAdDzBVlfkvnlzv/nnntuRQLgPg Bmz55dUwKADAA0ffJqt6fJeaDMJQCENIPUdcdbN5yYWJoB5j3uU2cAiARwe4zoz+lTQsLo/p8EOvb/mxIgdgEgi3As AlHziQUfdn5k8acFgEgALBIR+OMoKeAKAb+kQPFtfZEASWYzkKT0EgBjnpYNgKAPu78IAMGqVavM3Xffbf7+979bRA RoCQAB8MADD5hvz5xnrrn/cRtIljsAaG7M3bF2A4CqN3CJA3054hGgz4OAAE4LAMigDRs2VATAtGnTzMSJE+34jxo1 qhLoQxwWARIJ1053GkoWDMa7JADKVj+I+R89XyTzy53/UQqAXf+vfOUrFQmA0jEIALz/wV577WWG7LWLueaYgWb9w/ 8WvASgACAhZgAg4MNcIIFCXKUAiYmpGaCu76933KccAaiDfHe33xUE8vr6aEC+x7o9xv+7QvXu//+mBIhZAEggIAtx BHRYBGKhJws/N/iXoOGwww6zaZ5oAvW9732vIgIEWdiXOw24eiGeNLM7nPIatYFiuXeB0ySAiAAEgHPnzrWB/xe+8A ULSgW0BECAiNeZMmWKOf/88y0QAH7sAhYL/vNIgLIFAvooNwEBuIBgD83dAPo9iACA+MHYAxEEl1xyiRUA2A0eO3Zs VRaADu6zEGnU3fkhTyf3pCkp1HrgX673B8Stnvv1/I/7Aub+E044wd4nIAIgAe644w4rAfBeRzkQEAng3YKvBQnAhQ sJLTjUASD/JnGMeVoPCAnmMZ+npf/rEoB4S0fKKwAu/ff/r0oAaAnAsYpIAOgdQB3466Oe0PAJNZ868MfiTxaAMMQQ AOgEetRRR9lFICSAfp3eLPSL7QZm7t63KQDwRQRIEJcmARDcIwD8y1/+YoP/38/oYx/R+RUSQAsA2QUEBx98sA0ANj 56cxASoCKHVOaHLwJASwCAHg+uCJAu72j2KD0AJOsDYy89Ik488USb7g0JACABDjnkkKr+EOUJ/GslQP2Mndo5oObT LUgAH+YDCADM56741fN/lgDAz+K9juBf8O7GW7RPiB5X7v6TQFPE+feIe+z1NSA7+boBIE8cKXfwLzv9WeOMcePfK1 ABkBb068BfFv8C0jtR64ldPln4yeIvSwBgkSg7gfI6WSKgF4v/1N3+LqUBp/++ckoASfXWYOcXwZ9kAAAE/6+88ooV RRjj1157rXIqgOwEyg6gH7uAxfs+pEkAX2r+3TlAiwBcBxhfnfWhsz8kAwRjj+/VAsCVAHoO6L0IzCH/kozAzi0DaW IO8CEjCEE8erzInO7u/kP4uALg9ttvrxIAXt94i0iAEgsAptqSdgWCDOriHft68wvYddddK3MNd5LLOX5u+n+WBODf LEABgIWZG/Rnpf8KWMyLBEDNpwT+WPzJAtAVABdeeGFFAJQx/Tf3zl9RCdBE6m9ZgwGdzt1IAIgEWL9+fUUCSCaAv/ VexQSAjxKgXvmPzA0iAUQASNaHfq4lgAgA+dny7PrnL/+pL+6Mnplrr4cAsoDqSQCZ/7UA+OxnP1sRAJgjcJ/BMYL6 ve9rEJpbArgZQKX7/0g8brpFfAgECSH+ijuW+UQgAATUaINx48bZGm0dtKcBCYBFHhZ8LnoBCJAtAOo1BcMu0vXXX1 /uBmBFJEBADcDSJAA6vqPpG+q+kfqNoE8HgwgAcXIEMkJcAYDzxP0MBBpIgJQd4axTAXwVARLAY3zTxI+AMhA0DZRM AC0AyrPr35oIqBcI5skg8LWjtJYAkvUF0uZ/vNdxf8H1IhIA8hgELQFSxjmpue+UQwLIPDz5sM9buMgihBAKAAb/kf QAEBGAXX0gizn5WCOBPSQA0j0FLPz04g+LPASHCO6/+c1v2sUiHmUBqMFuEn5/744Aa6MEaNPxX0lJg0KRAFLrjbrv rCwABIL4XnwdPyvBP66PAw44wHYUDkECNMoCcHcCE5N4EwBqESDZAFIKIP0e3HHHeEMANAr+/RBBaUF7fQlQTwD4HP xrCYDTXpDtpXHnfy0AIAlEAuDrJ510kr8ZAXXe89ljXU4J4LLwurMqQAiwZIAQQsIJ/vOW7rB0IxIB4IoAdPDXXH75 5akSAIs9F1n8ZaHrRwV7XNR5U0uwIEx6iB8XoJYAyOyABNA7wngOHnnkEfPBBx9UmgiKBMBzjC8EALI/RAL43hMgsy Y8Mx3Yn7HHuLjZACIB0O9BxlyXfyDg0w0A5WfltT58e535r3uvM1OPHWzuvPNOLxpCZp70kEMAVDvDpHZS90wAAJz2 gnIvwZ3/pQng17/+dSsItATAdYLvlXtKEMcCJvUFQPb7P+npe3vI8Z8e9RVCqQYhhJB0AcCdfQqA3OUBWgpcccUVVg bMnj3bnvMsIkCjg/2ZM2eaSy+9tIq01z7g+HPM9j99vPjY8O8zSrDwqF+nn7dvQP6fMV4JAICz3lH3CwGAVG/ZEUag LwGgpIAjYHz77bftz51zzjkVCQAB8Ktf/crMnz/ffh7XjxcnA2RkgNQb5/rpwOW/FiRwd7MBMMYYb5R8iPiR4F9KBm TXX+8yIvjHqRCjR4+2eCN/MnZ2E70znDn2tZO5j2fEI/jHka64J6DXi+DO//fff7+d3yVD4Oijj64IAAhA6R0DRAJ4 cR2YJPf8n18AJD17X7tduxn4E0JIeAJAjnDsRAPPIUOGRP43TsIQAC7Y6UkL3LHDA9DtGQ2fkPIJ8DlZ/LnI4kIWew gC9jt8rM0AABAA5ZAAzUmBosG+b4t/nQGA51i84zkCQaR9AwkAJQhEsIBSEBEAL7/8sr2m7rnnnkofCHwvmgqiVKTc gUCdMpCcDd/c0gBfJABOcPjwv7fYcURfByASAGMOAYSsD137jyMjdfAv733s/CPwX7FihScZAPmyAdLTvpPMydxnAY AjXl0BjLIvkb/SX+aGG26w1wcEgM4CgAQA0idGKP0OdIE+D9nXhClNNhh3/QkhJJ4MAF0K0C4RgPUh/84BCgCAWu9r r73WXHTRRfY5Ave0AN9tLogFxXHHHWfBYs9daMjzpdMnWEQA4HmZFiOJSTvPvXG3cN/SvYsIADnqTZDAT+/+SgAI+v btawUAQACB8X3vvfcqAgDXFgIABBKQA+VcjDbTyyH72mh87ZQnAwDveUHGFMc86t4Aevxl7LG7e/DBB1c1gHzsscds +c+yZcus+Ju1+LnSBx/ue7++xEnJFFCBvq/Bf5oEwDiicawcDwsBINleerwBgv/ly5fbz51//vlmxowZ9r6AEgL53n nz5lnK3hsi39inu0GTKordzxNCCCGdkwBZ2QA6KyzPqTGzJhzDLIAOr1l6JgCwszvq4ukWPEcQgAWa1INiYSe1wFLz iZ0ffA8eIQDwvH///hUhUE8ElG03Im3xrutB86V7+i8DRABI0O6im765u79Lly61HcQROPzxj3+sfP7999+3vQAgAP CIZpE4jeKZZ57xIhOklSDAFwmAccB4Lly40DzwwANW7okIkGwAlH+IDMAYy9hDAHzuc58z77zzTmXMseuPwBGPCP6l BMgXAZAmAbOPfgxXAGjxAwEgjV5FAGCel/uARoJ+ADG0du1as3Llykrg70tPiPziL3seaeaUWUIIIaQZASBH/LklAS 7SLyBPY/awBUDemC1gAbDt9/9j9j9ynH2+11572ZQPvaiDBECKp9R84jl2ffSi75hjPr5IRAJI3bcrAkqZepEmABoE ckmu4NFPAQAQ7Osz3nXTN9n9BQgY3CBAdv3QPRzBowSSCPwl+PdVAKQHB1mTRVL4pMleSQAIwG/PnGd3b0UC6pM7MI 7o9yAlHyIJ16xZYzM/ZB7QJUBoHoeSAOBLCnL1HJAezFWNb833159LfBQAACU8rgAQ2XvyySdX0v6//OUvmxEjRlhE BPziF7+w3/e1r30tSAGQr2zAeCuFCCGElF8AiAQQEaCzAXRWAL72tTO/YwaMnWjW3D+NGQCxCgDQf+Bw8/mvHm0fh+ y1ixUAeNSBu0gA1HsCEQCy+MPncMQgLhR8TiSAHw3g8gRJplCqt28iwBUAEvRrEaCbviH1G7u/OgCU9H7dQdyfOtSi O/9JTQDoa2kIxgUS8Jr7H68SAAJ2crUMQMkHsj7wNR38IziUDBJ8bvrJ/2I2LbjNvLbkLrN54Swv5oG0wL2eAEyTBb 4fBSgCQN73GE83A0BkjwT+uG7wfh88eHAlYwzgcygHEAFQ/vtB0eMe85aM+CuFCCGE+CMB3AwA+VgyAPD5/sO+boP/ H0271JZ/ZwX/Nh4MXAA0vi8HLAAAmrdhoX7NMQNt8K8FABZ+IgFEBOiGT1j84RG14iIBsGDERZWWDeCr/dE7gEnOBa NP58KLAJBdf42c9a6DQqR+6wAQaf7Y6RcJsGXLFvs4YcIEM3fu3Kqgco899ijZ9ZBXAGSleid1r4uk8ITTfQmA8gwA uSNZQFLfj/GXPg8AJR86AwiBIcoHdPNHfA2nAmxZdLt586dzzLO3Tyr1HJCWvl8td8LNANICQE6DEAGA8ZSjXnX9P8 q+kPkF+Sv3gZtuusm+510J8MQTT9ifufLKK70WANXjmphGzSKZBUAIIaRbEkACfJ3uL1kBQCSBFgBZ9+QYgv9e7/6X QgBIELD+4X+rSAAtAHQQrxs+Sc2nlgAAFw3SRoH/2QCJyW7mlBSQAImXAsAN/nVmiA4AASQAusanSQCcLY/Po8GYgD IBUHYBkBT42UYSIL3mvBzvf5GAQMZX3re4DnDSg272iKwPjLkIABz/qAUAXkdkwi/v+66XHWW1BHAFYBKYAJC5QCRA mgCQawXzOuZ5SF/M+ZIN4EoAPBdh7EcpQJJzXPOXCSUlln+EEELCkwAS/OumfyIF8BzrMREAaVkAMQX/6fflpHu/uy xBgLs4w8cnnXSSXczpOl+p+UTaJxZ9WgCkSQC/swHqLwDzC4DEKwEgwb+kf+Os97TgH8Gf4EoAEQCvvvqq/Ry+f/Lk yRYcEbjbbruVWgAkdZuFNBIGiTcCQN7rGx+9uUr0SGCH58gUcps9IusDYy7j//jjj9tr6YILLqh8j+4r4rcATHI3e/ S5IWg9ASDjKHO6lgAiApA5okuB0GRSZNJZZ51l7xllPhK0FQGQelJEnSwTQgghpBMiwD0JAIE/gAT4l9Musmsz0KdP n6iPi+3lPTkp/R/nk8UbzofXNZ9o9iS7PCIBTj/9dAueYzEpC0MtAfzMBsizy5N4KwIwVloAuMH/h2+vsyndaOqGHh ByzrukfWP3FwGgmwmAxnHY7ddZAOgsjuB/l112KXUZQFbwn9UsrhkJUMb3uhYAGEsZY+nzoOUOnmOsJRMAiADAGAN8 DXOA3wIgK/XfeJ8BlCUBsgSAzgJAzxdIAJnnZe7/8Y9/bL8u94dVq1bZn5HgH+UDeO6fBDAtSwD2BCCEENIrRATs+Z mPA//vnTWafxcKgOygAF3fRQCgsZMWALLIw86PlAXg2EDZPUyjvGfCNycAikqAxCMBIPXcaBA3evRoGwwAfF43D8Tu rysAcM1AAkAAgJdeesl+HsaxvFke7nim794XFQA+1gOLBJD0/vfee6+uBABpAgB9QUQC+C//wpYA9QSAbhIJkYsgH2 MrEgACANfEs88+W5UFoAUAgn+UkvgoAKrft61lAVAAEEIIIRQAXggA7N7qNE+34RN2frD4e/DBB6u4+eabK/zoRz/y MBBIckuAPJQ5A0AH/zL+2PlH8L9ixQqzbNkymwEgwYA+MkxA0CfH/uG6ARAATz75ZEnHvX7wXz99v3gWgFcT1D//0f Pnz6+Invfff9/2btB9HkQCaBGA4B/yB2nfqDETQsoA0tdJEpAIwHsf8wDGT4L/A44/x+x3+NiqLACMJcYUpV6QALg3 QP5izsc1g/T/5557zqxdu9Z85jOfscE/QMPJ8gqALAmQv3wofc5PKAAIIYQQ4ocA0BIAAgALfizoZHdHCwDsCOERiz 8ECe5RcP6fCJBvtz/pYhOJdgsAnfovY4+AHwLABv7nTTWzFj9nz3rHcW8yptj1FRAAbty40X7+P/7jP2wPgE2bNlVl Afgxttlp+7UL+IzdfjcI8FAAYMdWy5133323ptmjXAcQPxh77AgjMMSjnDIg3HrrrQEIQJOeKZJDBCQezAeYB66//v qPd/7/+Z7f/qe/2cel0yfUZAFIvxf8HCQABIA0+cT3odwHJwf4cw9o1P8jTx+Q6v4RJmHATwghhBCPBIAEAhAAeFy5 cqX5xS9+USkH0DJAGj9h8YfdHnR+liOgEEjgc6EcC9ioHMANHMu68yMCwN39d2vDAYJ/BAPICsBZ7ygPkM7xkvYNEP ghENSBwPPPP28bx5Wj+V8jAdDuTBH3mvHnfY9AD2N60UUXWeTIRwgdee9jtxiZHnKdYOzR9+GFF16w/OQnP7HoXgIh CICs3X2fMoDqlQFIGRDQAkBfGyIBpBEgBIDU+ss9wK/Mj7wCwJhGR/9xx58QQgghQQiAefPmVRaFOOcZRz0h6JdgAG mfsgAUASCBv9SB+tsUzNR0AndlQL0FYBkXgyIA0oL/tOtAygJwdBzOepdO7xL8IxhEQCCN/9JEQhkDvNaDc792eou8 9zGeeP8jA0AEwNy5cyv9HdDsUSQAsj7qZQCF0hCwcT8Qf8dcJIAIgA3/PqNClgRwBQDmfpn/RQL7NN75x5ECgBBCCC EBCgBZ7EnwL4s7vahHsyeAEgGkferd/zAEgKlZ3Jk6MsAN/MssAHT6f95rYfPCWebNn86pHPcm9d+o+0YwgJ1fP8aZ AiBvJgCavkl/BwDJgxIPEQEQAPgYAkD/rDR/QwmA72VAaQKwSA8JHwWAlgBZAgBAAKDXCz6vA3+5Z/iZBdCaAMguGy KEEEIIBYBHAkAWfrLAkxRPgIZPqPlM+3ooAsBd4KV1iPZJABQJ/vX18Oztk8wv7/uufY6gHwEiGoMh0BMBoNljjz1K mQHQnl3bxgLA1yAAY4b0fYwrBICb0QERIBIA/R7czA8E/+gjAvr27evxez9jXDMEgfF4N1j3ApFx1MG/K4dcAaDLAP B1iEE5CtAvCdBchkjauFMCEEIIIcQ7AZCW0o2dHVnc6QC/0ddDGsR6i7yyLwKbFQByDUgJgEgAEQCo+da7v0gTF6Q3 QFgCwORKBfY1GJAmf3r3F2OJ4x/xHA0ecdIDJAD6PaR9H8oEIAj9zYRIf++72QBJAAIgzz3AlQBaAOA9r+8DEvxjPi j3KQDtyRBJuw+UuRcMIYQQQigACi0K9eLODfAbfT2YgayzuCt7BkAzwX/WteAKANn9RQA4efJkC3oFlKcZYNLmmu0w BYAbACKbA4E9xlP6g4gIkD4Bad/Xr1+/IMVfbVlAPLvAWgDIUa8S6GtEBsYiAEJ67xNCCCGEAqBmAVivzjecOuB8AU EzXw8pEMAYS8d3PIcAwO4vAkAE/+gREe4bO18gEMJYS2CPMe3Tp0/l85A7bgaA+30hS4B6PQBCff9LmYgedxG+GswH YQoA0zDzgwKAEEIIIUlI/zN6p6eZr1MAhBMIyFnvAuq+kfqN3d+QAsBmA4FQ/j9RxpFH6OT9vtDe8zG+97NO/vD7FA hCCCGEEAoAQgrXCpOwQGCfp5Qj7/f5KgDa9X2EEEIIIYQCgBBCCCGEEEIIIRQAhBBCCCGEEEIIoQAghBBCCCGEEEII BQAhhBBCCCGEsIcTIRQAhBBCCCGEkEgEwPbt26OWAGzaSygACCGEEEIIIVEIgC1btlAA8FogFACEEEIIIYSQGCTA+v XrKQF4LRAKAEIIIYQQQkjINf8UABQAhAKAEEIIIYQQUvLgvR01/64ACL0xYFqwTwFAKAAIIYQQQgghpaBfv37mtdde a4sAcGv+8Ryvfcghh1R9jN9ZpgCqXUF6lgDQn2/n7yOEAoAQQgghhGQyZMgQS6xHtDH4+vQawPPBgweZ2bNnm4kTJ5 oDDhjQ9pp/PL766quVj/E78Ls2btxof3e9f1s3roHkH0nl4+TDzkiAquD/Q/X7/pFEcX3KmHZjbMs853RqbCkACCGE EEJI5kJ8x44dFVauXBmVCEhS/ov1GpBADGO/c+fO1F37TggA+dwbb7yRet25/75OXgOdStuvJwAavX5I16YE/HrO6e TY+jDfdGJsKQAIIYQQQkiunTgACXDDDTeYAw88MOoFeSwywA2wR44cmRqgL1++vG0CYPPmzTWvj1IB/O60fx++1i0B kDX23RAA9T7v+/WI+UQH/LFlAXRzrqEAIIQQQgghhQJCLNYhAWKtn41JACD4djMA3Pp/PH/rrbeaygyR1xs8eHBdAb B161YzdOjQ1OtxzZo1HQ0Su5EBkOf1QxYAuMYwr8SY8t/tcaQAIIQQQgghqaDmGsEXdl4l9T+mPgBScx1zDwCMN7I+ tABYvXp1TYD+29/+tmkBsG3btioBsHbt2prX37BhgxkxYkSqAFi0aBEFQMTXKKEAIIQQQgghLYKu62j2hnpvpHxjlx aBHx733XffuFNyP0qilQA6A0Cn7b/++ustZQD079+/8vG6detqjgHE9xx66KE1wf+SJUu6smvslgGUQQCEEvxjXCF3 kOEhsnHQoEFR7v7Xu8YoAAghhBBCSMcCPgRc6L6ud/51MHbOt84yw4cPt4S8KM/62p///Ododl4x5rrvAwSQDshbFQ AQTDoDYOnSpZVjAPH4wgsvmFNOHlPzs/jazJkzuy8APsrXGLAVAeD2HMD1FuLu/9ixY6vkIq4FSEfIxzId/dgr2UgB QAghhBBCuhLwgbRj3vB5BH7PP/+8DQpHjRpVCdaC+zt8mOResId+Tbh9HyCAcA3g87vttpt9PmzYsJYFAF5DCwBca4 sXL+75NeaOsxZA8t9HH33U8mvjNdIEQGjXGAJ/Cf7TJCPko9trIth0/IICkgKAEEJIsBx52R38OxBS4oDw6aeftkFh jA0BYz8eEJkfGHdcA60IALBp06ZMAYBH/J6ySaY0CUQBkH/uQHAvWSRpQf6AAQMC7jnSeO5gCQAhhJAog//JCzZRAh BSkmwAFwR9QpR/FxN38zUIAGR/IDjHNYBHSIBmXkufAoBAP00AlC0QbGfKdr2AP8RrDOMNCRDDUaJlnDsoAIjXHDTm ghr4dyGEAoAQ0t7FOs54xzFv6PSOWm+AYE/KAEQEhLhblxT4L7ZrQ4JzPMf447rA87333rvQ67z44ouVn9HBv/yOsl 5XWYF60WuhXsAf4nU1adKkCjK+abhfi6kEoJNjTwFAvBcACBA0lACEsASAENL5TACkagNIABECUg4Qw1GBSNXW6dqx ZwRIGQCe77nnnuaqq64qJADwM3g+f/58L3tKtLJrH/qOv079R9APqSgiUXjooYdss0fIRmkGiMf169dX8F8EJIWlYi fmFQoAEowEuG/D3yyUAIQQQggh3RdEkg3Q54g+hQQAjvKToL+M9f7N7OZSAKSDYB8SQARi1u5/Glu2bDHbt2/3WgK0 87QICgAS/S6hpAuLBODOISGEENIdkL6NHVwEfuCII46IsqZXZwfEeB1oAYBsgLwS4NFHH60SAL4GeFlH+RUVAJxTGm ch8e9BAUBIRQRIJgAFACGEENI9EOwBBH7Y0UWTuBglQMylABKYQQDhGpgyZUrDn+lzUB/zyCOPBHWUpNvJv1s7uz6B po9C//79K89jCfJ72UeEAoAEJwCw+7/9A8MsAEICzfTh34KQ8osABH4I7A466KAod9e4m/vxKQG4BvIIgAULFgQX8B UtAYi2lPefc0S4Nf/NiwAeA0hIgeAfu/9aADBgICSs9zjf14QQ4k9w1+h7ytzlvxsSgCn/Juia/3aWFlEAEJJTADAT gJDw3ud8XxNCCCGs+ScUAITpwVWnATBQICTM9zp7fRBCCCGEUAAQpgZXBf0M/gkJV/aJCOB7nBBCCCGkywKACzBSpr RgXQ7Aa5OQ8GUA/xbl4MADD2ypVhhnQ/v9N0haW5DxGiKEEOKDAKjXmEkHY/yDk07VBumAX+BJAITEUQrA93l5QAD/ +uuvN/Wzxx13nP1ZiACRAT52kG82kE/r/kwpQAghpNQZAG69tf6cBGf8o5N2Bv9X37vI/OYPf61pAAi4+09I2ME/3+ vl2fXH0U0I2OWxFQGw++6728D/oYceqhIA5T1Tvj0Bey/PhCaEEEIB0JZUTF2nyTRN0kkBsPdXj65IAAkKuCtISJiB v3uPoQDoHWPHjrVBPySA7P4PGzbMfm3w4MFNCQD5OZEA48aNq3wdv6tsIiBrx75o8J62++++XreEADtvE0IIBQAhpQ NBf5oAYOd/QuKq96dgDkMASMAvP4fXSRMAeIxBAKS9XrckAAJ/nL2NM7izzuduJAj6HNTHgjPefV0gt+NvzSwOQggF ACFtFABgyPhpVgSIBGAwQEi4ILtHl5lJKQDf870L/g899FD7MQI9CAAJChHIF6nhx8+98MILNQJASgomTJhQugyAdu /Y5xEA3cyyA+vXr6+Av/+2bdvs46uvvmrZtGmT/fjFF1+0LFmyxDz66KPmkUceMQsWLPA+iyBp8T/OFYQwG4kCgJA2 TgoI/uVRJAAnCkLiKANg8N87EPQj6NPzLR61AOjfv3/le/LO6cuXL68IAHk92UGW3wnxUNbd4U4IgCzB0IsFOMYGYG zlubD33nubPffc046XENq9mME/Ia0BKYwsLgEf18swQhYSspFCmUuKzhOdmksoAIi3wb9kAMgkIRIAUAAQEn4pALN9 ugvS/Hfs2GGfjxgxwqxevbpqrsVz7NjrDADsEBcRAAjwEVymCQWZ63XWgWQG9Hq3v5MCoJnv4S4bIaSMSKmYgHsGMr 8gfzG3A511FOK8VAaJSAFAvE8JEhkgEkCe8+9ESHl374lfDBkyxAb/kAD4eOjQoTW7+5LCrwVA0QwAfL/OANBCQT4H 8QABoX8W/zb8G7uxYCubAGjHLlGRmn8NyjQAdvuXLl1q5s+fb2644QZLDDX/H330kYW7/4QUywLAaS9uFpFkFoUuJM uQOUQBQLyXALofAIN/Qsod/LNBp98CQILskSNH1uzuSwq/3rGXHZy8c7r+fvf1tCSAgKj37yuDAGhmdz7Pz9cTAK1K gLSaf6n137x5s2Xt2rVm3bp1NuDXhJL6n7ThP84ZhNQXAEX6w4SWrVSGeSKJbfHJNx6bhBBCKAFI88G/zLk7d+5MDc 7bKQDSsgzc39tpCZAV2PVSABT5d7ZyP5VgPg0d8Pva6b/oeNQTBZwrCMlfBoDsLkgAySLKm3UUSk+AZueNtp5OEsOC k+dEE0IIBQBpjwAYNGiQmT17tpk4caIZMGBAJXDUWQHtEAD69fB78Pvwe/H7eykAsoK/TgqARgEng1FCiE8ZAJAAgu 4JIP0AMP+H2BOgDNlFSQyLTXaKJoQQZmOR9gkA0K9fv6odeuwCp+3YS115o+Df/T7JAJDdZfkYv7fIv7OTGQB5av7z LtryNvzrdAaAmwlwwAEDUr+GcUEzxuCzAD5Mci/iOV8Qkp9x48ZZkBGQlW3kfj7YTOY68zpLAHLsKGUtLNkxmhBCCG mfANBBYtaOvzSXyyMA3O9Lywio9zr493WiB0CRAK8TAqBXdaUiXJB1kbYwR8PHxYsXV5r+hbg4zytcGPwTQrwTDr2o 1+6EAHDT/NOCfQoAQsqfscO/BceZlE8CNAqus1L+8+zcpH1P0RKCMtRrtjsQ7HVgiWyLjRs3mjfeeMNmaGzdutVs2L DBioFTTh4TRNO/ZlN1//znPzP4J6RJhg8fbo477jgLjnJFNpE7j6DsK6bTALo5/ychLSi1AHDT/pkBQIgfmTysD2cP AOLpYqbNAXuZBECvAvYyBJeDBw+yY4CTH3D6Ao5gxGI9muv6Hwl3/AnpABCJGjfLCNlHRY6SDVEARFECMOT4C1rKEN ASAI+uAGAfAELKvevbiYadPB2CAoB0VwLkqfnv1uv4LAEYZBJCYsgCwOPYsWNtsL969Wr7iNNe0PA1q+dLiLX/3TxW tHQCoNXFugQZUhIgwQSDf0LKFfjhedp7t5X3qswfe3/1aIs8pwRglgfpngBoxxFN7XodCgBCCPEDZBYhwwiZRpj700 57CV0G6KA/+BIABP6adtzwdco/U/8JKZ8EyNOw86AxF1jyBgxX37uoAgL/IeOnUQCUMPjnsazhS4B2CAC+ZwkhhJAA BQBu8Aj6JfW3XQKAMJ2clDcIzNuwE8E/vj+PBMC88Zs//LUCgv8Yjo7xcewBswAI8Rc0hAz12L8iO3W8FgghFABNCg B3p56LddKOnWRS3rHL27BTBEC9YNGdPyT9H1kAIgF0SQDHoBwZAHpc+R4mpNzBvsuSJUvMzJkzo0vLZSNAQjoHTgOI PiiPRQDoVD/u1BHWE8cnAeo17BQBkJYxoPt9aLQIcCUA55dySoC872GMIf+OhHRfAOzYscM2ZVyzZo1ZtGhRrmMhKQ AIIUXBXBPL3NLL7KKEFxsJIZBkTbG/ZRz1GnZqAaCDezfYd1PL5WtaAlAAlEsCYJxlzGTc+PchxI8sgFgX5Qz8CemO cIx1zumWbKQAIN6iA8BOHB9HuisCshp2agkggaIbOOpMAiCfk8aADP7LmQUg46XFTd4sAGaMEUIIIeFKACE26UgBQE gTgST/FuGhJYAEjTpwrCcAGCiWvxRA5F3e96+cGMOeMYQQQkjYWUcxlwJ0KuOIAoAEVQrAfgBxlAy4teM6pZzXgH/j qcs48goANo0lhBBCCKEAIJEGEnpHmMFfPCUDbkM5ZoH43QdC93+ot/MP5L1OAUAIIYQQQgFAAg8a9KMOJCgA4kshz+ odQPyUOg1vWv8M+FkCQAghhBBCAUAiCvyyggUGguz5QAK8UTlBPns7EEIIIYRQAJCIBEDa2fHuEXKEEEIIIYQQQigA SCDpwloAMPgnhBBCCCGEEAoAEpEMIIQQQgghhBBCAUAIIYQQQgghhFAAEEIIIYQQQgghhAKAEEIIIYQQQgghFACEEE IIIYQQQgihACCEEEIIIYQQQggFACGEEEIIIYQQQigACCGEEEIIIYQQQgFACCGEEEIIIYQQCgBCCCGEEEIIIYQCgH8E QgghhBBCCCGEAoAQQgghhBBCCCEUAIQQQgghhBBCCKEAIIQQQgghhBBCCAUAIYQQQgghhBBCKAAIIYQQQgghhBBCAU AIIYQQQgghhBAKAEIIIYQQQgghhFAAEEIIIYQQQgghFACEEEJIzxkyZEgVMd6k9X+8JgghhBBCAUAIISTIwH/Hjh1V xCIBkjr/8foghBBCCAUAIYSQIDjwwAOrAv7YsgCSBv/xGiGE+MS+++5rifZv8OnkTnKw//77W+L9GySfQAFAAtvVS/ 55YSdJfJMhF/CENAaBPyRAjCn/rgDg9UAICUEArFmzJl4JUD3BkxwbAPEKgMTG/hQAJKjgX6fyrly5MioRwJ28T/4O LY55rPKIEEJCXfAD7vaFLQDeffdd89RTT8UpAWoXhEGyxx57WKIVAG0ZXwoAEujuvwYS4IYbboji5s+03uogvpWf3b 59e9QSgDvDpMyLv1YXgNzli3PHL14J0J0FPwUABUA37gGvv/560/cBmQumTJnitwBoepz1XEABQAKXAnjDQwIw1ZcC IO/PbtmyhQIggv/PQw891IwYMcIMHTrUjBw50o75oEGDopwfZMzLPPay+JMFIBf5vMfnXfQvXrw4YgmQRCUBHnroIU qAQOcHuQfcdNNN5uGHHy50H5DgH3NBMAKg0Di7wT8FAAmEvoP62gW8LORj7gPA66F1gbB+/XpKgID//8aOHWtee+01 s3r1avv46quvmp07d5rZs2ebfv36MWOoxAtALP70LlBUMiB7QAkFAAXAu+/asY5SAkQyL4gEmDVrViEJIALglltuMe PGjTNnnnlmZBIgTQAkFADEb7Bgx8IdC3gs5PXCvs++faJezPP6qJ8RkCaKKADCFQAI/CX416JQmDhxYuVrMWYF+SAA sOjD4k+yAaLKCKg/uKSBBMD6gBIgCVoAoAwgSgkQ0bzQjATQAmDMmDH+CoCmJQAFAAkwuMOCHQv3tAU9vvbF079ohg 8fbgl5UV8vkAtRCOTN8mgkANyaf1cAhJ5NknZdhCgAcOPHfACQ/p82pgMGDAh2vPPIQR/GXUuAn//855ZW6kKDkgAU AZmLf7z/480ESCgBos0CSIIVAJj777rrLvPMM8/Unft1+j/mgQsvvNCccMIJ5uKLLw4nC6Du3J8V/Hfu+qAAIF0LAn cdsGvq17DQf/75520fgFGjRplDDjkk2j4AIUkAZH20Y6c2reZfxJFcK/JxmVLD2zmWWQJAfz6EawdjGHNH8JDmAJEA WPzhEQvArVu3mpdfftnst99+lABcG1Qt/s8444yIBUAStQCIaqwjFACY/2+77Tazdu3aTAmsBcD06dPNZZddFqYAyJ z/KQBIxAuAp59+2kqAGBsChiAA5GQH6feAkg9kfaSJn1Zr/vGIVFH5GL8Dv2vjxo32d9f7t3Ur4G/3WLqvlfaxr2nj wqRJkypA7qRlDAH3a7HNA77MEVjoIfDH4g+ICBAJEHw2QL5BDyKo07QiALyUAC2PaRKNBMD1gXt3tBIge5ETrASQe4 DI4Hnz5lXN/Tr4//73v29uvPFGKwBQAuCtACgkARoF/xQAJKBsAJfddtutAnf+/Az+MYFLkI0xRb+HtF37TggA+dwb b7yRGhC6/75ujF+70/YbCYB6r1/260uCflwfum4cYHH4wgsvmOXLl1eaAeIR14PguwhIWvyv7ItA7Pxg8XfzzTfbBe CCBQvs59AHhhIgCSKoW7NmjQ3qQFEZgABg/PjxducvCAFQeGzjFQDRSYD6C50gJQAyvzDvY/6fOnWqmTFjhpkzZ479 GkRwsAIg9/xPAUAiAAt3LOTfeust89vf/rayyEcJgJQBiAiIocY3lOaAboCNkx7SAnSMfbsEwObNm2teH6UC+N1p/z 58rVsCIGsMuyEA6n2+zNcV5gFIgGHDhlmyZGEaGFu3T0RMWUC+NAbE4k9LgJ/97Gfm17/+NSVAIBJAAjoRAa4MyBIC IgCw8EcAEJwEaDjOSfRZAABBHyVAEpwAQMYXsgC0BAD33Xef+cEPfmC/R64BVwBcfvnlVgAMHDgw3LnfUACQQHb4m8 kE2GXYLhZIABECLAVIvBp3NwPArf/Hc4ifZoI0eb3BgwfXFQAwzTgzPk0AYIeqk2UA3cgAyPP6vgqAdmUWcR4u5yIQ aZ/Y+dESAAvABx980Lz00kt2J0iIUgB8sghMAigFwG4uFvNaBiDgA2kiIAgBUEQC1MzDcQuA6CRAjh3hkP5/MadDAk D6igS49tprzVVXXWWuu+46e1/APQLvfVcA6CyAU0891Rx55JGWEOf/RvNAu9dxFACEC3HSlnFfuXJllQBAeq8boCPr o1kBsG3btioBgBRi9/U3bNhgRowYkSoAFi1aRAHggQDAGAv9+/evPI9lbgn1uFAs8JD2CQGAxR9qQn/4wx9aAYDUb2 R/nHLKKXbeoATwP8DTEqCeCECwhyO/sKj/xje+YSZPnlxXAngxB7Sw2I9NAvzud7+rKQWIIxMgPgmANZtIAMz/V155 pbnmmmvs3P+tb33LfOlLXzL77LOPHX8tAK644gorAHDfGHXxdLPt9/9j+g8cHo0E0AKAGQAkaPbee2+z5557mj5H9L HsekTfKLMAfJYAOgNAp+0ju6OVDAAEhPLxunXrao4BlOPj3OB/yZIlHW8C6I5dWQSAr0HkQQcdFGzNf6vlQj5LAOz6 Y+dHFn8I/kUAUAKEKQHqiQAEerpEAB9j8Z8mAY4f2NceFYzXKf0cUGTBnzMA8Hl9kCUA3nzzTZudJ9eHCIDwJUDeYD CcLDDM6yj7wj0A8hfzP8D9AHP/aaedZo499tiKBMC9QJcBXHTRRVYA7H/kOPP5rx5tywK8WQsUW/BSAJB4wYQAUAqA 4A03/ZhLAXy44WMSRtmG3LT77NunKiBvVQBgsaAzAJYuXVo5BhCPaBS33wm1QQO+NnPmzK4LgLxBezteO88JAL5KpV Br/mOUhAjqUfOJtE9Z/AlYAJ533nkWLQGCKg0o8M1J2vd7KgHcbACAnV8Ef3gvuxx++OE2AHAFwIf/vcWuBRYuXFjZ CSx1ZlDzE1/wAkCOe8V4v/POO1UCwJUAeWj0e8p3vGxSQALkweTsL9FbCYCeL8j6kswvd/4/99xzKxIA9wGAE6UgAP YZ+b+qygCQBfDakrvM+of/LWgJkPb+b8cc0HUBgEGOOlXaJAzwC4qAKVOmmD4H9bE7gjEv9H24dnCD1b0bvnj6F63E wefR2BHP0euhVQGA19ACAJIBC0X5uEyBWbtETh4BEMv8wlIjfxf8WASi5hNrAczvsvjTAkAkABaJCPylWawrBPySAs W39UUCfPqjSakW9HklAMY9LRsAO78I/iADwKpVq8zdd99t/v73v1tEBGgJMPXYwVYCPPDAA+bbM+eZa+5/3JYQIBAo 53zQ3Li7411PApRl3s8KttMCdowZrg0IAIy9ZAGIALj11lurJIA8zyJLDEAi4drpTj+JrPdmRtDeYm14kTKSspSSYP 5HzxfJ/HLnf5QCYNf/K1/5SkUCoHQMAgDvb7z3wV577WWG7LWLueaYgRZv1gJNSICgBABu5M3+PH4WgSDAa/kWFLYr CPBlwc9FetxgooYQePrpp1sSAGDTpk2ZAgCP+D29FgCdfL9SABCfA39ZhCOYwyIQCz1Z+LnBP86EB4cddphN80QTqO 9973s1R0TKor7cqcLVi/CkmZ3hlNeoDRLLfx2kSQARAcgGmDt3rg38v/CFL1hQKqAlAHq84HVwX8HGwPnnn29BMIkg YOOjN5d4vVEs+K8nAcq6DtTHuQF5b8r7GY0eBezgagGA8cf4igCYNm2amThxoh37UaNGVQJ9ZA8VobtzRJ5u7t0VAG WcIyBu9dyv53/cF3CtnHDCCfY+AREACXDHHXdUJABAORCABAChZoJ1shdIVwQADBxSgeWc51ayAHDT33333W3gj0nC BwHQiSCAC37iiwDAzVuOd8QjJEAzr6VPAUCgnyYAyrb4a2cNd72An3MBKWPQ7wb++qgnNHxCzacO/LH4kwXg8ccfbw UATvU46qij7CIQEkC/juwMl08EZO2+NbH4N0V295LSXxcSzLsSAMEfBMBf/vIXG/z/btYX7SNKfSABtADQO4Hg4IMP ruwClnvDoUDph8r+aLQTWKa5333PY/0vYMcXHd4BGj6KAEDmB8YeiCC45JJLrABASvjYsWOrsgAkuNev7dK7UyQaZe y0fw7wrYEkBADmc1f86vk/SwBI1hfe594F/rrtR5Pyt52lYB0XAHjjYuGON6Hs/uOMZ3xNFvNFmkLh5+XnRALo3+VL I6dm0rYaLfoZAJAyIsE5nkMCSAYQmj0WeZ0XX3yx8jM6+JffUdaFX9Z7tpWz3vneJ2UO8iQA0IG/HPEkIL0TtZ5Y4M vCTxZ/WQIAi0QJAuR1skRA72RAkrmD28kdwPTfV14JIDu9GgR+2PWXDACA4P+VV16xsgjjLOtJXQaEnUB/Mg2L937I kgBlF4Ao25P3pwTm8r7FaQ/SA0DKPiB/pEnkiSeeaOu9IQEA1ve4z+sGkfUC/94eIZnkzwbIyvxoQQKUKeU/SwCgx4 vM6e7uP8baFQC33357RQD4nlVcKBPMBwEgN/1OCwDcJOTn8Dr4eNy4cfbj4447zv6uMqX2d0MAcBeQ+IKUAeA5TnpA DXARAYCfwfP58+eXLt2/1SC+kz9LSDdT/evt/AlYyIsEQM2nBP5YM8gC0BUAF154YUUAlC8AKLDoLyoBmqj3LXMAoH dzGwkAkQA4/UMkgM4E8LPMsJgA8FECpGUDuCIA44+x1WUfuvxDSkAw7vheLQBcCaBFYHmygfJlA6QFhKlBoqcp/3kk gMz/WgB89rOfrQgAzA8QADhG0G0KHLQEcMt/ylYCgO7aaTdbCf6lCzjevLoLOAL5Iin8+Dl0+nYFgJQUTJgwwf4+t2 M8Pt+tXf6iO/bt2AVsFBQwUCBl6gkh2QA44rGIAMBpEBL0l7Hev9Ck28R7kwKAlBUszGShj9psADGP2mwdtKcBCYBF HhZ8LnoBCJAtAOrVA2MX6frrr680/+pm7W/h4D+PBGhL/W+5JQAavqHmG2nf2PlF4CclACIAcHoEskJcAYAzxf0MBh pIgJSAMKsUwLceICICRAKIANBjLs+1BBABID+bJf3K2O2/3vxQNQ18esOvFUKBlAKlSQDJ+gJp8z/e57jP4FoQCQB5 DIKWACliJ6kpNSuBANDHbCHob3QOOM70lu/JGzwsX7686igwvJ7uBI7XSysFcP99nRYAeYLxVgVAkUZgDBhIWdACAN kAeSXAo48+WiUAvJ30m5wDfDsRgsQlAFywqw9kMScfaySwhwRAuqeAhZ9e/GGRh8AQwf03v/lNu1jEoywANdhNwu/X gUf3u3+3SQK04XV9kQCS6o2076wsAPQDwPfi6/hZCf5xjRxwwAHm7LPPDkICNMoCcHcDE5OUPvBLEwESwGNs08ZcwL ijaaBkAmgBUL5d/+ZEQL1AME8GgU+BvysBcNoLsr007vyvBQAkgUgAfP2kk07yNyOgzvs9e4zbIwGSTgT/YMSIEdbs 6MHAc+zY6wwA1AgVEQAI8CEO0oSCDL7OOmj07+z07n83BECeYJ9NA0nZ2PWIvnZXH7uFjb4Xx0A+8sgj3u76Fy0dav V7CSmLFEAHf83ll1+eKgGw2HORxV8Wun5UwO/E4/Dzptr1QO8Cg6RnVM8T7U0b7aQEQHYHJIAOCPEcYP7/4IMPKk0E RQLgOcYZAgAZICIB/AkG8kkAN3CsTQlOjC+NIN3TAqQUQBo+uuIHYw0B0Cj492Pcs0uF8pR/hBT8iwAAOO0F5V6CO/ 9LE8Cvf/3rVhBoCYBrBN8r9xSvJEDOzK/M6yX12uixAMAAurv7ksKvBUDRDADdCdwVCvI5iAcIiLz/1hgEQK8kAM/r JvVAuQ6C+zwCQCb70ARAJ743hlISziv+ZgdABFxxxRVWBsyePdue8ywiQKOD/ZkzZ5pLL720irTXvuiii8wBx59jtv /pb1YCbPj3GZbeXSv16/Tzlg7k/Rnf5gkJ3nBaDLI3IQCw0ysBIYI/1P9jwS87wAj83n77bftz55xzTkUCQAD86le/ sj1i8HlcQ+WfI7KzQOqNdf2UYD8yAnQ2gEgANHwU6aP7P2D8dQNA+VmRfKvmXGM+fHud+a97rzN33nmnF+OeedRjDg FQfckk3q4VEPxjIxf3BPR6Edz5//7777fzu2QIHH300VUSQHrHAJEAXqwPTJJ7/s/+fHMSoGMCYOTIkTW7+5LCr3fs 8cYuIgD097uvpyUBBETZBUAzb9Q8P182AYCbODq9uo078jbyQPAHfK75bsffPNQAME8fkDJ3+e/GuMYU/ON6APXmCs wnmFdCvCbyzBc+Z4NgpyctcMcOD0C3Z4h9pHwCfE4Wfy7uvV+Oh9vv8LE2+F86fUJFAOB5ea6XfAF+Y0Hg/1yhMwDw HAt4PEewj11fIMGf7AAjYEA5iAiAl19+2V5X99xzT6UXBL4XTQVRLuLDjnCqBMhZ7+2WBvgkAdxsAIw71vno+SCZHz L+UjIgu/7ynkfwv/C6s2zwj/f/6NGjLb7InzQJkNQJDuuV9fiW7SsCAEe8ugIYZV8ifzHfI1sU5Z+4HkQASAyIDCAg fWKE0l8DBUo8MoVR3Z/vgQDAH33nzp2pwXk7BUBaloH7e3shAOoF590QAGWaGGSSxtgJGLdt27bZR4gisGnTJvsxur 0DpIej7hs3gBB2f5MW/+NuIgkZLAIEBIDIFsPNHXMC0PNHiLv/Mc0FqPO+9tpr7W79PiP/lx3LtABfg8Ufvg+n/QAs 9tIEsiuLEPhL8F+WayZ9LBs3CvMp1bsZASCd3gXZ8dfB31NPPVUJHPv27WsFAJBy0Pfee68iAHB9IQgodyZAsz0d0q 8PnyQAjm/88L+32LFEY0cgEgDBHSQvyj507b+MPwJ9t/x36rGDbeC/YsUKT7IAGmcDpAd8STACwJUAKN9C41g5HhYC QLK9ZJwfe+wxi8QFuBecf/75ZsaMGfY5NoDle+fNm+dFWUi+Mo9aL5h9/ej5oMNNAN2getCgQTa1D+lcAwYMqLxJdV ZAOwSAfj38Hvw+/F78/jz/zk7t2GQt2DopABotEns9KehFGco4APo5yHMBZ73juDe9EIh5sc/gn8Sy87/77rvXzAcy R4Se9h/THIBd3VEXT7dABshiXupBsbCTNGCp+ZTGn3iEAMBzXBsiBLKujTJeM5mlgA1SfmubPvkvA0QASNDuomu+Jf iryJ2lS23JJ4KHP/7xj5XPv//++7YXAAQAHkMRAPUCgcRJHCi7AJBsHYDAXaQOZK/uDaCvAxl/SfGWJpDyeggKEUAu W7bMZgDNWvxcqe8X1XN7UiAQTDLjAR/vFyIA9JhDAEijVxEAmOflPiDIzr/0DsA1sXbtWrNy5cpK8C+P/guAtPdy/U yyehIg6eT/VL9+/ap26BHIpe3YS3p4o8nC/T7JAJDUcPkYv7eMqZytHtOXJ6gvU5DPoIYQUjT1P9Z5JybZBwGw7ff/ Y/Y/cpx9nrabBwmAXUCp+cRzLPD1wu+YY46xUl8kgAR6Zb8Ocq0L6kqA5lI+yy4AgHvGu675luAPIGhwsz1k5w8dxN E7QHaVEUigPKCc10UrO/9pr2VqAoEyNoLEWCCgX7hwYUUESD2/jBvGUGQAAkSRPxj/z33uc+add96pGn/s+kMA4BHB P/qAQC6UdT5Il7zpvR8SZ3zT+n2EJAAAyndcASCy9+STT64E/1/+8pdt3zcgIuAXv/iFR+uC4gIgX9lAh3sA5F2YZe 34S414HgHgfl9aRoBPN/52CYCyTep5a/41uwzbxQKZA6uPJj4wfXJkXCwLee7+k1iZNGmSTf2HBBg2bJgl7/wRQk+A Vt77Ps4V/QcON5//6tFWAOy11142HThLAqDeE4gAkMUfPocjBiEB8DmRAH40f2s8dln1nkmuwNFPASBBvxYBEvxLkI jgb82aNTb1Hx9LcK+7iOv54ZlnnjFjxoyxj+W7LooG/6YS/FWOhW1QHlJmCYAsoAceeMCW+GgJIEACoOGj9HyQTCE9 /pgLcA3pPiDoIo/g/7Uld5nNC2eVOj5IkwBpO7pZ41+T9u1pCQAEgLznMZ5uBoCUfUngj7R/vNeRISgZYwCfQzlAmA KgSLZIjwVAvRT+Iil6ad9TtITAl4ZfvjeGy6r5l1r/zZs3W5Cms27dOhvwa0JJ/U/a8B8DQxJbBgAkgKB7Akg/AMwh IfYEiHGeQOM2iIAhe+1iBQAe5R6ChZ+WALrjsyz+8Ij6YJEAWDCipMCnbID6gaHJ7PYeigTQAkB2/TVy1JuMJVJ8sf Orgz+k+WPHWCQAhCAeJ0yYYObOnVuRAOW8HvIKgPrBYta10SgNuNdrRWQCfXvmPPt+FgGgx1rLAPR8wBoRX9PjjwBR SkjkZ6ef/C9m04LbbGPALYtuN2/+dI559vZJpZcAebOA0mSBz0cBSiNIEQAYTznqVdf/o+wLmV+Qv3IfuOmmm+z73Z UATzzxhP0ZfL/PJQDV45o07BORfa2UUACU5fUoADpXDiDBfBo64A/tnPc848Sgn5Bqxo0bZzMCsuYN9/Mh9wPwbd4v eo/ADt01xwysBP9aAEgQj8Df7faMBZ6WAAASAGmjwMdsgPTA0KQc+ZUUkACJtwLADf7ddYUEfwASQLKAXAmAo+Xw+d 122827EoCkwM82lAAl3TC65v7HawSA1PfjGpBGjwA9H9zxR/aAPv1BXyMQAJJd9Mv7vuuNAKjO7gi7DEjmAZEAaQJA rhXM65jnIX0x58v9wJUAeC7CWGSRz1kAjcY8nyzqoQAoUvPfrdfxWQIwWCSEEOKzAFj/8L/VCAD52kknnWQXc27DJ9 R8Iu0Tiz4tANIkgM4G8FkCZAd8idcSIEsASPAvu7846k1LAB38Ca4EEAHgHkntiwCo3/G9kTAolg7cyzkA5Rng4IMP rgTrQN63uBZw1KM+7QFlHxhvuQZ+9atfVQTABRdcYL9m5cI/5xY86hIjX4SvlgBuGUdIZUBFBYArAUQEQBrpMiD0l4 hFAGQdJ1k6AdCOWs12vQ4FQPcyAXYdsGvq17Cbd+ihhwafBcC6f0Iag3PAcYPHwh3zgjvH47SXmE4DCF381htLCQJw TeiaTzR7kl0ekQCnn366Bc+xmJSFYTgSoNGZ4H5LAC0A0oJ/nPOud3Z13wAEfwgC3UwA1I3jaDGdBeCLBGh03Fu+rI HySwCdBSTBupY8UveNciH3tAeUfWC8RQA9/vjjFQEwfvz4igTwuwwoqQoQG5/24L8EyCoB0BIAPV8gAWSel7n/xz/+ ceXesGrVKs/GP8l5jGc+CZDkiSHLdMPv5muQLk7wr71mj2hMS+fFed+44UvTv5BTelkCQEhjMF8I7nyBecQ9TSamEo CY5gnp+C0CAI2dtACQhR52fqQsAMcGSuAg+C0BGgf7vkuAegIA4/Xh2+tsKjeauqERpJzxriUAgj8RAEBq/iEBIADA Sy+95M1JAO6Rf+nv/3AkwMZHb65p8o1xlPGVRo86u0M2AiUTAGgBIBIAAWIY8i+9PMj3MqCiAgDzOOZz9HwRCQABgG vi2WefrVwfFAAlFAAkPnA048aNG80bb7xhSze2bt1q7S0W8vudsF8QTf+abfAV26KekDygHhSBH+YI1H3icefOnWb2 7NmlOeq11/NGTAIA50LrNE+34RN2frD4e/DBB6u4+eabq2RAeY+DK1Lnnb7wy6LsQaAWADr4l2sAwT/mg9GjR9uAAO hMABcEfVhv4Ou4dgAEwJNPPumFAEgL/rPf/+GUAqQ1+sZYSnr/e++9V1cCgDQBgECREsAfCYA5AOJOgv+LLrqo5qhY SAA0fEWpFyQA5nbIX8z5SP1/7rnnbKPxz3zmM96Nd82cnXrPT3LdB+qNOwUA6Rp9B31cgzVy5MjKLg5SfKPLiOCOPy G5wRwh5/ti/hg0aFC080WMvV9EAkAA4BrAok4W/1oAyCMWfzgHXmeNQAKAH/3oR55mD+bf7U8NHqsWhOUWADr1X8Yf O/4I/lesWGGWLVtmP9YN4xDwaWTXFxIA1wJ6AGzatKnEWQD1U/8bS8D610JaDblP738cCy2ZAO+//74dU93o0ZUAAM E/gsizzjrLBopCSGVA+r0eigSQLIDrr7/eBv+QAAccf47Z7/CxqVkA0u8FPwcJAAEg8/8uu+xiTw3wTfhWjbEpVgLk HhdJAUAIIYQQbyUABAAeV65caX7xi19UygFcsPMjRz997WtfM1deeWVNGYm/9cDZO/tpjZ98kcwiANzdfz3+EAA28D 9vqpm1+Dl7zjuOepNdYtnxFRAUSN2/BATPP/+8zTzEaQD4XLkDvPqlP8WzAKqvG596SKGJm87uePfdd2tOe5CjHiF9 IH8w/ro5KECjQd/LgLJPe6g/L/h0KoiUAeA53u/b//Q3++iWiGgJII0AIQBk/pd7gF9jnqf/R6PSoXwbjRQAhBBCCP FCAMybN68SyOOcZxz1hF1/1HsCZAhg50cLADkHGicHlP9M6MYCIG1nP0kJ8HwpNRMBkBb8uyniCP4REKAfAM55l89r CYCdXwn40GMorfdQuY4ErB/8N9tHoN6Ov08CAAEcxhWp4AASB59HRoeIP4y5jC0kAOSPnC7gcuuttwZQBmQyA/tGIq DsWSAiAaQHCIL/pdMnpJaIiARwBQDmfpn/RQL7mQXQ3LVBAUAIIcRLsLiLOuhleVDNYk8H/1mg5hNpn3r3PwwBkDeF v7ZutMwCAIt8nfqf5zpA8I/O8egNAKR7vKR/I+3bFQA4DWDy5MmWco1/O4L/YjuCPr73scsLCYjxFQEwd+7cSoNHjC 8kAPo9SMYHxl74yU9+YtHNBH3vBdDo2LhsQehHLwCZEzb8+wyLKwG0AAAQACj1wud14C9CIEwJUP/9Xm89QQFAegqa d8R27F+9tD5CyKdgAYA5gvMDr4U0CYBgHunBcs6zWyMqC0BJAfVdANRkAJh8p0WUXQDkDf71dbB54SyzZdHtVefGI+ hHwzfUersCAB3iEUBiJ7lsAqA9wX+4AkC/pwHGWE55wE4/ejyICIAAwMduHxD/S4CyJUCSs4zEN6QXSJYAaCQBpAwA X4cUxPzvpwRoTxaA+96nACBdDfZdlixZYmbOnBnVYj7Wjt6ENDNniATQxCYAOF9Up4G7H6ct6vTOjyz+QhAA7biGfB cAMr5v/nSOfYQEkM8h8NcCALu+chwgPu7Tp4/H6b7tCQZ8f/9jFx9jKRJARIBIADR8lM8jMwDyB+OPZqJ9+/YNYB6s DQ6zjn8L4f6BcUwL/tMkgBYAGgn+Mf/jeXhzff0SjzQJTAFAur6YR9OWNWvWmEWLFkW1oKcAIKT5eUOILSOA80Xri0 e9+ItNAPiQAVA0+Jdxffb2SeaX9323RgpBAEi9twgABH/lPBIs6cBubeOUYN/f0xL8Sy8HPMcJDzjqERIADR/xOZR8 IPMD14J/R8I1zgSqSvNOkQOh3DsaZW+IBIAAkNNeRPpq+YtssTAFgMmVAUABQEqTBRBrSi8X8oQ0N2/EXArAOaP5xa Ms/hAIxCYAQr2G6mV/IBjAWEvNdwg7v60GAyFnA+nPQQRInwAIAJR9lC/zo7NyIInw3iHZIbpEzAVzQrgCwDTM/qAA IIQQQkg06J0gSqQ4pI9/3d47FwzEJvyQGRBG3X8rAijuMrHwekB0IDOMEEIIIYSQ0DMESPigCWC5jnrsjfDjtUAoAA ghHWPfffe1RPs3+HRGJYQQQgghhAKAEBK2AEBjx2glQPWsSgghhBBCCAUAISRcAfDuu++ap556Kk4JUDuzEkIIIYQQ QgFACKEAoAAghBBCCCGEAoAQ4rkEeOihhygBKAEIIYQQQggFACEkdAGwePHiOCVA+gxLCCGEEEIIBQAhJNwygCglQP YsSwghhBBCCAUAIYQSIPwsAEoAQgghhBBCAUAIiUAAHHjggRQAvDYIIYQQQggFACEkNAHw6quvxisBMmdaSgBCCCGE EEIBQAIAwV1Uu7w1MMDLEgDRSYC6sy2vEUIIIYQQQgFAAhAAO3bsiFgCJDa2Y4CXnQUALrvsMkoAXiOp7L///hZKRF 4LhBBCCKEAIB4IAAR48UqAhBIgRxZANBKg4azLayRNIMYrADh3EEIIIYQCgFAAUAAEIAF+97vf1ZQCxJEJEI8E2GOP PSzRCoBP76YUAIQQQgihACDxCAAEfBQAXMRrAfDmm2+aNWvWVCSACIDwJUCe2TcJRgC8/vrrTYsAEQBTpkzxUwLU3l VbEACcPwghhBBCAUA8EAC33HJLxFkACSVAyjUBtmzZYt55550qAeBKgDx4e03kkgB5KL8AuOmmm8zDDz9cSAJI8I+5 IxgBUEgCuME/5w5CCCGEUACQkgd6Z5xxRsQCIIleAKQF7GPGjLFZABAAKAOQLAARALfeemuVBJDnWZRbFGQE7bln4X bSWwkwa9asQhJABADmj3HjxpkzzzwzMgmQJgAoAQghhBBSMgEgqZ6t1H16TUvpnuVL1da0IgC8lABtSN+NRQJkBd0Y fzB+/PgKRx55ZJUAQCnAhg0bKgJg2rRpZuLEiTa4HzVqVCXQv+666wqBaw7XW3euuYLBeJcEwKe/rrfXXDMSQAsASC NvBUDTEoACgBBCCCGeCAAs9KTuM2oB4LkEQJCG3Vl0bAdFZQAW8Aj4pk+fHoYAaGIHLyYBIOnagogfgGvgxhtvtHzj G9+oCIBVq1aZuXPnWkQQXHLJJVYAnHvuuWbs2LFVWQA6uM9CrjO51rpzvWUFay0KANOOwL/315vcF37+85+bu+66yz zzzDN17w/6esKYXnjhheaEE04wF198cThZAHXnkUbXExcohBBCCClRCQAWdqj51M2fopIBLQWN5ZMAUqMtIsCVAVlC QAQAgr7vf//74UmAhmObRCkBAJr8uSIA1wCYPHlypQfA3Xffbf7+97+bv/zlL5Vr68QTTzSnnnqqlQAAEuCQQw6xAk Cuo/IE/rVBW23wXV8C1Hy6BQlQtsA/TQAgA+C2224za9euzbw3aAEAeYSxD1IAZM4fFACEEEII8UwAYJGHdE/JBogq I6DlneNylgIgPRsLci0DEOiBNBEQhAAoIgFqxjcuAeCWAkgwniYCENAdfvjhNvj/whe+UIVcW/j6aaedZr9XCwBXAs jr9y7wTx/zPCIgLehPFQE5g/8yB4giAbD7DwGATADcJ+bNm1d1b9DBP8Ya8wfGHiUA3gqAQhIgTzYJFyiEEEIIKZEA cCUAdn1AK8dBhb/j44cI0BKgngiQZm+o90bKN3Z90yTAYQfsEZYISIoGa+G+B+qJAJEAIgB+P6NPRQDIcy0BRADIz5 Zn17+xDKgnAqqSAfTc8IkIyHNdlXXXP+u+sHXrVntvuPnmm83UqVPNjBkzzJw5c+zX9ttvv3AFQIE5hAKAEEIIId4J AC0BZKcHOz9Y/L388st2oUcJ4LcEqCcCsIjXJQJSx50lAcDpI/YKqCSgsRiI5VSANBEgATwCfFw3bhaAsH37diuRJB NACwB313/qsYNLKpTqi4CkznWVJ4PAp6AQ9wTM/7gXaAkA7rvvPvODH/zAfo/ML64AuPzyy8MXAIYCgJB2ctCYC2rg 34UQQjokAGTBJymfQESASIDgswGarh8vvwRwswGAdHVHfbcLgj0J4nTwtvC6s8yy2ZfbRy8yApp+R8UpANJEgAR4Ug qAQB+POvgXOQAB0Cj4/88ZF5g5Fx5T8usne3c3SwIkuUpJ/LqGMO9j/l+wYEFFAlx77bXmqquusg0ekRGA+4KUe2gB EE0WgIk7e4iQdguAyQs2VSEi4MjL7uDfiBBC2i0ARAKg4RMyAbDYw6IPiz98bvXq1ZQAnkoABF5p2QA4OeCdd96xMg Cg07s0ewMiAnQQN3z4cDN69GhL4sXiNmWXP8euXpJSJ24f1X8xiACdDSAS4JVXXrGPIgLwuH79enP88cdXZY/Iz+I6 wWu9eM9UCyRAebMATE2Nd+q1kEMAVF96fl4vkACY/0UCQA5feeWV5pprrjGTJk0y3/rWt8yXvvQls88++1ROgBABcM UVV/gtAFqUABQAhLQmAu7b8DeLyABKAEII6YAA0OUASPXUEuBnP/uZ+fWvf00J4GnglyUBRAQgGwBHvOlmb1LbLRIA Z8DjdVasWGHuvPNOTwSACsAKBP95JEDwE8sngbubDYA0fwT8SAPH9fHII49Ugn8pGRBhlNi/W2KOGrK3eevJuTb4Bx ABfvSVSM8G0A0AMzMFAgj+MN9D/mL+R+r/D3/4Qxv8A2QCQALgejj22GMrEuCUU04JowygaBYRBQAhLYMg380CEBFA AUAIIR0UAOj2jPROLQGw+HvwwQfNSy+9ZHeFhLTXOH5g3wqJbwugwrvEfkkACeZdCYDgHgIAx7zpBm+S8q0FwLJly8 zw86aaWYufC04CVHZ3U4I7LQBimFgQoE8+7PM2WMe4Y/yBSAAE/bg+Pvjgg6raf1xP+P6zzz7bXh+QRRAAAOUj6+bd 6JEAaJwNkCWKQgn+cE+A/MX8D3Dcn0gACIDzzjvPnHvuuRUJAAEAZs+e7b8AaEECUAAQ0rwEcEXA9g8MswAIIaRTAk AWfOj2DAGAmk+kfWLnRxZ/WPRhgYedIVcCIOhfOn1CBUqAckoA6Q2gwVGAbqM3SflGgIfA77XXXrOvgeB/+5/+5t/Y JjkFQEZ6d2yLegTpkrYv2QC4BnRvAEEH/7guIAvwiAARoGwEJSToIzH/O6fZ15YMAW+unSRvvf+nl1pi/C8dwT0B8h fzvwgA3AdEAKAUALv+X/nKVyoSAPeQIARAkxKAAoCQ9mQDYPefAoAQQjosAGTBh11/pHlKzacs/mTh50oAWcz/v//7 kE33/cPK/0MJUGIJ4IqANAGga7xFAkgmAOq4gV9BXH0JkKfJW0wLexEA2LXH7j3GW2cD4HoRGYDjQ3XaP0DAjwwAZI 2gdAQSAK+DkyRwvaGZHHoG+Hb9pJWJZF0X2QIg8SpTAPO8zP06+BcBcMYZZ5gTTjjB3jsgAnB/uOOOOygBKAEIoQAg hKRm+gj8m5REAGCxhxpfLNAl3dNN+wRaAmg2LbjNbF44ywqAkSNHmlNPPdWvQLHAN6cGjSkBQFklwK233mqmTZtmLr nkEnPiiSfaoE6f9w4BgGsBKd9aAGCMX1tylx1nSJ+gJIAzpjELAOzWY9deGkDifS/ZAADXy9tvv22DQHz8tw3/af77 uXlm+sn/YoZ/5Ws2WwQlIxAB+HmUFeB1IQBw/WkJUOZrqDqIry0DaHRd1BcAiRcCAPO9nv8l+G8kAPCz/onC2pi+GQ FQVVZECCkcJOgeAJQAhIRV4sMeHyUSALKwx0IOvQCw4EMmgJv2qSUAygOwyMMuIHCFAIAEEBHgQ6pvMxIg6wzxMjaP 0xJg4sSJFoxPVhYA6r3xvfg6fva/7r3ObFl0u3nzp3PMs7dPCqYcoFEWQGy7etitx649gnfs4mM3H8E8hIBuFAj69u 1rrjlmoL02IIiQMYBSEekXARD869IBCACRAGXOBsi3k58Um2M8OjseczhkL+Z7VwAg+B87dmyNALj99tsrAgB9AoCv IiApIgEymkUmXLAQ0lQWgAT+FACEhPF+Tmv2yfd2jwSA7vgtXb+xmMMCLy3tE2DhBw477DAzcOBAe/bz9773vYoIEP RZ4OVd/KXs6DW5Skxb15dxga8lABbnkAByrrsE/tLpHc3epImgSAAE/ijx+OV93/V0dy+fBMib7h1qFgB27SEAbOD/ SQNI7O5jlx+7/dj1l8AO1wPEELJDdIkIeOaZZ8zGjRsrwT4QASASABkpZbyW2iHw6gnC6mvLDwkg878WAJ/97GcrAg ClRRAAOElGrgE0mQX6uvBFCuS+L7iNQ1OvAf8WbVxwkV5cd3rHkEECIWGl/rMUoEcCQO/e6cBfwIIc5zyj/jsr7ROp 4RAAQ4cONUcddZRd+EEC6NeRs+S1CCjVbn9SZ/e+mRVixsK+bCJAxmLUqFF2AQ8BgLGWHX8E+nLGu3R6x1gi5dut9/ ZWAGSMc1InYIuxGaCMsTSARHCPXX7s9mPX/x/bltuvv/f8wzYrBKUh+PjVV1+1jeHwOp/5zGfs5yAB0FzyhRdesPzk Jz+x3HPPPd6niqemjlf+f5JG04QXpQAiAWT+Bwj+XQGAE2QgADCfaAmgRYAWAsFkAqQ0jEwa3Cp82bHhoot09v318f ygA36BfQAIiUP48e/RIQGQFvTrwF/vzgEs3nHEE3aIJfCX4D9LAEASyM6yvE6WCOi+DKhXv9viqjxpTPrv630GAJ5D AuA5gv0jjzzSIme8S6d3ZHRIvTc+d9FFF1VSe70WAEm+scy+XuJaoEEAYJcfu/3S6BMgGwSZIdIXQgsABIdC2g5wEu DfsepkABOGPIIEQNkX5n2NDv5xz9ACAPOISABdCuBT8K97xGRKgMwjIbUESJzrg42aCME8cPW9i8xv/vDXmgaAgLv/ hITf74Pv8Q4JACzG3KAfQZ2ALv833nhjFQjyRALgqCed8ilpn64AuPDCC6uCxjR6kxVQIOhvRgIUeL0ylAdoAQAOOe SQCrLjr8dQjnmTeu+gMgByjlmMQX/WYg27/Njtx65/WjCPTKBNmzbZ58ccc4yZNWtWhe985zu28SQ+H2rwr4O+pM5/ PgoAgLIvzPuCDv6BNAH8+te/bu8RWgJ4G/zX2/1vOF/UlgNwEUNIrQDY+6tHVySACADuDhISXtBPAdBFASBMmTLFMm 7cODNmzJiqoD0NSAAs8CTVU6N3foA0fHIbfWmwi3z99dfbwFKLgDIFfIUkQAuvm6eLeCcFAMYjbcwxNsjecM94R803 0r6x84vgz+seAIWDf046sljDLj92+93xx3OcG//kk09aCfD8889/XD7wz8D/3nvvtY+QixAAV1xxhTnnnHOqREAIQk C/p/NIAJ9EgDR8Rc8XSF9BB//g/vvvt/cayRA4+uijKwJg5cqV/o6xSXIJ5HoCgME/IdUg6E8TALoPAP9OhITZ4wOS j+/zLvUAEBGAXX0gwbx8rJHAHhIAjQEFSefVOz84Sg7B/Te/+U2bKYBHvSgUUCaA369LAbpbDtBGCZC0h24vCrUA0J 3YZcdfnouckcAMjd/STgHw8iQABv8tlwOkjbt8HiIA2T46CwCp4SIArr766ioBMHjw4MrzUEoAiggAH2SACADIHbk3 CJj/Mb/PnDmzIppvuOEGu/sPAaCzAJ544gk/540cAiBxMs4oAQhpLADAkPHTrAgQCcCAgJC4JAD/Nh0WAK4IwG6O5v LLL0+VAAj2Xdydn7Rg3wW/sxwLv6SH9Pb/3RUAEvRrESDB/9lnn202bNhgxwzd39EADjXgSAOXem8Ee34t5oul/edJ AuGkVCsBdt111xoBgEcE/rj+EFC6AiAkCWCaEAA+SQDM58ggkz4xmPMvvfTSyhwPHnvsMQuC/+XLP24YibEXGeBveU c+aZjukRPOGYR8cq+Q4B/PtQQIt0SMEAoAyfJh8N8DAZBWHqClAFJ0IQNmz55t5syZU7Pj4wb/2PnB4k+T9toIAKZN m1aiib1+nX7evgF5f6YMi3wtAOr1adA7vTj/HUfAoQmcPuYNgQBSvv26WbczK4OL+TwgsJ8xY4a9XiAARAzgiEAJ/v F5lCUF2RQwK+jP+FrZBQDmCH2UqGR8ybyP3gAYV7e8A5/Hz+Bx1apVXmYP5RMAWbK3d5lfhJRVAOiAXyQAoAAgJGwR wOC/hwIgrxRAYydw++2323OesZsH8Dmp+XRBacGQIUPMqaeeao477jgrDaQm+F//9V9LPLnnC/CbayzY+3TfegLADf 5xBjx2+vAoR8FJl3eAZm8I6vzKAigW/KeNV5JR703qS4Bvf/vbNuiX60uCRAT/knWERpOhTtqfngigJnKPJECaAAAo +9IC4Pzzzzc33XSTBcE+TgTQ3x+6AMhzb+CcQUh11piIAEgAec6/DyGEdEkA5JUCbnNB2eHB4u+AAw6wHeUhAOQEAU gAfA+CfzSHwvf4s3Oc1N/Zz7lALEO6b5YAkOBf+jIcNWRvCwTAsmXLzPDzploJgPFCXwiA52j2hp9FyrfvAiDtdIb0 sVLjyTKAwgs993OQSAgekUr+mc98JsoJ3TcBIOVCmEvcDADM7QJEMe4LmP8hAuT0gLVr13o41kUzAJIG9wwGOEV2ir hbFEc/AAb/hBBSEgEgiz+A+k0s5IAc9YSGT7Kjh10fEQCuBJAsAHDllVdWUoG9mOw/eVL/mKc8naJrd/96IQG0AHCD /xfvmWreenKuFQCjR482K1assFkAbgDndnH3uQ9A1tGM9QIzH49zKxtoLAoBMHnyZJtO3q9fv6iD/7ILADlKVgQA5h Hd4BWZXzL3n3766fZe8Oyzz1YC/4ULF5rnnnvO7LLLLqZ///5BCYC8PUV6eQxs2QP9tMBfzoWnAIhHFPPvQAghJREA mJSxQMcjJAA6O8tRT3iOZk/4mggALP5kAYigEjtAuhRApwH7IgGqOzmnS4B8C0TTYIe5dwLgP2dcYAUAHhded5at/4 cEABgjpHBj5w4nQcj57tLALQwBYOoKgEqar/H/bPeyLPYglyAAxo8fb/r06cMMgBL/WzFHiARIEwAQvkAEAIL+CRMm mPnz51dOkPF7gd+6BGBQVos++k2Cf/kcz4InhBBCSiAAtATAMU9ABAAWfEj7ROCP5zobQEsAEQE+CoC0QD9paoHYew Ggg380+Jtz4TE2+Afr5t1ols2+3IqAyYd93hx2wB5m48aNdqxEAMgZ7yICfBQARdJxteihBGgPuJamT59ud4VjndB9 uX4aCQD0fEG2FySAlAEcddRR5sEHHwxkZ68VAUCydv4R5GOnXwf6TP0nhBBCeiwARALMmzevSgKICJCjnaTOE2mf2P nB4k/XhGruuecev8oAUiRAbSO4JPciMelRKrkWADr1HwE+gAhAFgCY/53TzOkj9rKfR70vUn8hAXQGgDSFRKd3PyRA sztz1T9T72g3UkwA7LbbblFP6D5dNyIB0gQABK+UfOH7IH4x14cjAJqTABQAjSWACAAd9Oszo/l3IoQQQgHQYwHgZg Poc56xCIQEQNonFn7CzTffXOFHP/pR5ef9FABJigioDS7rnx7QWwGgd//110UECEjNBiIAXnnlFTte3/nOd8yNN95o gQhALTc6vZd/LIvu/meLGwoAEhv1BAAyu0QC4JECgAKgGQkgNf+s/Sck7hJB9oQgpAQCIC0LYOXKlTXnPEsWgNR71k Pqx316kycZzxvV+5dl908EQFrwnzbe+F45wgsC4IUXXrCfv+SSSyrgKDcgx7z5IADyp/4XEACcoEgkEgACESc3SPAP CSjzuogAAAEA6RvWQq5WAlTP4xQAzUoAXRLglgUQQnr/Hs3zuVaQkyDkkRKgPHMz/xYUAFWPTzzxRM05z+j2DAFQ73 UQ+CNoHDNmjJcCoHFTwKSUtb9YvOv0/0bjjaAfEkAQAYDxu+KKK8zVV19tx92nYx07IQA4OZHYsgCuv/56G/zjfT9t 2jQrAXDUq5YAcQiAtPk8fAEw5PgLOrrY5IKTkPL163B7dbSjTEfWj3IU5JDx0ygASjzuJGIBIMG/fA5lAHLUE8BRT4 3etGgAKPiVlmRqFnRJEwu+XgqAPMF/lgT4yU9+UpmUZecfR4T5k8nRzDnc6WNLCUBiLwOQeQTvfQT/OBlGZwLEIgDS M7rCFQAI/rkwJ4QCIK2JZ9G44up7F1VA8O/nEdMUACSSDADX3K1atcqydu3aoDt6Jw3EQPHg0pRaALgSQAsAKeEASP /3Q+YkTY5RAwHQg34OhJRpHsGcgID/yiuvrBIAuudLmBIgq6wrLAGA8UPgr+ECnZB4gsA0AdBqvw783G/+8NcKWgJI RgDnmd6OO8uxKADqLuLkazgnvn///hEPUlJ6AVAk+NcCAMjpDXrM5UhHeb7HHnuUeMJudnzqL+Z18E8RQGIUAO6cAG S+EGHoW8ZXqyIxSXrb86Xd939Z8GNBSAFASNwCoNUacb27LMG+PHdFAMehN+Mu/ViYBRC5ACARX3j/nIRvvfXWmuwP KeOQng44DQDceeedtg9EvV4QIWR/JDn+4/VDQpUAaQJAAn0tBWV+CEcAmEwhmPbeD2U+0BIAUACQRr0c+LcIJxAsGg QeNOaCmqM9NSIVtFzQQkAkALMAep8B4AogvrcpAEhkEsAVAFICgMX9mWeeaS699FIzefJky/Tp04M/450CgBCTKgFc 0PA1LAHQ3LwQyn2AC3KSd8eYwUK4AqBe004IADe4dz/G66KEAOivSW8ABv/llAB4rHeP4N+OAoBEIARkcQ8BgKPBzj 33XDN+/Pige0HEstgnpNUgkQEjIXFLAIqAcCSAu4sv9f9pfQBEAOg0cnkuSPAPdK057xvleh/L+GgRlCUBpJyDpRsU ACSSxX7fvn1tD4h+/fqZPn36RPnmZPBPCCGEVNd416shJ36VdehAvl4TQJ0BkBbsy/XgBv+knCLPHbs0ASDNHJm5QQ FACCGEEEIYNDLQC2hM66X/p/UBSKv55zXhlwTQWQBpAgCBP/o2SO8G/v0oAAghhBBCSGToEgCdSs6/DcUBM0P8FHla 4Ljfp09w0FnC/DtSABBCCCGEkIiDQP49CK8FP8fLLemQ3X8E/zrYx3GxgKfGUAAQQgghhJDIAgd5lI7vDPwI8a8UQI J/kQEI/PVzWwLwSeAvwT8FAAUAIYQQQgiJLHDQEoBlAISEk8EjXf8l/V9S/yEA5L1OAUABQAghhBBCIhMA7PpOSMBB 6j+DfH0CAEsAKAAIIYQQQkhkwb97djjrvgmJRwiwCSAFACGEEEIIiUgA6HPiGfgTQggFACGEEEIICbhmmH8LQgihAC CEEEIIIYQQQggFACGEEEIIIYQQQgHAPwQhhBBCCCGEEEIBQAghhBBCCCGEEAoAQhrApj2EEEIIIYQQQgFAIhEAOLeX EoAQQgghhBBCKABIwBw05oKKAEiDfyNCCCGEEEIIoQAgAWUByOPkBZsskAJ4hCDg34gQQgghhBBCKABIoCUB2z8wlA CEEEIIIYQQQgFAQgz8dSYAgn4pD4AEYDkAIYQQQgghhFAAkIB2/nWgL59jk0BCCCGEEEIIoQAgAQkASft3ewLg8ywF IIQQQgghhBAKABJoGYA0A9QCgJkAhBBCCCGEEEIBQAKTAa4AkM9RAhBCCCGEEEIIBQAJBNnt1z0A5IhACgBCCCGEEE IIoQAgAe3+QwJI0M/gnxBCCCGEEEIoAIhnHDVk71wCQJCjAHkaACGEEEIIIWTIkCFVxBio6/8oAIiXEiBJEouu/xd0 HwD+/QghhBBCCIk38N+xY0cVsUiApM5/FACk9AJAkOD/6nsXmd/84a81DQDd4wEJIYQQQgghcXHggQdWBfyxZQEkDf 6jACCl573nH7ZAAmgBsPdXj65IABEA3P0nhBBCwt7Rk0zAWFN5eS0QUh8E/pAAMab8uwIgmB4ADPDiYuqxg815551n li1bZiVAmgAIvfkfb/od+rsm/JsSQogvwb9O4125cmVUIqBTu3iEEFJ6AcAz3uNEBMCsxc9ZCTBk/DQrAkQCCLT+JC +TD/u8JdadJEII8XH3XwMJcMMNN9idPqb0xiXvW7lv875PiIcCwE31Dj34I8YMHvxxFgCQcgAtAUKfzGn828fC686q 8ODlY2yGiYgA/n0IIcQvKYDgHxKAab7M4Cvys9u3b4/6vh/DNXPooYeaESNGmKFDh5qRI0fa8R40aFCU84OMd09OAd A7ta3s2ro/x6yAuCSAjL+WACD0iZwCoD3B/6o511j+697rzPDhw83o0aMtMdeT8roihPhA30F97Vwti/mYewGwhK81 AbBlyxYKgID//8aOHWtee+01s3r1avv46quvmp07d5rZs2ebfv36MWOoWwLArdXW57bL11gaQPKOM7JARALEvAggxY P/15feba+bY4891gb+K1asMHfeeWd01w9rSQkhPoFFOxbvWMRjMa8X93327RP1gp7XR3MSYP369ZQAAQb+Evzr+ECY OHFi5Wsxbuz0RABoCaDPbpeADs9bLQ3gMXDxSAA8MugnebOO5DhJXDN4fOyxxyq9JYafN9X2l5DrCWUl3P3v/bjxGi aESLCGRTsW72mLenzti6d/0WZ1gdiyAHV6b6xCoN56MG2TiAIgPAFwyy232LkAIP0/bWwHDBgQ7KZhHjHYkxIAd0Gu ZYAc49bqolELgBiaw8XI8ccfb8cUj3H+DRLnkdSbDyRbBHWiAiZ+7PpDAOARwf/2P/3Nfh7Bv/SWCO+6SSrXTVkFgJ vlw2uZECIL9l0H7Jr6NSz2n3/+edsLYNSoUeaQQw6JOqMrpMAub7DWSAC4Nf+uAIihl1ToAgCBv6zzYhU63Xz/J60u 9LQEaCULwJUAIhWYFRCmBLj00ksj/hskQQuAVt+vuIlv2LChIgCnTJliHn/8cXPZZZdVSQABwT6aAQL5nO8SIMkM/s t/7bCkixBSFMzrTz/9tJUAMTYFDEEAyOkOuuyjHenaaTX/kjkiskg+zqoPd/9t3cjyaHu6dgu/z4fratKkSRUwrmnZ QsD9WmxzQFdLANwdeb1L75YEtLro0xkGDP7DTu2G0Y17VyTsEo+iP3vQmAss6Pgqxv/ss8+2sghAAFxwwQUVASANJC XYf23JXWbzwlnm//3fhypiwOcskSQz+E+8uA441xFCsnaEXXbbbbcK3P3zM/jfsWNHJchGw0f0fEDZR1rmR6s1/3hE Lwn5GL8Dv2vjxo32dzf693Vj/No9nu5rpX3cSACU8fqSoB8C5/XXX6/ioYceMi+88IJZvnx5pRkgHnEtCL6LgKTF/7 omAGTXX8sA6QUgsI6U5A0S4y4HMMGVA7Ry1CeCf/xcmgT4/ve/XxEA48ePt1/7zR/+WgEnSuBzb/50jnn29kmeC4A8 EoDzCCHEzzRfLObfeust89vf/ray0EcJgJQBiAiIoc43lOaAboCNsUPDx7Rd+04IAPncG2+8kXrd4N+FLIJuC4B27t 42EgD1Xr/s1xXmAEiAYcOGWbJEYRoYV9+PhWzlvd/suCbNBuZpC/x2Bf8kHgkgtcIvvfRS1NInCWxs6x31mTXOIgDk e7UEAJAAbiYSgnyp+xcJ8Mv7vhvIwvFTCZB4JooocAmJd4e/mUyAXYbtYoEEECHAUoDEq3HXAgBHPaYF6JA/7RIAmz dvrnl9BIP43WkCYM2aNR0tA3DPa++VAKj3+RCbTPI0sR70AOACj7Sj54OUeriNIEm4pQH1BIBIoQkTJtgFRFrzUTcT yZUAoWSGJAGMN9/PhMSZ4s+/R1zjvnLlyqoMALf+H8+R+dHMtSGvN3jw4LoCYOvWrXbzIE0ALFq0qGsCoFMZAHle32 cBgPEV+vfvX3key7zSzWyghBMX6RVI7XYD/7i6hydRCYBGTT1FAGghlFZ2pPuO6K9pCcD3V/myfPg3IYTkYe+99zZ7 7rmn6XNEH8uuR/SNMgvAZwmA56tXr64J0FH20awA2LZtW5UAWLt2bc3ro4HwiBEjaoL/JUuWdLwJYFoWQBkEgI+7/w cddFCwNf+tlgpRABDvQe0/JICk/+usgDgChsTrXd5mMz6yjvrEtaAlgAT4uslo2vGjIgD87/6fBDvmzOwhhBThqquu sqAUAMHb8OHDoy4F8CF4wz0YZRvSqFcyAHTaPso7WskAwK6wfLxu3bqaYwDlDHn9s+gaP3PmTAoAz6RSyDX/ZRCEFA CkNLvDRZvGEb8lgHvUp0zuWgLI98j3aSGQJgCYelrefgCUAARNnqKvueR1UFgE4CjYPgf1sbuCMS/2fbh+EPxL74Y+ +/apCshbFQDYDdYZAEuXLq0cA4hHdIvf74T9ShWc5Qna2/Haodb3s8yohD0ACOlEejj/HvEEhFlHfWJST6v51x9rIc Cgsjxj2ur3kPAFAAKAZn8eP4sgEOC1fAsI23Fsk4+7wlyox8sXT/+izeKAGMDJDniOZo+tCgC8hhYAkAyLFy+ufFzm bI5OCgBKRkIBQLxNDScMGmXRmNYLQAf+vGbKU+vvnvzgfizZGvybxcUtt9xidwHlnOdWsgAgAHbffXcb+ON8aB8EQL vPbfb5qDgSHyjdQEbA008/3ZIAAJs2bcoUAHjE7ymbAOjE+58CgFAAkKCCCP4dSJYEcBsB8nopV/DvnvCQJgQaNYEk 4TF27Fgb9GP3T3b/ccYzviYL+bwg2MfPy8+JBNC/y4fgv9l07rSfb1dqMSGdFACjRo2ywTkEAB4hAZp5LX0KAAL9NA FQtmyTdjZyqxfwM/gnXRcAeLP523SLEBJKijkpjwBwA31m+VAAtEMAIOCXn8Pr4ONx48bZj4877jj7u2ITAAwASNmR 4BzPIQGkDAinPRR5nRdffLHyMzr4l99R1lKTrPdps3MABSApTQaASACA55MP+7yFf2BCCAlfALinO6T1Z2DwHy4I8H fs2JEa/EsDMCzQdQMwBPJFUvjxc2jy5QoAKSmYMGGC/X296Bafp/N2o+Zg3AEkMSBlAHiOox7R5LGIAMDP4Pn8+fNL We/fShDfyZ8lpGMlAGlHNSy87qwKEAJsBEMIIeH173ADfpZqxAOO1kLwDwkgn0PQ3+gIMBznJd+Td42xfPnyqi7geD 3dBAyv55YCQAx0a5e/UXDfTgGQtwaYQQIpW2lf5ZSAI/oUEgA4DlLe72Ws9y8UeDXx/qQAIKXtAYA39pDjL6gsCl0h wD84IYSEmQHglgK0I7CM+++beCUA9HiNGDHCrF69uuq+j+fYsdcZAOjqXUQAuOeAa6FQ7xxw998XkgAoko3AOYuUAS 0AkA2QVwI8+uijVQLA17ii2XnAtyMhSWQCQO/8yNnc/EMTQgglQBGOH9iXf18Pg38wdOjQmt19SeHXAqBoBoBuAuYK BfkcxAMERJ5/ZyeC/zILgF4EDdwEIlnsekRfu6s/ZcqUht/b56A+5pFHHvF2179I+VA7vjf0LBLOKSUTAGmlAPwjE0 JI2ME/OvxLl3/BlQBaDOdpHDtrwjHMAij5PTQrsB45cmTN7r6k8Osd+/Xr1xcSAPr73dfTkgACIu+/tVcCoJldvDw/ X+939yKAwJhs377dbNmyJbVUNM96EcEf8Dnlux1/9xCDP/TswNjmEQALFiwILq4oWgIQ+j0PfWFAvXkCcwnmlBBjzD xzRVvnE0IIIaSV3X8tAdIaAOqTAFAvrmvG4xMASc7g3k8BgIXZzp07U4PzdgqAtCwD9/f2QgDUC867IQCK/lu7tWOH 8RMwdtu2bbOPkEUA57zjYzR7A9gdRto3dn5DCP6SFv8LOehr9D1l7vLfDQkQevCPci4BmV3IFoPgxXwA9NwR4gZzL+ YBCgBCCCFtkQC6IaBIAPm62xtmzf3TmAEQqAAYNGiQmT17tpk4caIZMGBAJQjUWQHtEAD69fB78Pvwe/H7y5AB0Chl v50CoNEisQyBpN7FQykHQE8HeS7gqDd0e0fQJ8S84GfaN4lh53/33XevmQtkfgg9s7wX738KAEIIIW2RAC7uCQF4lO D/R9MuNaeeempm8I8eAKELgMY39vIvdjBGaePUr1+/qh16BHFpO/aSGt4ocHS/TzIAJC1cPsbvLfLv7FTKZjONAYte K0WOFuxWIMkSUEJIs6n/sc45PSnP4oVHCCGkHRJA7/jrsgAgUkALAGnoFmPw3zj48z+Aco8BdHf8pT48jwBwvy8tI6 DsC8BOCIAyjnnemn/NLsN2sUDoLF261J7zjk7v0jE+lsU8d/9JjEyaNMmm/kMCDBs2zJJ37gihJ0Ar7/tm5wkKAEII IR3pCSBBP5r+SQkAniPAzxIAndqp9UcAJEEE/41S+NMkQR6R0Oj1fK/17eXrdbrmX2r9N2/ebFm7dq1Zt26dDfg1oa T+J234j/cVElMGACSAoHsCSD8AzB8h9gToxRxBAUAIIaQjmQACPo/AH0ACQAAIbhmASIJY/l6xLPLbHbBTAJT/2tG7 dBLMp6ED/tCOecszVgz6CfmUcePG2YyArDnD/XzI/QA6Oe9TABBCCOkaIgIQ/OPm3adPkvp1/q3ClAB5av679To+Sw AGioQQQigACCGEEFJqAdCOWs12vQ4FQHczAXYdsGvq17Cjd+ihhwafBcC6f0LqM3bsWHPccceZCRMm2DnBneNx2ktM pwF0ct6nACCEEEJIV4PBXr8G6e6Yo24XxzSmpfTizO/FixdXmv6FnNbLEgBC6oO5QnDnCswh7mkyMZUAtHOOoAAghB BCCCEdA8czbty40bzxxhu2fGPr1q1mw4YNdjG/3wn7BdH0r+guv17MM/gn5FOGDx9uswEwP6xevdo+7ty508yePTvz qNfY5gwKAEIIIYQQUmr6Dvq478fIkSPN0KFDzYgRI2yab4y1t9zxJ6QxmB8wT2C+wNwxaNCgaOcKlgAQQgghhBBCCC GEAoAQQgghhBBCCCEUAIQQQgghhBBCSgpOAog+QKcAIIQQQgghoTBkyJDojvxLq+/ltUBIOjt27LDzBOcICgBCCCGE EOJZsO+yZMkSM3PmzKgW8p3q6E1IqPOGSABNbAKApwAQQgghhBAvF/I4AnDNmjVm0aJFUS3mKQAIaW3uEGLLCKAAII QQQgghQWQBxJrOy8CfkObnjphLAXgMICGEEEIIIYQQQigACCGEEEIIIYQQQgFACCGEEEIIaZF9993XEu3f4NOIihAK AEIIIYQQQkjYAgCNHaOVANVRFSEUAIQQQgghhJBwBcC7775rnnrqqTglQG1kRQgFACGEFJqUksTCvwUhhBBCAUABQA gFACEkcAGwffv2qCUAj4gihBDimwR46KGHKAF4/yYUAIQQUlwAbNmyhQKA1wIhhBCPBMDixYvjlADpN3JCKAAIIaSI BFi/fj0lAK8FQgghHpUBRCkBsm/khFAAEEJInpp/CgAKAEIIIZQAfmcB8D5OKAAIIREE7+2o+XcFQOiNAdOCfQoAQg ghPguAAw88kAKA1wahACA+M2TIEEusXdqTT/7jtfAx/fr1M6+99lpbBIBb84/neO1DDjmk6mP8zhCvhywBoD8fy/Un 84wQ6zzD+YYQ4psAePXVV+OVANmLHF4fhAKA+Lso37FjR4WVK1dGJQKSlP9iFUB4PnjwIDN79mwzceJEc8ABA9pe84 9HLCTkY/wO/K6NGzfa313v39aNgD/5h7oSPuyMBKgK/j9Uv+8fSUdlRK+vLz3PgFgkQFLnP96DSJlBgBfVTm8NDPLS BEB0EqD+IodzBaEAIP7vygFIgBtuuCGKiT1p8F8sAkiCMQTmO3fuTN2174QAkM+98cYbqdLJ/fd1cvw7lbZfTwA0en 3fr0XMITrgjy0LIPb5hfgvAPDejVcCJDa+Y5CXngUALrvsMkoAXh+Z7L///hZKRAoA4klQiAkdEiBWexarABg5cmRq gL58+fK2CYDNmzfXvD5KBfC70/59+Fq3BEDWuHdDANT7vK/XogQPMab8xzaXkPCCfwR48QqAhAIgRxZANBKg8WKH80 aGQIxXAPRm/qAAILlA2jUCMARfkvofUx8ASbuOdYGOsXYzANz6fzx/6623mrou5PUGDx5cVwBs3brVDB06NFUArFmz pqMBZDcyAPK8fogCgBBCAUABEJYE+N3vfldTChBHJkA8EmCPPfawRCsAPl2EUQCQ8EDjNdR7I+UbkzoCtdWrV9vHGI 54qZuc+1ESjQBAyYcWALgG3AD9t7/9bdMCYNu2bVUCYO3atTWvv2HDBjNixIhUAbBo0SIKAAoAQkgPBADWBhQAnH+1 AHjzzTetmBcJIAIgfAmQa9ETjAB4/fXXmxYBEvxPmTLFbwHQtAjQcwcFAClZ4IdAHw3Y9M6/gK+d862zzPDhwy0hC4 Csr/35z3+OIvjSEkBnAOi0fdwIWskA6N+/f+XjdevW1RwDiO859NBDa4L/JUuWdCV93C0DKIMACCn4x9hC8CDLQ7KN Bg0aFGUpQL3rjJAyCYBbbrkl4iyAhBIg5ZoAKMt75513qgSAKwHy4O01kUsC5KH8AuCmm24yDz/8cCEJIME/5o5gBE Ch+7Ub/FMAkJIFfSCt0zs+jwX7888/b/sAjBo1qnJsW3B/hw+T3NkBIV8LuukjLL8OyFsVANgx0BkAS5curVxPeHzh hRfMKSePqflZfG3mzJndFwAf5WsM2IoAcHsOQDaFuvs/duzYquwiXA/IOkL2UZmOf+xVthHvR6SMgd4ZZ5wRsQBIoh cAaQH7mDFj7PoAAgBlAJIFIALg1ltvrZIA8jyLcsuBjKA9/+KnRcojAWbNmlVIAogAwPwxbtw4c+aZZ0YmAdIEQEIB QPy6ATz99NM2OIyxIWBMC3W36SOyPyCA8PnddtvNPh82bFjLAgCvoQUAJAMWmL0WTO4Y6+wP+e+jjz5q+bXxGmkCIM TrC4G/BP9pWUbIPnL7TYQ6jxTNQOplzWerdZ/e0lK6Z/lStTWtCAAvJUAb0ndjkwBuAI7xB+PHj69w5JFHVgkAlAKg fE8EwLRp0+y8juAeG0cS6F933XWFwDXXfRmQMzDvmgAohwxoRgJoAQBp5K0AaFoCUAAQz7IBXBD4CVH+XSLepUPZB4 QABFArAgBs2rQpUwDgEb+nbBkmaTu1FAD5wY0fwb1kkqQF+QMGDAi26WgeeVi2MZeFntR9Ri0APH8/IkjD7iw6toOi MgALeAR806dPD0MANLGDF4sAkCBbOvoDET8A18CNN95o+cY3vlERAKtWrTJz5861iCC45JJLrAA499xzrfzVWQA6uM 9CrjNN56+5gsG46awEqP115RAAP//5z81dd91lnnnmmbr3B53+jzG98MILzQknnGAuvvjicLIA6s4jWcF/9yQABQDJ DRbpOOYNnd7R7E0WgQj6pAxAREAMi3Wm634sAGDwZezxiGuh2etLBAAC/TQBULbrqp3jXy/gD/W6wpj7W+cZrzzEwg 41n7r5U1QyoKWgsXwSQGq0RQS4MiBLCIgAQND3/e9/PzwJ0HBsk2gkgARsAjL2XBGAawBMnjy50gPg7rvvNn//+9/N X/7yl8q1deKJJ5pTTz3VSgAACYB7PASAXEeNAv/ulwJkBd2NJUDNp1uQANm/25RGACAD4LbbbrONnLPuDVoAQB5h7I MUAJnzBwUACSATALu1AIGfCAFdKx462K3VO7afLujjEAESnOM5JACuATzfe++9C73Oiy++WPkZHfzL7yirVMoK1IsG dfUC/lCl0qRJkyrIGKfhfi2mEoCyZgFgkYd0TxHBUWUEtLxzXM5SAKRnY0GuZQACPZAmAhoJAG/eq8XeqFEKgLT0fw nG00QAArrDDz/cBv9f+MIXqpBrC18/7bTT7PdqAeBKAHl9HfiXpedDIxGQFvSnioCcwX+ZGwOKBMDuPwQAMgFwn5g3 b17VvUEH/xhrzB8Ye5QAeCsACkmAJIdAogAghHiElAHg+Z577mmuuuqqQgIAP4Pn8+fP97KhZCu79jHs+LuBPzIAdA AJEISg4SOyjaQZIB7Xr19fIRQRkDT5X9kkAHZ9QCvHQYW/4+OHCNASoJ4IkGZvqPdGyjd2fdMkwGEH7BHOmBbcqQ19 E6CeCBAJIALgd7O+WBEA8lxLABEA8rP1dv3L8zdoLAKqkgH03PCJCMhzXdW+frmzw7Zu3WrvDTfffLOZOnWqmTFjhp kzZ4792n777ReuACgwh1AAkODADi6CuD5H9LEcccQRUab06uyA2LJDJBsA419EAOAoPwn6y1jv38xOLgVANggWIQEk gyhr9z8NpJZu377dawnQzhMjei0BZKcHOz9Y/L388st2oUcJ4LcEqCcCsIjXJQJSx50lAcDpI/YKqCSgsRiI5VSANB EgATwCfFw3bhaAgHkcEkkyAbQAcHf9px47uKRCqb4ISOpcV3kyCHwI/PU9AfM/7gVaAoD77rvP/OAHP7DfI/OLKwAu v/zy8AWAoQAggYKgD2AnGEEd6sRjreuNsTmgFgC4BvJKgEcffbRKAPga3GUd5VdUAHAuyVeGxL9H7xd8kvIJRASIBA g+G6Dp+vHySwA3GwBIV3dIOBcEexLE6eBt4XVnmWWzL7ePXmQEND8xmZiPBdQiQAI8KQVAoI9HHfyLHIAAaBT8/+eM C8ycC48p+fWTvbubJQGSXKUkfl1DmPcx/y9YsKAiAa699lq7FkSDR2QE4L4g5R5aAESTBWB6nz1EAUA6KgKmTJli+h zUxxx00EHxBSmRB3TI/oAAwjXQ6HtxjTzyyCPe7vpn9YZoVgDEBBo/Cv379688jyXID6GRKBZzaPiETAAs9rDow+IP n1u9ejUlgKcSAIFXWjYATg545513rAwA6PQuzd6AiAAdxGEjYPTo0RY/3tMpu/w5dvXcgE4+jmVDAGPrZgOIBHjllV fso4gAPKKk6/jjj6/KHpGfldd68Z6pFkiA8mYBmJoa79RrIYcAqL70/LxeIAEw/4sEgBy+8sorzTXXXGMz/771rW+Z L33pS2afffapnAAhAuCKK67wWwC0KAEoAAgh3oNFH4L7PAIAN4rQgr2iJQAxXyuQhKHX/DfbD8AXCYCFHlI9tQT42c 9+Zn79619TAnj6/s6SACICkA2AI950szep7RYJgDPg8TorVqwwd955p2fv5WLBfx4JEEOGVlo2ANL8MZ8jDRzXB6S/ BP9SMqAbSIKjhuxt3npyrg3+AUSAH30l0rMBdAPAzEyBAO51mO8hfzH/I/X/hz/8oQ3+ATYHIQFwPRx77LEVCXDKKa eEUQZQNIuIAoAQEmpg1+h7ytzlvxsSgCn/tan9odX8t7O3SFkXfOj2jPROLQGw+HvwwQfNSy+9ZHeFhLTXOH5g3wre jXXhXWK/JIAE864EQHAPAYBj3nSDN0n51gJg2bJlZvh5U82sxc8FJwEqu7spwZ0WADHMVwjQJx/2eRusY9wx/kAkAI J+XB8ffPBBVe0/rid8/9lnn22vD8giCACA8pF18270SAA0zgbIEkWhlI3gngD5i/kf4Lg/kQAQAOedd54599xzKxIA AgDMnj3bfwHQggSgACCEEEJY8+/Vgg/dniEAUPOJtE/s/MjiD4s+LPCwM+RKAAT9S6dPqEAJUE4JIL0BNDgK0G30Ji nfCPAQ+CGrB6+B4H/7n/7m4Xs5pwDISO+OrR8AgnRJ25dsAFwDujeAoIN/XBeQBXhEgAhQNoJsQvSRmP+d0+xr+3U/ yO4NkHZ9JBlZYb7eEyB/Mf+LAJBTgDC2KAXArv9XvvKVigTAPSQIAdCkBKAAIIQQQoh3Cz7s+iPNU2o+ZfEnCz9XAs hi/v/934dsuu8fVv4fSoASSwBXBKQJAF3jLRJAMgFQxw38k3rFBEDMEkAEAHbtsXuP8dbZALheRAbgRBid9g8Q8CMD AFkjKB2BBMDr4CQJXG9oJoeeAb5dP2llIlnXRbYASLzKFMA8L3O/Dv5FAJxxxhnmhBNOsPcOiADcH+644w5KgA6PLw UAIYQQQtq22EONLxboku7ppn0CLQE0mxbcZjYvnGUFwMiRI82pp57qV6BY4JtTg8aSl35oCXDrrbeaadOmmUsuucSc eOKJNqjT571DAOBaQMq3FgAY49eW3GXHGdInKAngjGnMAgC79di1lwaQeN9LNgDA9fL222/bIBAf/23Df5r/fm6emX 7yv5jhX/mazRZByQhEAH4eZQV4XQgAXH9aApT5GqoO4mvLABpdF/UFQOLFPQHzvZ7/JfhvJADws75n/yVF7gspvSK8 EgAYZC6ECCGEkHiQhT0WcugFgLUAMgHctE8tAVAegEUedgGBKwQAJICIAB9SfZuRAFlniJexeZyWABMnTrRgfLKyAF Dvje/F1/Gz/3XvdWbLotvNmz+dY569fVIw5QCNsgBiKwPAbj127RG8Yxcfu/kI5iEEdKNA0LdvX3PNMQPttQFBhIwB lIpIvwiA4F+XDkAAiAQoczZAvp38pNgc06Oz45sVAJC9mO9dAYDgf+zYsTUC4Pbbb68IAPQJAL6KgKSIBMhoFpn4JA BwI2/25/GzaBwG8Fo+HiHXys3anSjYIIwQQkjZA3999BcWc1jgpaV9Aiz8wGGHHWYGDhxoz37+3ve+VxEBgj4LvLyL v5QdvSZXiWnr+jIu8LUEwOIcEkDOdZfAXzq9o9mbNBEUCYDAHyUev7zvu57u7uWTAHnTvUPNAsCuPQSADfw/aQCJ3X 3s8mO3H7v+EtjheoAYQnaILhEBzzzzjNm4cWMl2AciAEQCICOljNdSOwRePUFYfW35IQFk/tcC4LOf/WxFAKC0CAJA TocCaDIL0hoFByMB3MahqddAyQQAmnigwQdu8vLYigDYfffdbeCPi8AHAdDOgL0sx0Cx8RYhhJB6Qb8b+AtYkOOcZ9 R/Z6V9IjUcAmDo0KHmqKOOsgs/SAD9OnKWvBYBpdrtT+rs3jezQsxY2JdNBMhYjBo1yi7gIQAw1rLjj0BfzniXTu8Y S6R8u/Xe3gqAjHFO6gRsMTYDlDGWBpAI7rHLj91+7Pr/Y9ty+/X3nn/YZoWgNAQf40hYNIbD63zmM5+xn4MEQHPJF1 54wfKTn/zEcs899wS3Xq2+VpJG04QXpQAiAWT+Bwj+XQGAE2QgADCfaAmgRYAWAsFkAqQ0jEwa3Cp6KgAw+UuHV9n9 HzZsmP3a4MGDC70Wgn38vPycSAD9u3wSAEWD97Td/14KANzIcQRX1vFcjSZcnO8OcMyblxNwm/7+zOIghIQU/EtQrg N/vTsHsHjHEU/YIZbAX4L/LAEASSA7y/I6WSKgdzKgfpDX1OosaUz67+t9BgCeY22G5wj2jzzySIuc8S6d3rG2k3pv fO6iiy6qpPZ6LQCSfGOZfb3EMW/IehECALv82O2XRp8A2SDIDJG+EFoAIDgUiq5DQxAAiQlDHkECoOwL875GB/+4Z2 gBgHlEJIAuBfAp+Nc9YjIlQOaRkFoCJM710SUBIDf9TgsABPzyc3gdfDxu3Dj78XHHHWd/V9mCwU4JgLTX62YwKW80 mHwBf/9t27bZR0zQYNOmTfbjF1980bJkyRLz6KOP2vQ/eeN6PRG3+B+DBkJISKn+CMgR1Ano8n/jjTdWgSBPJACOet Ipn5L26QqACy+8sCpoTMOVAb1I9c8TsBeSAAVeL2/zsG4JAADJL8iOvx5DOeZN6r2DygDIOWYxBv1Z60rs8mO3H7v+ acE8MoGwrsTzY445xsyaNavCd77zHdt4Ep8PVwYkmccB+ry2lL4uKPvCvC/o4B9IE8Cvf/3r9h6hJYC3wX+93f+G80 VtOUDXSgCGDBmSerOV4P/QQw+1H2PyhwCQgUEgXySFHz+HtB5XAEhJwYQJE+zvQxMR/XP4fLcCwEbBf6sBezMCoNMT gZ5YMTagf//+lefC3nvvbfbcc8+qxUBoZpbBPyEsR4oNLMYk6J4yZYoFYn7MmDFVQXsakABY4Emqp0bv/ABp+OQ2+t JgF/n666+3dE8CJPl2/JuRAEnz9EoCiADAeKSNOYJ+ZG+4Z7yj5htp39j5RfDndQ+Ako9Rmedz7PJjt98dfzzHufFP PvmklQDPP//8x+UD/wz87733XvsIuQgBcMUVV5hzzjmnIgKwBpXnvu/8JwUkQBkyhvOA97w0fEXPF0hfQQf/4P7777 f3HMkQOProoysCYOXKlf6OscknkOsJgKSNsUwhAYBH+RyCfgTjemGGRy0AECTK9+SdGJYvX14RAPJ6kkIuvzOtFMD9 93VaAOQJxtslAPK8wVt983ORTQjpNtLwtV6JEcqQUI4UZJpnjnm7DAs7LMZcsKsPJJiXjzUS2EMCoDGgIOm8eucHR8 khuP/mN79pMwXwqBeFGrk2uicBktZpa/Dv7hQmPRMAuhO77PjLcxkbGS80fks7BcDLkwAY/HdkvSmfhwhAto/OAkBq uAiAq6++OlUAhCABjDNtFBEAZZQACP5xtKsIAMgduTcImP8xt8+cOdPeXyCZb7jhBrv7DwGgswCeeOIJP+eNHAIgqS Oc2ykBkmaDfzBixAjb0MG1d9ix1xkASBEvIgAQ4EMcpAkFGXCdddDo39mp3f9uCoA8C8JW3/xFav41yNIAkDRLly41 8+fPt29aEEPN/0cffWTh7j8h+dGd3nHPQOYX5C/mdqDLjkIUkyFkEYkIwG6O5vLLL0+VAAj2XdydHxfdQBDgc/idcj 30th9A0kPS/g29EwAS9GsRIMH/2WefbTZs2GDHDN3f0QAONeBIA5d6bwR7fr3Hi6X950kC4X2hVgLsuuuuNQIAjwj8 cf0hoMQJARL84/PISorqfpHy9bIKgLeenFslATCnI4NM+sRgfr/00ksrczx47LHHLAj+sUbA5zD2/pYX15cASUqtf6 1HTrrTAyArsEbdhru7Lyn8WgAUzQDA9+sMAC0U5HMQDxAQef+tMQiAdkmAtJp/qfXfvHmzZe3atWbdunU24NeEkvqf tOE/3sQJqb/zj9Ne3DIiKS0KPSMppPkjLTsAIgApupABs2fPNnPmzKnZ8XGDf+z8YPGnSXttBADlah5Xv04/b+lA3p 8pwzWiBUC9Pg36fYzSTRwBhyZw+pg3BAJI+fbr/Z5XABSr9ybZIMCfMWOGvV4Q9IsYkPsFgn+RjugzEfQ9o06GcBnv ISIA/rDy/1QEAOYIfZSoZHzJvI8Y010LAHweP4PHVatWeZk9lE8AZIndZuaYNguAkSNH1uzuSwq/3rGXHZy8Aaj+fv f1tCTA4JddADRTn5/n5zslANLSsySYT0MH/L52+i86HvUW8bxJE1Is9T/WcqXQ54y0wB2NncDtt99uxT528wA+JzWf LigtwP381FNPtU2AIQ2kJrjc458vwC8iCPSCsMwCwA3+cQY8dvrwKEfBSZd3aSKMoM6vLIBiwX/qGjKj3pvUlwBu8z +5J+AaQvCInWQcGxiyOPZtPYrxccsAtAAAKPvSAuD88883N910kwXxHk4E0N8fugDIc2/omQDAH33nzp2pwXk7BUBa loH7e3shAOoF590QAEX/rYQQUhbQ2BVBICSAlBHlLTsKpSdAs3O1r3N8WoCvQc2n7PBg8XfAAQfYjvK4n8sJApAA+J 5//dd/tc2h8D2+LfySOoIgzwKxDPf6LAEgwb+UZRw1ZG8LBMCyZcvM8POmWgmAMURfCIDnaPaGn0XKt+8CoHrs6r1n 1XiyDKAl0FcEAmDy5Ml2N7lfv35xlUx4kEUmEkALACkXwlziZgBgbhcginFfwPwPESCnByAb2T/ZUzQDIGlwz0g6Jw AksHaD6kGDBtnUvokTJ5oBAwZUBlhnBbRDAOjXw+/B78Pvxe/P8+/s1EIt683WSQHQ6A3e7je+LLgPOGBA6tew649e DMFnAXyYeDvpElLmDABIAEH3BJB+AJj/Q+wJEGt5kRwDhfpNLOSAHPWEvjHSzAu7PiIAXAkgWQD4Gbc/kA9NoLIaQe UXAOXJAtACwA3+X7xnqq35hQAYPXq0WbFihc0CcMcqbUfXVwmQFvw3s5FEiq9VcW1BAIwfP9706dMnvr+BB/cJjBPm fzlKVgQA5hHp+SL1/zL3n3766fZe8Oyzz1YC/4ULF5rnnnvO7LLLLpWecaEIgE/njvo9RbLmmrYLgCxg2fQOPQLAtB 17aSzX6MJwv08yACSwlI/LYveaORmgaLp5O44WbOXNir83pEvaThz6PeBNLE3/YuvSzeCfkNbBcXLICMgqN3I/H/IC rmgZko8LdanfhwRAZ2c56gnP0ewJXxMBgMWfLAARVGIHSJcCCD51/q7u5JwuAfKVBPT2GqknAP5zxgVWAOBx4XVn2f p/SACAcUINN3bucBKEnO8u6d1hCID62ZmVNF9uIrQNXEvTp0+3QWGUEsSTawjvf8wRIgGyBACkrwgABP047h1NxuUE Gb/XAo2zvIoIxp4IANe8p+34S3f5PALA/b60jICyD3onBEAv/38gWzZu3GjeeOMNK2i2bt1qO/pCDJxy8pggmv41u1 P35z//mTdtQghpQgBoCYBjnoAIACz4kPaJwB/PdTaAlgAiAnw6Azyped5sFkBtSUCvBIAO/tHgb86Fx9jgH6ybd6NZ NvtyKwImH/Z5c9gBe9g1BcZKBICc8S4iwEcBUCQdV4seSoD2CYDddtst3rnVk2snrwBAthckgJQBHHXUUebBBx8MJN ZoRQC0MVZt98CmpfznCdzTvqdoCUGZd3HK8nrNMHjwIDsGaPyIxRhOYHCPYQx6Yv1Hwh1/QjrA2LFjbTAHu485xZ3r UfYVw85/TOnBGMt58+ZVSQARAXK0k9R5Iu0T1wYWf7omVHPPPffYn/Hp+C9XAtQ2gktyS4CkR9eKFgA69R8BPoAIQB YAmP+d08zpI/ayn0e9L1J/IQF0BoA0hUSndz8kQLM7c9U/w5OESIwiWCRAmgDAmkBKvvB9EL+Y68MRAEUlr8cCoCyv RwFACCHlAtlEgpv+j/KjIkfJhigAQrsHaAHgZgPoc56xCIQEQNonFn7CzTffXOFHP/pR5efLdTRgXgGQpIiA2uCy/u kBvRUAevdff11EgIDabCAC4JVXXrHj9Z3vfMfceOONFogANHPzVwAUzRgwFAAkStIEAIAAQGaXSAA8UgB4IACK1Px3 63V8lgC8CRBCYgA1wsgGQLC/evVq+4jTXtDwNaaOzrEEA24WwMqVK2vOeZYsAKn3zALp/8AnAZBeCpBdW17G2l8RAG nBf9p443vlCC8IAPQQwucvueSSCjjLXc5490UA5E/9zykAeD8gEUkACEQc3SjBvxzxCkQEAAgASN+wNgNqJUD1PO6h AGjHEU3teh0KAEII8QOUAaDECIEf5v60015iEQAh3wO0AJDHJ554ouacZ3R7hgDIKhlE4C9NAH0VAI2bAiYN1wi9Eg A6/b/ReCPohwQQRABg7K644gpz9dVX23H3p+SnMwKA9wESWxbA9ddfX5XJBQmAo161BNACIMwsgCyh65EAyFvz343X IJ0DzTlCPfYvpIYrhBBSVgEgwb98DmUActQTwFFP9dYBEkCi/t+nHgAmJYU/TQIkBe5FvToJII8ASJMAP/nJTyrrPO z8AxwR5tOJDsXP4k4fW0oAQgGQVMV+cjqMSIBYBEB6jOGRACDhBfsuS5YsMTNnzow6LZc3akIIaS0DwJX+q1atsqxd uzbXkV5SAgD8+hvUFwN5A0tfBIArAbQAkCMAkf7v1zgWFQCmvgBg5ieJWALoeQQBvy4FwMfS80Uyv8IsA0jLAK/NGq IAIF0TAHiDoifDmjVrzKJFiyoigAKA1wchrYJO71EHxJHNJfV2ceRrOCe+f//+EV8XiTElX+RK5/8i4w4BAOT0Bref gzzfY489PFjkNzNG2bt5eh7g+oLEJgHS5hKZD2S+0GVfvknfVkRi0uayLwoA0nQWQKwp/wz8CekMWADEOLewrIjEJn 9uvfXWqpRfyeDAoh6lADgJANx55522B0RaHwi//wb5Nxk4L5BYJIArAHSgryWhlH2FIwCyZaL7/m/XvEABQAghpFSZ RrHKRi78SYwZILoEAMH/mWeeaS699FIzefJky/Tp081uu+0WbZYh5wES+zwhAT8aBArhCYDuZiFTABBCCCmdBBBiyw jgwp/EvsiHAMCxYFjkjx8/PlcfCC7yCQl/jnDh34Y9AAghhARYbhRzKQAX/iTGRX7fvn1t/4d+/fqZPn36sNyQ1wYh hAKAEEIIIYQQQgghFACEEEIIIYQQQgihACCEEEIIIYQQQigACCGEEEIIIYQQQgFACCGEEEIIIYQQCgBCCCGEEEIIIY RQABBCCCGEEEIIIYQCgBBCCCGEEEIIIRQAhBBCCCGEEEIIoQAghBBCCCGEEEIIBQAhhBBCCCGEEEIBwD8EIYQQQggh hBBCAUAIIYQQQkhjjrzsDv4dCCGEAoAQQgghhIQe/E9esMkcNOYC/j0IIYQCgBBCCCGEhAyCf1cAQAwwM4AQQigACC GEEEJI4FkB9234m9n+AcsDCCGEAoAQQgghhARfFgAJIJkALBEghBAKAEIIIYQQEqgEECADpE8ARQAhhFAAEEIIIYSQ gGUAygGQEQARwLIAQgihACCEEEIIIYGXBQiUAIQQQgFACCGEEEIClgDIAmAmACGEUAAQQgghhJAIMgBQDkABQAghFA CEEEIIISRgASDHA1IAEEIIBQAhhBBCCAlcALAMgBBCKAAIIYQQQkgkAoDBPyGEUAAQQgghhBDPOGrI3rmCf2kCiEf9 Of4NCSGEAoAQ4jn77ruvJdq/waczLiGERCkBkiSp2flH/b9kAFAAEEIIBQAhJCABsGbNmnglQPWsSxqw//77W+L9Gy SfwGuB+CsABAn+r753kfnNH/5akQAI/gWWARBCCAUAISQwAfDuu++ap556Kk4JUDvzkgwOPPBAs2PHjogFQGJjfwoA 4jvvPf+wBRJAC4C9v3p0lQBg8E8IIRQAJNJFP+COHwUABYDf7LHHHpZoBUDLYxymAJA6b97v4mHqsYPNeeedZ5YtW2 YlgBYAuhQg5Gsj+eQ/Xg9t/rtSkBJSLgEgi79WFoBM9Y131y9eCRD+rp9IgIceeogSIOD5AXP/66+/3vR9QOaCKVOm +CkBWh5nPRckQQkACfYoBeJBBMCsxc9ZCTBk/DQrAiQLIPTxpwBoP5MP+7wlsXMl/7aElEYAYPEnC0Au8nmR5V30L1 68OGIJkAQvAUQAYJyjlADpM3CwAuCmm24yDz/8cKH7gAT/uEaCEQCFxtkN/pNSBvLNBG1pXd7Z+T18Bg/+OAtArhug JUDoARwFQPtYeN1ZFR68fIzNMBERwL8PISUoAcCCD4s/vQsUlQzI/msTCoDoBQDKAKKUABHNCyIBZs2aVUgCiAC45Z ZbzLhx48yZZ54ZmQRIEwBJaYJ+CdglaC8auLvBv1v7TREQrgSQ8UbNv5YAIIYsAF4Hrc0/CPpXzbnG8l/3XmeGDx9u Ro8ebYlRACTqP14jpFQCAIs+LP4kGyCqjID6f3FSRwC8+uqrFACR9AKgBKgUM1ICpAiAMWPG+CsAmpYA5RUAEvgLrT Zuw89JAzieAx8+SP+XccbOrTQGTCsNISQtS+j1pXfb6+bYY4+1gf+KFSvMnXfeGZ0ASJz/eJ2Q0ggAVwL8/Oc/t7RS FxqUBOAbNnXhj0V/vFkASbRZAFGNdYQCAHP/XXfdZZ555pm6c79O/8dccOGFF5oTTjjBXHzxxeFkAdSd+7OC//JJAD nDXZ/f3mxPAGYAxCUBpG5bB20cd5JHEuKawTX02GOPVXpLDD9vqu0vIdcTykq4+9/7TDFevxELAC0BsPjDIxaAW7du NS+//LLZb7/9KAF4AVYW/meccUbEAiCJSgAgyyNaCZA5FyRBCwDM/7fddptZu3ZtpgTWAmD69OnmsssuC1MAZM7/5R YAWaUAktbdigCQtHAGhPHs5jJYIFmcffbZ5tJLL7V9YOQakZOiEOhj1x8CAI8I/rf/6W/28wj+pbdEOGtC93PlFgA8 0pMCoGoRiMAfiz8gIkAkQPDZAPlGwfugTtOKAPBSArQ8nkk0EsAVANFJgLrzQLgSQO4BIoPnzZtXNffr4P/73/++uf HGG60AQAmAtwKgkARoFPwnpQ3mWpUA8joiAXRKOBeRYUoAfQQg0//DG9uWgpJ/znUbNmywEgACADz++OP2fqAlgIBg HyUlQD7nuwTw7V7Q7muABCIAZBGInR8s/m6++Wa7AFywYIH93OrVqykBPJcACOrWrFljgzpQVAZgQh8/frzd9QtCAB Qe13gEQFYWAJAbPCVAeBIAmV+Y9zH/T5061cyYMcPMmTPHfg0iOFgBkHv+T7xc9OlADgF8M6UA7uvIazEwDD8TQK4Z jnV4GR7NBIRDhw61IIjfvn17JRMA4H5wwQUXVASANJCUYP+1JXeZzQtnmf/3fx+qiAF/d/5N6bPBCAVA4XIALP60BP jZz35mfv3rX1MCBCABZEdXRIArA7KEgAgALPqx+A9OAjQc44RZADFJgDz6PzABgIwvZAFoCQDuu+8+84Mf/MB+j1wD rgC4/PLLrQAYOHBguHO/8V8AtCuIY1O48Ev+3MyPuFKGk+gEQN7xlaaQYOix51QkAO4JIgCwVsTXf/OHv1bAiRL42T d/Osc8e/skjwVA3kwAf7JBOI9TANgFHtI+sfOjJQAWgA8++KB56aWX7E6QEKUA+GQRmHheCoB0bizktQxAwAfSREAj AeBNh9di77xoBYCWAL/73e9qSgHiyASISwJgTocEgPQVCXDttdeaq666ylx33XX2voB7BN7/rgDQWQCnnnqqOfLIIy 0hzv+N5oKy1X66ZQBcVJE8HH/88RYJEOKUAEmwEiBtfsjT6POgMRdU1ZBLJgCQe4MWCgjype5fJMAv7/tuUKcCJDUi wI+gX2dycc6LXACIBEDaJwQAFn+oCf3hD39oBQDSvydNmmROOeUUWxZACeB3cKclQD0RgEAPx31hQf+Nb3zDTJ48ua 4EcLsH+5zym4fQswDefPNNWz4i14kIgPAlQN5rJCwJgLIvkQCY/6+88kpzzTXX2Ln/W9/6lvnSl75k9tlnn8o1IALg iiuusAIA941RF083237/P6b/wOHRSAAtAMq84CekiASQ4D/OrI/wU7lduVMvGwDBv+4FMvqbV9s1gtswUh9BqkWAlg AhBf8+jbW8h92jYpstDSMBCQCRANj1x86PLP4Q/IsAoAQITwLUEwEI8nSJAD7Gwj9NAhw/sK8ZPny4fZ3Si4BmZ/gG EiCUc1+lmc+WLVvMO++8UyUAXAmQB293gNokinwpBcC8jrIv3AMgfzH/A9wPMPefdtpp9oxnkQC4F+gygIsuusgKgP 2PHGc+/89Fn1dlAc1s+3ggAAhpBqR2UwCELwDyHvWJud3NANDBpHxO9xwRuQC0BOD10FsZ7EqbVvrDkIAEAIJ61Hwi 7VMWfwIWgDjaA2gJEFRpQIFvTtK+30MJ4GYDAKR+Y/cXAaDL4Ycfbhf/rgD48L+3WAGwcOHCyi5gEBIg5+LfVwGQFr Aj6wPXB8Yb14JkAcj1cuutt1ZJAHmeRblFQUbQ3mJaeHP0XgKg5wuyviTzy53/zz333IoEwH0AzJ49u6YEABkAaPzk 1Y5Pk/NAWUsACGk1A0AHCHFJgLB7AbgCIOuoT3mEEBIJoPuK6Oe6Sagg14z/3f/Dy/rTY0wJELkAkEU4FoGo+cSCDz s/svjTAkAkABaJCPxxlBRwhYBfUqD4tr5IgMTThiCyq5+WDYCgD7u/CADBqlWrzN13323+/ve/W0QEaAkAAfDAAw+Y b8+cZ665/3EbSJY7AGhuzN2xdgOAqjdwiQN9OeIRoM+DgABOCwDIIBz9IwJg2rRpZuLEiXb8R40aVQn0IQ6LAImEa6 c7DSULBuNdEgDV11M5MgHQ80Uyv9z5H6UA2PX/yle+UpEAKB2DAMD7H+y1115myF67mGuOGWjWP/xvwUsACgASQ6o4 y0nC2fWvJwH0eMujZHV++aipVRLADfYlEyDtpBAvSkQjug7czA/2A4hQAEggIAtxBHRYBGKhJws/N/iXoOGwww6zaZ 5oAvW9732vIgIEWdiXOw24eiGeNLM7nPIaPjUHyZIAIgIQAM6dO9cG/l/4whcsKBXQEgABIl4H58Kef/75FggAP3YB iwX/eSRA2QIBfZSbgABcQLCH5m4A/R5EAED8YOyBCIJLLrnECgDsBo8dO7YqC0AH91mINOru/JCnk3vSlBRqPfAv1/ sD4lbP/Xr+x30Bc/8JJ5xg7xMQAZAAd9xxh5UAeK+jHAiIBPBu0deCBODChTD4Jz7s/OqP3RND0rICJIiHAEgrAXDL AOJqHOn3dUABEJEA0DuAOvDXRz2h4RNqPnXgj8WfLACRIgYBgHNBjzrqKLsIhATQr9ObhX6x3cDM3fs2BQC+iAAJ4t IkAIJ7BIB/+ctfbPD/+xl97CO6v0ICaAEgu4Dg4IMPtgHAxkdvDkICVOSQyvzwRQBoCQDQ48EVAdLJF80epQeAZH1g 7KVHxIknnmjTvSEBACTAIYccUtUfojyBf60EqJ+xUzsH1Hy6BQngw3wAAYD53BW/ev7PEgD4WbzXEfwLXjZ3alL++l YKRkjRgJGEO866S3zWuMtOPjLF0poAuicLBBugBZYVAuHD90GgAiAt6NeBvyz+BaR3otYTu3yy8JPFX5YAwCJRdgLl dbJEQC8W/6m7/V1KA07/feWUAJLqrcHOL4I/yQAACP5feeUVK4owxq+99lrlVADZCZQdQD92AYv3fUiTAL7U/LtzgB YBuA4wvjrrQ2d/SAYIxh7fqwWAKwH0HNB7EZhD/iUZgZ1bBtLEHOBDRhCCePR4kTnd3f2H8HEFwO23314lAHxf2OWW ACUVAEy1JYR0SvrImm7XXXetmmt4vnz5hE4zpSEkIAGAhZkb9Gel/wpYzIsEQM2nBP5Y/MkC0BUAF154YUUAlDH9N/ fOX1EJ0ETqb1mDAZ3O3UgAiARYv359RQJIJoDcIPxbiBYTAD5KgHrlPzI3iAQQASBZH/q5lgAiAORny7Prn7/8p764 M3pmrr0eAsgCqicBZP7XAuCzn/1sRQBgjsB9BscI6ve+r4FobgngZgCV6v8h8bjpFiGEkHbU+LdTFhAPBYCAGm0wbt w4W6Otg/Y0IAGwyMOCz0UvAAGyBUC9pmDYRbr++uvL3QCsiAQIqAFYmgRAx3c0fUPdN1K/EfTpYBABIE6OQEaIKwBw nrifgUADCZCyI5x1KoCvIkACeIxvmvgRUAaCpoGSCaAFQHl2/VsTAfUCwTwZBL52ENYSQLK+QNr8j/c67i+4XkQCQB 6DoCVAyjgnNfed3ksAmYMnH/Z5CxdYhBBCAUAi6gEgIgC7+kAWc/KxRgJ7SACkewpY+OnFHxZ5CA4R3H/zm9+0i0U8 ygJQg90k/P7eHQHWRgnQpuO/kpIGhSIBpNYbdd9ZWQAIBPG9+Dp+VoJ/XB8HHHCAPUYmBAnQKAvA3QlMTOJNAKhFgG QDSCmA9Htwxx3jDQHQKPj3QwSlBe31JUA9AeBz8K8lAE57QbaXxp3/tQCAJBAJgK+fdNJJ/mYE1HnPZ491+SSAy8Lr zqoAIcCSAUIICSf4d3sxUAZQANSIAHTw11x++eWpEgCLPRdZ/GWh60cFe1zUeVNLsCBMeogfF6CWAMjsgATQO8J4Dh 555BHzwQcfVJoIigTAc4wvBACyP0QC+N4TILMmPDMd2J+xx7i42QAiAdDvQcZcl38g4NMNAOVn5bU+fHud+a97rzNT jx1s7rzzTi8aQmae9JBDAFQ7w6R2UvdMAACc9oJyL8Gd/6UJ4Ne//nUrCLQEwHWC75V7ShDHAib1BUD2+z/p2ftaN/ gKoUyDEEJItgCQuv52ZwSgvxf/1h4LgLTyAC0FrrjiCisDZs+ebc95FhGg0cH+zJkzzaWXXlpF2msfcPw5ZvufPl6A bPj3GSVYfNSv08/bNyD/zxivBADAWe+o+4UAQKq37Agj0JcAUFLAETC+/fbb9ufOOeecigSAAPjVr35l5s+fbz+P68 eLkwEyMkDqjXP9dODyXwsSuLvZABhjjDdKPkT8SPAvJQOy6693GhH841SI0aNHW7yRPxk7u4neGc4c+9rJ3Mcz4hH8 40hX3BPQ60Vw5//777/fzu+SIXD00UdXBAAEoPSOASIBvLgOTJJ7/s8vAJKeCgCBgT8hhIQpAfSRju1u8jdkyJDI/8 ZJGALABTs9aYE7dngAuj2j4RNSPgE+J4s/F1lgyGIPQcB+h4+1GQAAAqAcEqA5KVA02Pdt8a8zAPAci3c8RyCItG8g AaAEgQgWUAoiAuDll1+219Q999xT6QOB70VTQZSKlDsQqFMGkrPhm1sa4IsEgOH98L+32HFEXwcgEgBjDgGErA9d+4 8jI3XwL+997Pwj8F+xYoUnGQD5sgHS076TzMncZwGAI15dAYyyL5G/0l/mhhtusNcHBIDOAoAEANInRij9LnSBPg/Z 14QpRTYYd/0JISSeLAARAG42ADMAmAGQCWq9r732WnPRRRfZ5wjc0wJ8t7kgFhXHHXecBYs9d7Ehz5dOn2ARAYDnZV qQJCbtPPfG3cJ9S/cuIgDkqDdBAj+9+ysBIOjbt68VAAABBMb3vffeqwgAXFsIABBIQA6Uc0HaTC+H7Guj8bVTngwA vOcFGVMc86h7A+jxl7HH7u7BBx9c1QDyscces+U/y5Yts+Jv1uLnSh+AuO/9+hInJVNABfq+Bv9pEgDjiMaxcjwsBI Bke+nxBgj+ly9fbj93/vnnmxkzZtj7AkoI5HvnzZtnKXtviHxjn+4GTaoodj9PCCGEdE4C6L4AWgboj9E0ttHpMbMm HMMsgA6vWXomALCzO+ri6RY8RxCABZrUg2JhJ7XAUvOJnR98Dx4hAPC8f//+FSFQTwSUbUcibfGu60HzpXv6LwNEAE jQ7qKbvrm7v0uXLrUdxBE4/PGPf6x8/v3337e9ACAA8IhmkTiN4plnnvEiE6SVIMAXCYBxwHguXLjQPPDAA1buiQiQ bACUf4gMwBjL2EMAfO5znzPvvPNOZcyx64/AEY8I/qUEyBcBkCYBs49+DFcAaPEDASCNXkUAYJ6X+4BGgn4AMbR27V qzcuXKSuDvS0+I/OIvex5p5pRZQgghpBkBsP0DUykHqCcDJEMgT2P2sAVA3pgtYAGw7ff/Y/Y/cpx9vtdee9mUD72o gwRAiqfUfOI5dn30ou+YYz6+SEQCSN23KwJKmXqRJgAaBHJJruDRTwEAEOzrM9510zfZ/QUIGNwgQHb90D0cwaMEkg j8Jfj3VQCkBwdZk0VS+KTJXkkACMBvz5xnd29FAuqTOzCO6PcgJR8iCdesWWMzP2Qe0CVAaB6HkgDgSxpy9RyQHsxV jW/N99efS3wUAAAlPK4AENl78sknV9L+v/zlL5sRI0ZYRAT84he/sN/3ta99LUgBkK9swHgrhQghhJRfAIgE0CJA9w jQAuBrZ37HDBg70ay5f5oZOXJk6uviazFkADS+NwcqAED/gcPN5796tH0cstcuVgDgUQfuIgFQ7wlEAMjiD5/DEYO4 UPA5kQB+NIDLEySZQqnevokAVwBI0K9FgG76htRv7P7qAFDS+3UHcX9qUYvu/Cc1AaCvpSEYF0jAa+5/vEoACNjJ1T IAJR/I+sDXdPCP4FAySPC56Sf/i9m04Dbz2pK7zOaFs7yYB9IC93oCME0W+H4UoAgAed9jPN0MAJE9EvjjusH7ffDg wZWMMYDPoRxABED57wdFj3vMWzLirxQihBBSfgmgRYD+GAG/iAH5XP9hX7cB/o+mXWrLv7OCfxsPUgCEKwAAmrdhoX 7NMQNt8K8FABZ+IgFEBOiGT1j84RG14iIBsGDERZWWDeBr/YfeAUxyLhh9OhdeBIDs+mvkrHcdFCL1WweASPPHTr9I gC1bttjHCRMmmLlz51YFlXvssUfJroe8AiAr1Tupe10khSec7ksAlGcAyB3JApL6foy/9HkAKPnQGUAIDFE+oJs/4m s4FWDLotvNmz+dY569fVKp54C09P1quRNuBpAWAHIahAgAjKcc9arr/1H2hcwvyF+5D9x00032Pe9KgCeeeML+zJVX Xum1AKge18Q0ahbJLABCCCG9EgES/EvNv3xeC4C0e3IswX+v0/9LIQAkCFj/8L9VJIAWADqI1w2fpOZTSwCAiwZpo8 D/bIDEZDdzSgpIgMRLAeAG/zozRAeAABIAXePTJADOlsfn0WBMQJkAKLsASAr8bCMJkF5zXo73v0hAIOMr71tcBzjp QTd7RNYHxlwEAI5/1AIAryMy4Zf3fdfLjrJaArgCMAlMAMhcIBIgTQDItYJ5HfM8pC/mfMkGcCUAnosw9qMUIMk5rv nLhJISyz9CCCHhlgXo0wCkBAAyAOsxEQBpWQAxBf/p9+Wke7+7LEGAuzjDxyeddJJdzOk6X6n5RNonFn1aAKRJAL+z AeovAPMLgMQrASDBv6R/46z3tOAfwZ/gSgARAK+++qr9HL5/8uTJFhwRuNtuu5VaACR1m4U0EgaJNwJA3usbH725Sv RIYIfnyBRymz0i6wNjLuP/+OOP22vpggsuqHyP7ivitwBMcjd79LkhaD0BIOMoc7qWACICkDmiS4HQZFJk0llnnWXv GWU+ErQVAZB6UkSdLBNCCCGkU9kA+nPS+R8S4F9Ou8iuzUCfPn1q7smNTgiIqwwgAgFQLzDA4g3nw+uaTzR7kl0ekQ Cnn366Bc+xmJSFoZYAfmYD5NnlSbwVARgrLQDc4P/Dt9fZlG40dUMPCDnnXdK+sfuLANDNBEDjOOz26ywAdBZH8L/L LruUugwgK/jPahbXjAQo43tdCwCMpYyx9HnQcgfPMdaSCQBEAGCMAb6GOcBvAZCV+m+8zwDKkgBZAkBnAaDnCySAzP My9//4xz+2X5f7w6pVq+zPSPCP8gE8908CmJYlAHsCEEII6RUiAvb8zMeB//fOGp36PfxbUQBUjv0SAYDGTloAyCIP Oz9SFoBjA2X3MI3yngnfnAAoKgESjwSA1HOjQdzo0aNtMADwed08ELu/rgDANQMJAAEAXnrpJft5GMfyZnm445m+e1 9UAPhYDywSQNL733vvvboSAKQJAPQFEQngv/wLWwLUEwC6SSRELoJ8jK1IAAgAXBPPPvtsVRaAFgAI/lFK4qMAqH7f tpYFQAFACCGEUAB4IQCwe6vTPN2GT9j5weLvwQcfrOLmm2+u8KMf/cjDQCDJLQHyUOYMAB38y/hj5x/B/4oVK8yyZc tsBoAEA/rIMAFBnxz7h+sGQAA8+eSTJR33+sF//fT94lkAXk1Q//xHz58/vyJ63n//fdu7Qfd5EAmgRQCCf8gfpH2j xkwIKQNIXydJQCIA733MAxg/Cf4POP4cs9/hY6uyADCWGFOUekEC4N4A+Ys5H9cM0v+fe+45s3btWvOZz3zGBv8ADS fLKwCyJED+8qH0OT+hACCEEEKIHwJASwAIACz4saCT3R0tALAjhEcs/hAkuEfB+X8iQL7d/qSLTSTaLQB06r+MPQJ+ CAAb+J831cxa/Jw96x3HvcmYYtdXQAC4ceNG+/n/+I//sD0ANm3aVJUF4MfYZqft1y7gM3b73SDAQwGAHVstd95999 2aZo9yHUD8YOyxI4zAEI9yyoBw6623BiAATXqmSA4RkHgwH2AeuP766z/e+f/ne377n/5mH5dOn1CTBSD9XvBzkAAQ ANLkE9+Hch+cHODPPaBR/488fUCq+0eYhAE/IYQQQjwSABIIQADgceXKleYXv/hFpRxAywBp/ITFH3Z70PlZjoBCII HPhXIsYKNyADdwLOvOjwgAd/ffrQ0HCP4RDCArAGe9ozxAOsdL2jdA4IdAUAcCzz//vG0cV47mf40EQLszRdxrxp/3 PQI9jOlFF11kkSMfIXTkvY/dYmR6yHWCsUffhxdeeMHyk5/8xKJ7CYQgALJ2933KAKpXBiBlQEALAH1tiASQRoAQAF LrL/cAvzI/8goAYxod/ccdf0IIIYQEIQDmzZtXWRTinGcc9YSgX4IBpH3KAlAEgAT+Ugfqb1MwU9MJ3JUB9RaAZVwM igBIC/7TrgMpC8DRcTjrXTq9S/CPYBABgTT+SxMJZQzwWg/O/drpLfLex3ji/Y8MABEAc+fOrfR3QLNHkQDI+qiXAR RKQ8DG/UD8HXORACIANvz7jApZEsAVAJj7Zf4XCezTeOcfRwoAQgghhAQoAGSxJ8G/LO70oh7NngBKBJD2qXf/wxAA pmZxZ+rIADfwL7MA0On/ea+FzQtnmTd/Oqdy3JvUf6PuG8EAdn79GGcKgLyZAGj6Jv0dACQPSjxEBEAA4GMIAP2z0v wNJQC+lwGlCcAiPSR8FABaAmQJAAABgF4v+LwO/OWe4WcWQGsCILtsiBBCCCEUAB4JAFn4yQJPUjwBGj6h5jPt66EI AHeBl9Yh2icBUCT419fDs7dPMr+877v2OYJ+BIhoDIZATwSAZo899ihlBkB7dm0bCwBfgwCMGdL3Ma4QAG5GB0SASA D0e3AzPxD8o48I6Nu3r8fv/YxxzRAExuPdYN0LRMZRB/+uHHIFgC4DwNchBuUoQL8kQHMZImnjTglACCGEEO8EQFpK N3Z2ZHGnA/xGXw9pEOst8sq+CGxWAMg1ICUAIgFEAKDmW+/+Ik1ckN4AYQkAkysV2NdgQJr86d1fjCWOf8RzNHjESQ +QAOj3kPZ9KBOAIPQ3EyL9ve9mAyQBCIA89wBXAmgBgPe8vg9I8I/5oNynALQnQyTtPlDmXjCEEEIIoQAotCjUizs3 wG/09WAGss7iruwZAM0E/1nXgisAZPcXAeDkyZMt6BVQnmaASZtrtsMUAG4AiGwOBPYYT+kPIiJA+gSkfV+/fv2CFH +1ZQHx7AJrASBHvUqgrxEZGIsACOm9TwghhBAKgJoFYL0633DqgPMFBM18PaRAAGMsHd/xHAIAu78IABH8o0dEuG/s fIFACGMtgT3GtE+fPpXPQ+64GQDu94UsAer1AAj1/S9lInrcRfhqMB+EKQBMw8wPCgBCCCGEJCH9z+idnma+TgEQTi AgZ70LqPtG6jd2f0MKAJsNBEL5/0QZRx6hk/f7QnvPx/jezzr5w+9TIAghhBBCKAAIKVwrTMICgX2eUo683+erAGjX 9xFCCCGEEAoAQgghhBBCCCGEUAAQQgghhBBCCCGEAoAQQgghhBBCCCEUAIQQQgghhJDIgxL2byKEAoAQQgghhBAShw DYvn171BKADXsJBQAhhBBCCCEkCgGwZcsWCgBeC4QCgBBCCCGEEBKDBFi/fj0lAK8FQgFACCGEEEIICbnmnwKAAoBQ ABBCCCGEEEJKHry3o+bfFQChNwZMC/ZjFwBDhgypIsbgXP9HAUAIIYQQQnq2KI+1U3snF+O+0a9fP/Paa6+1RQC4Nf 94jtc+5JBDqj7G7wzxWsgSAPrzsVx7Msfs2LGjilgkQFLnPwoAQgghhBDS1YW5XpCvXLkyKhHQjQW5LwwePMjMnj3b TJw40RxwwIC21/zj8dVXX618jN+B37Vx40b7u3t+LfxDXQUfdkYCVAX/H6rf949wr7sDDzywKuCPLQsgafAfBQAhhB BCCOlZSi6ABLjhhhvswp2L8zjGXwL0nTt3pu7ad0IAyOfeeOONVOHUjQAxbUe+nWn79QRAo9cP5RpE4I+5JMaUf3eO YQ8AQgghhBBSyqAQC3ZIAC7Yw8/+kMBs5MiRqQH68uXL2yYANm/eXPP6KBXA72707+v0OGeNeTcEQL3PszyFUAAQQg ghhJC2pHwjAEPwJWn/MfUAkLTrWAMsN8CW3X43QH/rrbeaui7k9QYPHlxXAGzdutUMHTo09d8HOdAtAdCpDIA8r08B QCgACCGEEEJIx0DjNdR7I+Ubu74I1FavXm0f991337hT/z+KpP/BP4NvVwDgGnAD9N/+9rdNC4Bt27ZVCYC1a9fWvP 6GDRvMiBEjUgXAmjVrOpo6TgHQeQ499FA7vpA8IhsHDRoUVUCelm1CAUAIISQKjrzsDv4dCClB4IdAHw3Y9M6/gK+d 862zzPDhwy0hL8qzvvbnP/85+N1XjDX6PaRlAOi0/ddff72lDID+/ftXPl63bl3NMYD4HgSJaQJg0aJFFAAeX4Njx4 6tkouQjZCOkI9lOv2hV7KRAoAQQkjwwf/kBZsoAQgpQeAH0jq94/MIxp5//nnbA2DUqFGVY9uC+zt8mOResMciAZD9 oQPyVgUAAj6dAbB06dLK9YTHF154wZxy8pjU4H/JkiVdaRxXtTP7Ub6ygFYEgNtzALIptOAfgb8E/2mSEfKxHcdNep GOX1BAUgAQQghhBgAhpOugCeDTTz9tJUCMzQBjEgDuiQ/I/oAAwud22203+3zYsGEtCwC8hhYAkAyLFy9OFUz43MyZ M7suAIDO/pD/Pvroo5ZfG6+RJgBC2/3HdYPgXkRSWpA/YMCAgHuONJ47WAJACCGEEEJ6mg3ggsBPiPLvYuJpwOae+I CyD3wMAdSKAACbNm3KFAB4xO/pdYZJ1i59LwWAzyDwxzUVwzGiZZw7KAAIIYQQQkjdxTqOeUOndzR7Q7o3QNAnZQAi AkLcrUsK/BfLNQEBgNIPGXs84lpo9voSAYBAP00AlO26auf41wv4Q72uJk2aVAFjnCUZ3a/FVALQySwACgBCCCGEEF I4EwC7tQCBnwiBmMoBsFurd2xjEwESnOM5JACuATzfe++9C73Oiy++WPkZHfzL7yhr4JcVqBcd/3oBf2jXEnb8EfRD +ohIFB566CHb7wGyUZoB4nH9+vUV/BcBSWGp2Il5hQKABMVBYy6w8G9BCCGEENIdpAwAz/fcc09z1VVXFRIA+Bk8nz 9/vpcNJVvZtY9hx1+DYB8SQARi1u5/Glu2bDHbt2/3WgK0s2EkBQBh8P/PwB/dwwElACGEENI9sIOLIK7PEX0sRxxx RJQ1vTo7ILbsEMkGwPgXEQDo5C9Bfxnq/dsR2FEAdD4LiX8PCgDCXX8b+N+34W88QowQQgjpAQj6AHaCEdShTjxGCR BjTwAJ3kUA4BrIKwEeffTRKgHga3CXdZRfUQEQy/WCvg9C//79K89jCfJ72UeEAoAEseuPwN+FEoAQQgjpjQiYMmWK 6XNQH3PQQQdFubsWY0AnIPsDAgjXQKPvxTXyyCOPeLvrbzJ6QzQrAKJcy/9zjgi35r95EcBjAAmpAwJ9oEXA9g8MMw EIIYQQQnoAsj8Q3OcRAAsWLAguyCtaAsDU/nBr/ttZWkQBQIgjAaT+XwsASgBCwhR+Av8mhBBS3p3dRt9T5i7/3ZAA DP5Z888eAIS0KTCgACAkbNHH9zchhBBCCAUAYXBQ1QOAAQIhYZf88D1OCCGEEEIBQCIN/vUjgwNC4pF9/LsQQgghhH RYAHDRRcoUEOiAXwIDCgBC2AuAdIcDDzywpVrhSZMmef43SFpbjPEaIoQQUmYBUCS9mgs00rEL+JPGIGmnAFAAEBK+ BOCJH+UBAfzrr7/etADAz+6+++4VGeDj8XHNBvJpRz9RChBCCPEyA8Dtzs4/Omln8H/1vYvMb/7wV7P3V4+u7PwjIB ABwKCAkPAFAN/rvd31x7nNCNjlsZnXOe6446oEwEMPPVQlAHCkWFl3/dsRsHf7DOi8cp2dtwkhhAKgqSwBXZvNPzrp pADANSYCgLuChIQX8Kdll1EA9IaxY8faoB8SQHb/hw0bZr82ePDgpgSA/JxIAHxevo7fVTYRkLVjXzR4T9v9T/u4m/ dXnL2NM7izzuduJAhwvjvAMW++LpDb8TdnJgchJDoBwPR/0ikQ9KcJAB4PRkiYpAX6vM+EIQAk4Jefw+vg43HjxlUJ ABECoQuAtNfrhQQA69evr4Ax2LZtm3189dVXLZs2bbIfv/jii5YlS5aYRx991DzyyCNmwYIF3mcRJC3+x7mCEGYjRS UACOm0AABDxk+zIkAkAIMBQvzZxS8KsnvkNaQEQH+OdDf4P/TQQ+3H2OWFAJBFGgL5IjX8+LkXXnihRgBIScGECRNK lwFQb4e+meAvjwDo9QIc4wP69+9feS7svffeZs8997TXghDaop3BPyGtgfsCgMwFeF4vwwhZSMhGCmUuKTpPdGouoQ AgXltBBP/yKBKAppCQ8gb/7SgF0wKAwq87df47duyofIygH8G4nmvxqAUAAkT5nrzz+fLlyysCQF5P0sfld0I8uD8L OdDNVPCsBVknBECeEoC2pKlzl40Q0gUkW0yA6IX8xfyPOR7orKMQ56UySEQKAOJt8C8ZADI5iAQAXMQQEmYGgA78+f fsPEOGDLHBvz7ib8SIEWb16tVV8yyeYyGnMwCQHl5EAGDhB3GQJhRkntdZBxr8G/Fv7eRCrRcCIO9uUKuLxSI1/xpk agCImqVLl5r58+ebG264wRJDzf9HH31k4e4/IflBs1fgZhFJZlHoQrIMmUMUAMT7miCRASIB5Dn/ToQQ0h4BoIProU OH1uzuSwq/FgBFMwDw/ToDQAsF+RzEAwREnn9njAKgVQmQVvMvtf6bN2+2rF271qxbt84G/JpQUv+TNvzHuYOQxmUA sWYrlWGeoAAg3u4i6glAsgEY/Pu7q0sIKX/wD0aOHFmzuy8p/HrHXtI38y7q9Pe7r6clAQREkX9vO4P/vAKgmdT8PD /fqBSgHQtLvcCWYD4NHfD72um/6JjUEwWcMwjJXwYgR71KFlHerKNQegI0O2+09XQSQnysI9ZBJ+sXyzUehJBwBQDm 2Z07d6YG5+0UAGlZBu7v7YUAqBecd0MANPPvJYSQsmUAQAIIuieA9AOAaA6xJ0AZsouSGIITHB3FAIU7zoTjQQhpXQ AMGjTIzJ4920ycONEMGDCgEpzrrIB2CAD9evg9+H34vfj9ZcgAaJSy304BkGcR2O5Foiy0DzhgQOrXsOuPfgzBZwF8 mORexHPeICQ/OAUAR70iIyAr28j9fKgZRp1s8hptBoAcFcUghRBCCGlNAIB+/fpV7dBjkZa2Yy9N5RoFmu73SQaABJ XyMX5vvX9vO3sANMoAKNoXoGiqedGjBdu+Q/TJ3xziJW1hjp4PixcvrjT9CzEDL69wYfBPCPFOPoSUgpwV5PO4KEII IaS4BMgKqt1jAN0df+ksn0cAuN+XlhHQiwCzSHDXCQHQ6/GHcNm4caN54403rKTZunWr2bBhgxUDp5w8Joimf82m6v 75z39m8E9IkwwfPtxmAAAc5YpsInceQeZXTKcBdPMe0BMB0O6BFAEg1AvyKQAIYSkBKcdYc7wDWshkpPznWbylfU/R EoKypXOW8fWaZfDgQXYc0PwRDRhxCkPaUYzBXtv/SLjjT0gHgEjUuFlGyD4qcppMiAKAJQA5BABq/YHe7ZcFJhebhJ Q7yGczwbiuAY51HAKgLK9HAUAIIeXMAsDj2LFjbbCPo17xiIav6PlSr+wrxD4A3eotUioBMOT4C5rOENASQGr+pe6f PQAIKX/g16mGnTwdopzXAAVAmBIgT81/t17HZwnA4J8QEhvILEKGETKNMP9nNXwNWQbooD+4EoB6AqCVxbre9XczAi gACCmXAMBj2tdbea/K/LH3V4+2yHNKgHKl/TP4D1cAtON85na9DgUAIYQQUlIBgMBf046bvlsGwMUmIX7s/tZ7zx40 5oK6QcPV9y6qgMB/yPhpFAAlHHsezRq2BGiHAOD7tfygOWSoR/8V2a3jtUAIoQBo4kaPoF/Sf9slAAgh5Q0C8wSA7t cQ/Nf7Gcwbv/nDXysg+A/17NiQxp8SgBA/gn2XJUuWmJkzZ0aXmstmgIQQCoA2CAB3p56LdVI0w4N/Ez+DwCINOyEA 9M+kXQuS+g+QBSASQJcEcAzKMfYiAZgJQIgfAmDHjh22N8OaNWvMokWL6h4RSQFACCkCjgKMPiCPrQTAPfaBbwSSN5 WYAYS/Y1ikYafs/rtBY9aOssgAVwJwfilXGYAWAXnewxhD/h0JKUcWQKwp/wz8CekMkIwxzi29KCtKeMERnzMAWE8c zhhmNezUwb8bMOrHtF1lLQEoAMqXBYCx1uPGvw8hhBASd6ZRrLIx2mMACSlCWvBHCeB/OUfW7r8rAdxjAyWgBPI5aQ zI4L+cEkDGS4ubvFkAzBgjhBBCwpQAQmwZARQAhLAfAFESwA3yJXBM+7wWAAwUy18KUPT9KyfGsGcMIYQQEm65Ucyl AJ0sB6AAIMEEFDrw498kjv4PEvw3U09OylMCorM78goANo0lhBBCCKEAIJELAJYBxCcBXCHA8fdXAqQ1gEzb+QfyXq cAIIQQQgihACARBA1pn6MAiLdvAMc9jPFseNP6Z8DPEgBCCCGEEAoAEtHub1qgz0CQkEBvVE6Qz94OhBBCCCEUACQy CaDThd3z5Pl3IoQQQgghhBAKABJgyjB3/wkhhBBCCCGEAoBE1g+AEEIIIYQQQggFACGEEEIIIYQQQgFACCGEEEIIIY QQCgBCCCGEEEIIIYRQABBCCCGEEEIIIYQCgBBCCCGEEEIIIRQAhBBCCCGEEEIIoQAghBBCCCGEEEIIBQAhhBBCCCGE EEIoAAghhBBCCCGEEAoA/hEIIYQQQgghhBAKAEIIIYQQQgghhFAAEEIIIYQQQgghhAKAEEIIIYQQQgghFACEEEIIIY QQQgihACCEEEIIIYQQQggFACGEEEIIIYQQQigACCGEEEIIIYQQQgFACCGEEEIIIYRQABBCCCE9Z8iQIVXEeJPW//Ga IIQQQggFACGEkCAD/x07dlQRiwRI6vzH64MQ4gv77ruvJdq/waeTOiEUAIQQQkgaBx54YFXAH1sWQNLgP14jhBCfBM CaNWvilQDVkzshFAAk3l29JEkssabz8logJBsE/pAAMab8uwKA1wMJWfSBeP8GySeELwDeffdd89RTT8UpAWoneJKT /fff38I5ggKAeB7861TelStXRiUCuJP3yd+hxTGPVR4RQkiImT7xSoDEru1DlwAUABQArcwP8QqAzs4PFACk67v/Gk iAG264IYoFANN6q4P4Vn52+/btUUsA7gwTQkJY4C9evDhiCZBEJwEeeughSoDA79977LGHJdrgvy1j3Pl5gQKA9FwK 4I0OCcBUXwqAvD+7ZcsWCoAI/j8PPfRQM2LECDN06FAzcuRIO+aDBg2Kcn6QMS/72Mvir9UFIOt9KQEoAcITABjrKC VA+gQfrAB4/fXXm74PSPA/ZcoUvwVA0+Os5wMKABIAfQf1tQt4WcjH3AeA10PrAmH9+vWUAAH//40dO9a89tprZvXq 1fbx1VdfNTt37jSzZ882/fr1Y8ZQyRd/sgDkTh/n67wSAO9xSoAkaAGAMoAoJUD2RB+sALjpppvMww8/XOg+IME/rp FgBEChcXaDfwoA4jlYsGPhjgU8bvJ6Yd9n3z5RL+Z5fdTPCEgTRRQA4QoABP4S/GtRKEycOLHytRizgnyYN7Dgw+JP 7wJFJQMiWuy3SwDccsstEWcCJJQA0WYBhC0BZs2aVUgCiADAfDBu3Dhz5plnRiYB0gQAewAQj4M7LNixcE9b0ONrXz z9i2b48OGWkBf19QK5EIVA3iyPRgLArfl3BUDo2SRp10WIAgA3fcwHAOn/aWM6YMCAYMc7jxz0Ydyx2MOiD4s/yQaI KiOg/iATZ8F/xhlnRCwAkqgFQFRjHZEAaFYCaAEwZswYfwVA0xKAAoAEGATuOmDX1K9hof/888/bPgCjRo0yhxxySL R9AEKSAMj6aMdObVrNv4gjuVbk4zKlhrdzLLMEgP58CNcOxjDmo8FCmgO0BPj5z39uaaUuNCgJEJAIQFCnaUUAeCkB 2lDvG4sEwPWBDNBoJUD2IidoAYC5/6677jLPPPNM3blfp/9jLrjwwgvNCSecYC6++OJwsgDqzhFZwX9nrhEKAFKaXY Cnn37aSoAYGwKGIADkZAfp94CSD2R9pImfVmv+8YiFhHyM34HftXHjRvu76/3buhXwt3ss3ddK+9jntHEwadKkCpA7 aRlDwP1abPOAL3OESAAs/vCIBeDWrVvNyy+/bPbbbz9KgECCujVr1tigDhSVAbj3jx8/3kyfPj0MAdBEym+sAiA6CV B/kRO0AMD8f9ttt5m1a9dmSmAtADAfXHbZZWEKgMz5gQKARJAN4LLbbrtV4M6fn8E/Jm4JsjGm6PeQtmvfCQEgn3vj jTdSA0L339eN8Wt32n4jAVDv9ct+fUnQj+tDp4wDLA5feOEFs3z58kozQDziehB8FwFJi/+VfRGIwB+LPyAiQCRA8N kA+S4A7wM7CehEBLgyIEsIiAC48cYbzfe///3wJEDDcU6izwIACPYoAcKVAHIPEBk8b968qrlfB/+YBzAf4JpACYC3 AqCQBGgU/FMAEM/Bwh0L+bfeesv89re/rSzyUQIgZQAiAmKo8Q2lOaAbYOOkh7QAHWPfLgGwefPmmtdHqQB+d9q/D1 /rlgDIGsNuCIB6ny/zdYV5ABJg2LBhlixZmAbG1u0TEVMWkA8nA2DnB4u/m2++2S4AFyxYYD+HZrCUAGFIAABhh0W8 lgG4F4A0ERCEACgiAWrGOm4BEJ0EaLzYCVICIPML8z7m/6lTp5oZM2aYOXPm2K9BBAcrAHLP/xQAJIAd/mYyAXYZto sFEkCEAEsBEq/G3c0AcOv/8Rzip5kgTV5v8ODBdQUAbjI4Mz5NACBNtZNlAN3IAMjz+r4KgHZlFnEeLnc5ABZ/WgL8 7Gc/M7/+9a8pAQIqCdASoJ4IwKIfjb6OPPJI841vfMNMnjy5rgRw1w0+L/bzELoE+N3vfldTChBHJkBcEgBzOzK+kA WgJQC47777zA9+8AP7PSKCXAFw+eWXWwEwcOBA+3qYL0BocjCvAGjXWo4CgHAhTtoy7itXrqwSANjZcwN0ZH00KwC2 bdtWJQCwe+i+/oYNG8yIESNSBcCiRYsoADwIMjDGQv/+/SvPY5lbQj0uFAs8pH1i50dLACwAH3zwQfPSSy/ZnSAhSg HwySIwCUgC1BMBCPR0iQA+xqI/TQIcP7CvPSUIr/PtmfPMtt//T3nng/w3toZiQEuAUOYCEQBvvvmmFfNyfYgAaLcE KF9j2bySqI2/r8fvE8zpkACQviIBrr32WnPVVVeZ6667zt4XcI/Ae98VADoL4NRTTzX7HznObP/T30z/gcODm/8byc C295UipEzsvffeZs899zR9juhj2fWIvlFmAfgsAXQGgE7bR3ZHKxkACAjl43Xr1tUcAyjHx7nB/5IlSzreBNAdu7II AF+DyIMOOijYmv9Wy4V8lgBI+4QAwOIPNaE//OEPrQBA0yeUgJxyyilWHlIChCEB3GwAgJ1fBH8o3XE5/PDD7cLfFQ Af/vcWKwAWLlxogQS45v7HbQZBKeeD5m+kDQVAo/tAL5AgO0+gLd+H8X7nnXeqBIArAfLQ6Pd0p5ykSKp2UkAC5KH+ 7ylLJgnmdGzciATA/H/llVeaa665xs793/rWt8yXvvQls88++1SuAREAV1xxhRUAuG+Muni6lQCf/+rRlayA0CUABQ CJBlhBgFIABG+48cdcCuDDoh8LMJRtyI22z759qgLyVgUAAkGdAbB06dLKMYB4RKO4/U6oDRrwtZkzZ3ZdAOQN2tvx 2nlOAPBVKoVa8x+jJBQJgF1/zO+y+EPwLwKAEiAsCYD7QVo2AHZ+EfxBBoBVq1aZu+++2/z973+3iAjQEmDqsYPtWu CBBx4w559/vgUC4LUld5mNj95cwvmg+CB++iONJUCZ5gFdw62D7bSAHWOGawPzOMZesgBEANx6661VEkCeZ5ElBiCR utdLwk3hrt/jodUdYR/LSDD3Y15H2RfuAZC/mP8B7geY+0877TRz7LHHViQA7gW6DOCiiy6yAgAlAMgAwHvfmw2BNo jAehtMpRcAGOCoU6VNwgC/oAiYMmWK6XNQH7sjGPNC34drBzda3bvhi6d/0UocfB6NHfEcvR5aFQB4DS0AIBmw8JCP yxSYtWuxlkcAxDK/sNTIXxDUo+YTaZ+y+BOwPjjvvPMsWgIEVRpQMBgMoU9AlgQQEYBsgLlz59rA/wtf+IIFpQJaAq C8C68DAYA1AR7BwQcfbK45ZmDJ54NiwX89CVDmzQFXAoAzzjjDgkaPAoI3LQAw/hhfEQDTpk2zx/pi7EeNGlUJ9DFn FKH7jSTz1HF3TwCUsYcEJAB6viDrSzK/3Pn/3HPPrUgA3AcAjpWGANhn5P+yZQC4hvbaay8zZK9d7Pt//cP/FrQEaJ QJ5I0AwC5gsz+Pn0UgCPBavgWF7QoCfFnwc5EeN1igQQg8/fTTLQkAsGnTpkwBgEf8nl4LgE6+XykAiO9IUIBFIGo+ cQ+H5JXFnxYAIgGwSETgLyfGuELALynQ3I5w1s5wGWp7i4y9BPOuBEDwBwHwl7/8xQb/v5v1RfuILB9IAC0AsJ7AfU XWFugNIAKg9GOfV/ioMc8KAMo8ziIBsAMvINBDXTdAw0cRAMj8wNgDEQSXXHKJFQAIBMeOHVuVBSDBvX5tl96eIpFT ApjOSoAyN5DE/I+eL5L55c7/KAXArv9XvvKVigRA6RgEgLz/Ad77QCSAN7FGE2PfiV4gXREAeEMiFVjOeW4lCwALgN 13390G/jCFPgiATgQBXPATXwQADL4c74hHSIBmXkufAoBAP00AlO0G0M4a7noBP+cC4kPgj0W5BAdYBGKhJws/N/iX ncPDDjvM1nmiCdT3vve9iggQZKFf7s7hny7iKuv/JmvD02MJP0SABHKy06tB4Iddf8kAAAj+X3nlFZsWjGsG9wCRAL r/C4IAPxb/xTM+khLWcucZZ2TsieyRwFwavOG0B+kBIGUfkD/SJPLEE0+0u7yQAAASAPd43SCyXuDf+yMki0mAmk+3 IAGq54RyZ4LpuV/P/7gvYO4/4YQT7H0CIgAS4I477qhIAAHBvxBqJlin3v8dFwB448qkLbv/OOMZX5PFfJGmUPh5+T mRAPp3+dLIqRmL22jRzwCAlBEJzvEcEkAygNDsscjrvPjii5Wf0cG//I6yLgCz3rOtnPXO9z7xJeh3A3991BMaPiG4 04E/Fn+yADz++OOtAMDRnkcddZRdBEIC6NdxF/3lEQFZi/L27wL6JAL0bm4jASASAI0/RQLoTAAtAbzKAilS8uGxBH Df91oEYPwxtrrsQ5d/SAkIxh3fqwWAKwH0PFCeOaBR1o7z3k3rA1FQAPgkAyEAMJ+74lfP/1kCIIRSsEISOO1aKZMA kDd7pwUAbhTyc3gdfDxu3Dj78XHHHWd/V5lS+7shALgLSHxBygDwHCc9IP23iADAz+D5/PnzS5fu32oQ38mfJaRXi3 8dAMjiXUB6J2o9keorCz9Z/GUJACwSJYCU10kTAWVZ/DfcCWxjGrAvu39aAqDhG2q+kfaNnV8EflICIAIAPSNwLbgC AJ3E/ewH0kACpASEvpUCZGX+iAgQCSACQI+5PNcSQASA/GzWrn/pjvtrIAKqpgHd58MVQoEIQC0A0ONF5nR39x+xoy sAbr/99ooA8L20uFAmWJkFALprp910JfiXLuB4A+su4Ajki6Tw4+fQ6dsVAFJSMGHCBPv73I7x+Hy3dvmL7ti3Yxew UVDAQIGUqSeEZAPgiMciAgCnQUjQX8Z6/0KTbhPvTQoA4lPwX68GWMCCXiQAaj4l8MfaQRaArgC48MILK8FjvVTg3g UDBRqBFZEATdX/Jl5IAEn1Rtp3VhYA+gHge/F1/KwE/7gmDjjgAHP22WcHIQEaZQFUP8o9pPxj7YoAea9ibNPGXMC4 o+GbZAJoAVC+Xf/mREC9QDBPBoFPgX89CSDzvxYAn/3sZysCAPEeBACOEXRPBgpaAriNQMtUAiACQB+zhaC/0TngON Nbvidv8LB8+fKqo8DweroTOF4vrRTA/fd1WgDkCcZbFQBFGoExYCBlQQsAZAPklQCPPvpolQDwdtJvcg7w7UQIEm/w jy7tANl5OPJLB+1pQAJgkYcFn4teAAJkC4B6ncGxi+RmA3Rnvmgi+M8jAZpsAlb2bAAtATCmkAA6IMRz8Mgjj5gPPv ig0kRQJACeY1whADDuIgH8uTfkkwBu4FgbCCTGl/IPLQiBlAJIw0dX/GCsIQAaBf9+BIRJ5hyRp/wjpOA/TQJI1hdI m/8h/SAAcF1oCQCBHLQESBnvpOa66oEASAv+wYgRI+yg6kHBcxgcnQGARiFFBAACfIiDNKEgF4POOmj07+z07n83BE CeYJ9NA0nZ2PWIvnZXH4FCo+/FMZBYBPq661+0dKjV7yWk22BhhnssHgXs6gNZzMnHGgnsIQGQ7ilg4acXf1jkIUUc wf03v/lNu1jEIz7vgt2k66+/vuoc8M4vEFsI/utJgIDOAc8KCNEoFhs3EADY6ZWAEMEf6v8REMgOMAK/t99+2/7cOe ecU5EAEAC/+tWvbHkYPu9NU8CMsa9XQpIeCCReiQCdDSASAA0fRfro/g8Yf90AUH4WY4zXWjXnGvPh2+vMf917nbnz zjvN6NGjSz7+SfZRjzkEQPUlk3i/ToAEwGkvyPbSuPO/FgC4JiABRAScdNJJ/mYE1Mn8yRY+9a+DngoApOy5u/uSwq 8FQNEMAN0J3BUK8jmIBwiIvP/WGARAryQAz+sm9UC5DoL7PAJAJvrQBEAnvjeGUhLOK+UTACDtc+jgr7n88stTJQAW ey6y+MtC148K8nv1jmPnJUBa4JWUgrJKAJ0BgOeQAHiOYB+7vkCCP9kBxqYPJJAIgJdfftmeEnHPPfdUMkDwvWgq6M XRgFkSIGe9d1JXPvmVDYBxR8CPng+S+SHjLyUD+r0sLLzuLBv8Yz2B4B8SwJexzwzq6gT/WWPr60afHOeK9zFiR8Gd /6UJ4Ne//nUrCCRbQNaG+F65p3i1NsiZ+VWvj0QzmUAdEwAjR46s2d2XFH69Y483exEBoL/ffT0tCXDxlF0ANLOoz/ PzZRMAMPk47sVN0cqbsoXgD/hc8922MzsDDBzy9AEpc5f/boxrTME/rgdQb67AfIJ5JcRrIs984dsiT2cFaClwxRVX WBkwe/Zse86ziACNDvZnzpxpLr300irSXvuiiy4y+x0+1gw/b6pFgo2l0yf06JrJDuRyNwss8DO110b76kY7JQCk07 sgO/46+HvqqacqY9m3b18rAIBkgr733nsVAYBrANdP2XeCm+/tUBsA+CQBcHTjh/+9xY4lGjsCkQAI6jC/o+xD1/7L +CPQd9f9U48dbIP/FStW2Pf8rMXPeZMFkpUNkJohUGdcfc0SRPCP9zDuCej1Irjz//3332/nd8kQOProo+21InGg9I 4BXkkAk+Se//MLgKR3AgB/+J07d6YG5+0UAGlZBu7v7YUAqBecd0MAlMkOyqIdYydg3LZt22YfIYrApk2b7Mfo9g6Q Ho66b1jgEHZ/kxb/4y4jCRl9tjsyu5Athhs75gSg548Qd/9jmguw05MWuGOHB6DbM64BpHwCfE4Wfy5unyENAn6w4d 9nWHonAJqXAo0Fgd89I6SPQ1pvCF3zLcFfZWyXLrXZnpgv/vjHP1Y+//7779teABAAKBFBZkDZa8KbyeLISh5IDxrL l8GFIB4gcBepg3le9wbQ14GMPwK7gw8+uNIEUl7vscces9k/y5Yts8H/9j/9rdT3iOq5PGlYQlQzrgGV+YoAwBGvrg BG2ZfIX8z3KBlFDygE/hAAEhvgPY9eIED6xAAv1gkmf7PH9Ayg5u4PbWsC6AbVgwYNslYfNV0DBgyovEl1VkA7BIB+ Pfwe/D78Xvz+PP/OTu3YZC3YOikAGi0Sez056IUZyjgA+jnIcwFnveO4N70bEPNin8E/iWXnf/fdd6+ZD2SOCD3tP7 Y5AB3fr732Whuo7TPyf9lxTQvwNVj84ftw5C/AYq/edeHKgDJdO+lj2/jIMJ+avhURAMA9413XfEvwB+QYMA2yPvGI umH0DsCO8jPPPGObUOKxnPNGKzv/aa9lTNoRlEkJBQAC+oULF1ZEgNTzSzYAxlBkAIJDkT8Y/8997nPmnXfeqRp/pP 1DAOARr4f0cciFst430uf39N4PiTO+jQSAr2UAIgEwjmgcK8fDQgBItpeMJYQPkCag4PzzzzczZsywz2U+8EYC5BZA TvNA5zqpzRJJOisAsujXr1/VDj0CubQde0kPbzRhuN8nGQCSGi4f4/eWMZWz1WP68gT1ZQryGdQQQoqm/sc678Qk+1 Dbvf+R48yoi6dbIAMkCJB6UOzsSEMwqfmU0z/wCAGA5xBEIgTqXQNlC/4zx75B8y+TusDzUwa4AkCCfi0CJPjH9YGd XwR/a9asqTT6kx1+XTus5wMJ/n0VAKnXgbpeGkmhsmYAfHvmPCsAHnjgASv2tAQQIAHQ8FF6Psj8oMcfwR6uIT3meK 3pJ/+L2bTgNvPakrvM5oWzzLO3T/JGAqRlBFUJntTv97tkUASAzv5A8C6NXkUAYJ6X+4AO/iXoB8gOWbt2rVm5cqX9 nnnz5nmwPiiWAZI3k6zeHJB0KyDM2vGXGvE8AsD9vrSMgLIvADshAMo2seet+dfsMmwXC2QOUvvQyRdvcjkyLpaFPH f/SaxMmjTJpn1DAgwbNsySd/4IoSdAK+993+YKCACk6EICSLM3Xdcr4woJgFRPqfnEc9n1kcXfMcccYzP7RAJI3XfZ 039zlRHWlQD1Akj/BIDs+mvkqDcZTyzssfOrgz+k/mLHWCQA5gI8TpgwwcydO7eSFQD8FQBZ10qtGEpNDy7Z/IAx2f b7/7ESALu28t7XYKy1DEDPB6wN8TU9/ggMpYTEnT/QGHDLotvNmz+dYwUA+g74sl6s995PkwW+ZwOlCQCA015cASCy 9+STT64E/1/+8pdt83cgIuAXv/hFJfiXx5AEQJ6ygXoSIOn2mz4t5T/PzTrte4qWEPjS8Mv3xnBZNf9S679582YLDN 26devspK4JJfU/acN/DAxJbBkAkACC7gkg/QAwh4TYEyC2eaL/wOHm81892j7utddednHuCn4tAVDvCUQAyOIPn8MR g5AA+JxIgPI3gMt3H8+q6c535KC/AsAN/t1MHwn+ACSACEBXAuBoOXx+t912804AJAV+No8EKNs68Zr7H68SAPJ5qe /HNSCNHoEcLa7HH9kD+vQHfY1cc8zAyrzyy/u+W8r5IKuEuHE/B7/lXz0BINk/GE83A0DKvnTaP97rKBOUjDGAz6Ec wJ/swCICoEjfiA73AGhVAJTl9SgAOlcOIMF8GjrgD+2c91wLPAb9hFQxbtw4mxGQNW+4nw+5H4Bv834R0AwQKbpD9t rFLtTxmCUA9HFPevGHR3QKFwmABSNKCnQ2gNfXQsZOb6PFny9HwaUJAAn+ZffXFUM6+BNcCSACwD2NyhcBUL/je6MF f/4goJfrQ/RnACjt0AJQjnQTCYCjHvVpDyj7wHjLNfCrX/2qIgAuuOAC+zV9f3Dlog/zvJYAbi+HEORfmgCQIyFFAG BM5ahXXf+Psi9kfkH+yn3gpptusu95VwI88cQTQfQAqJf2n69vTI8FQJGa/269js8SgMEiIYQQvwPcj3fqEPy7AgCL P5EActSTW/OpJQCABEDaKPBfAiSZDZ9CkgBaALjB/6o519hz3nVAp/sGIPhDEOhmAqBuHA3FdBaALxKg0XFv+bIG/J AAEIB4/+vdev0+x3OIQve0B5R9YLxFAD3++OMVATB+/PgqCeDvez+pCg6TBiUCvksAvN9FAtQTAJjXMc9D+mLOl2vF lQB47tcJYo3m8zwCsOQCoB21mu16HQqA7mUC7Dpg19SvYTfv0EMPDT4LgHX/hDQGZ/jiBo+FO+YFd47HaS8xnQYQuv i1mXwP/1tFArhfO+mkkyrjrY96Qs0n0j6x6NMCIFQJUL8uOPE2GKgnADBmH769ztZyo6M7yj/Q5d2VAAj+XAGAeQQS APMIePLJJ71pBOh2/E5PF88vAMp8HODGR2+uyeaS97qMrzR61NkdEgNIJgDQAkAkAOYDP9/7jVL/jffv/aICQK4N6Q OgJYCIAJSP6IagaDQZiwBIPS6yTAIgb81/N16DdNHyvvaaPaIxLZ0X533jDS9N/0JO6WUJACGNwXwhuPMF5hH3NJmY SgBCnCcade9HAI+ATtd8otmT7PKIBDj99NMteI7FpCwMw5AAjXZ5/AwEtADQwb+MPYJ/1IiPHj3aBgJAZwK4IOiTzv +4ZoBIgJdeeqmE10Dj4D97jRCGBMg6whNjKen97733Xl0JANIEAEqCRAL49/6PVwJkZQBoCYCeL5AAMs/L3P/jH//Y fl3uD6tWrQpEApi2SoCEi03SDXA048aNG80bb7xhSze2bt1qU7iwkN/vhP2CaPrXbIOvUBf1hLQCFv1YvGOOQPMnPO 7cudPMnj27NEe99nreiEUg4+xvEQBo7KQFgCzysPMjZQE4NlAyBWS3yG8J0DjY9zUQ0AJAp/7L2GPHH8H/ihUrzLJl yyoZAPJ1BHwaBH1Ya+Br//Ef/2F7AGzatMk8//zzds1RvmaA9VP/G7/3swVA2vD7FAxiDHEilGQCvP/++/Y0B93oUS SAFgEI/pH9cdZZZ9l+IIKf7//06yNJLRHyXwTkFQAYS8zpEDwiASAAcE08++yzVVkAFAAUAKTH9B30cX3XyJEjKws4 pPhGlxHBHX9CcoM5Qo72wfwx6P9n71+DrirO/G98oYgSlHKiMSCEARyUSYLl6dESBQPB4CEeIQoqAgE8QcTAT5RHDo +nBDxF1JEZCtCAk6gVxSGc4gSE8IcoBRg0opagM3kxmUqsSv2S8k1i2f98W69l795rrb3WPq7u/pb1qb3v077x7rV7 9fXp67q6T59g54sQe7+YAgDnQptpnnbDJ+z8YPH36KOPxtgiwPUgoJYESA74yhsEiACwd/9l7BH8I+gfeOV0NX/lS1 oMmsfGScBngmAAEkCO/7OziMof4KVn/BTLAnCzFtwcfzT/M7M7Pvjgg6rTHmRckfmBccf4o/wHj9JoUJg7d65j7//0 7I4ooUQoyhUcll8CYD6AxJHg/5prrqlqBoq5HGIHYw0JgHke8hfzPsQR0v9feuklfeLYYYcd5tSYVwXxiff9qOB9gA KAEEIIIY5JAAgALPixoJPdHVMAIMDHIxZ/EvhhMXjHHXdUNA+UmmLfsgDy7g5GJRQAdvBvp4gj+N//h4/USSedpGZ/ 858qAnpTAiBoQEBQ7sZ/1eOad3c+byAQefTex7giAATI4sDnUNIhcwDGHIJQrgdIAIw/ykvBU089pTF7CbhfCpAu9r ISAFwrBbj11lu1ADj2tJGJAgBzvvR7wc9gfsecb8q/Qw45RH31q191TvzU2ww06cjA1H5ChBBCCCFlDgQgAPC4ceNG 9Ytf/CIuBzBlgDR+wuJPFn0AEgA8/PDDDvcQiqoW+FkLwIqd4xIGAViwm6n/eWrF0Qxw17K7dG8ANI40JQBA2jd2fh H4uXD2d5Hgv76dYj/e+wj2kO4t/R0WL14c93bAaQ8iAVD2kZT14f6xsdXlHUUaSLqGWQqA58gAWj17bKYEkEaAEAD4 Gub/qVOnatwb+7xZPBklQCrHccKEEEJImcDCLuiAl+VBmRJgyZIl+hHnPOOoJwT9IgKQ9omvycIPZ0b7EQRUSoA0GR BZ11BZryVZ5NcK/u1rAEfH7VmxoOLYOCz+ESAiJRip3iIATLp3716ysW9mwFZbALg8p2DcsIOPsRUJgF1+9HgQEQAB gI8hAMyfw/sfpQT42cjpkgiV2OOhSBNJFyVAmgCwJYA0fDUlgIBrwO0sAFWXBEgvHaIAIB0GdTuhHftX601JCPkU3P wxR3B+4LVgLvgk+LdBsyeAEgGkfdoCAMcGynO3/wbpnzeDAlsAlOl6qif4l/HfvXy+evuni/RzSAD5PAIAEQBI+TaD P+wSC5Ie7E/wn54q7lMjUanzx6O5yw8RIBIADR/tXWKMP0qIQNeuXb1479vZPbXEjw8SYMe/zEk9MUIkgAgAZHvJ+x /g68gOwj0gBAmQ9f6nACAdCfZtVq1apebNmxfUYj7kjt6EFJ0zRAKYhCYAOF+kS4CkNHE0fJLdHln8+SQAVM1U/uQT ZsomAIoG/zLGLy6YqPnlQ9+rCvZsASDBH86Jnzx5sgY15Z0/DSBSrUnV9lcAmO9xCAAZQ3z87LPPagGA0x7sawLSB+ OPMgG3msHll8N2doAPAkDGWuYKCICkLIBaEkCQ4B/3ADx3TwI0lgVk3wcoAEjbF/Po3Lplyxa1YsWKoBb0FACE1D9v CKFlBHC+SF8Y5vkeiADZ+fFJAIR8/cjOf1o6MASANHzDcwgABH8oH0Hwj+wQf8c8nwDwcU545ZVX4iaB8nmUfUAAQP xg/H0+Qjapx4cvmR8I/NOC/yQJYAoAmftl/ocUdEsAtDALiJBOZQGEmtLLhTwh9c0bIZcCcM6ob/Fo7vyEJgDKWgLQ yvGWo94EpH1j5xfBX5cuXQK45sNcd2CskRWQlAEgmR/+j3/k5bozb+8WkQAQANLwVeZ9AVLQXwGgKAAIIYQQQnxqBE aJ1LxggYQBygX8z/zge998/5tHPvpzEkSzSsTYA4AQQgghAWCmgTII4PVAwhIAne/5UJ5+ASwTIxQAhJCmcMwxx2iC /Rt8PqMSQgghhBBCAUAI8VsAoLFjsBKgclYlhBBCCCGEAoAQ4q8A+OCDD9Rzzz0XpgSonlkJIYQQQgihACCEUABQAB BCCCGEEEIBQAhxXAI89thjlACUAIQQQgghhAKAEOK7AFi5cmWYEiB5hiWEEEIIIYQCgBDibxlAkBIgfZYlhBBCCCGE AoAQQgngfxYAJQAhhBBCCKEAIIQEIABOOOEECgBeG4QQQgghhAKAEOKbAHj99dfDlQCpMy0lACGEEEIIoQAgHoDgLq hd3ioY4KUJgOAkQOZsy2uEEEIIIYRQABAPBMCBAwcClgCRju0Y4KVnAYDrr7+eEoDXSCLHHXechhKR1wIhhBBCKACI AwIAAV64EiCiBMiRBRCMBKg56/IaSRKI4QoAzh2EEEIIoQAgFAAUAB5IgPfee6+qFCCMTIBwJED37t01wQqAz++mFA CEEEIIoQAg4QgABHwUAFzEmwLg7bffVlu2bIklgAgA/yVAntk38kYAvPnmm3WLABEA06ZNc1MCVN9VGxAAnD8IIYQQ QgFAHBAAd955Z8BZABElQMI1Afbs2aPef//9CgFgS4A8OHtN5JIAeSi/ALj99tvV448/XkgCSPCPucMbAVBIAtjBP+ cOQgghhFAAkJIHehdddFHAAiAKXgAkBewjRozQWQAQACgDkCwAEQBz586tkADyPI1yi4KUoD33LNxMOisB5s+fX0gC iADA/DFq1Ch18cUXByYBkgQAJQAhhBBCSiYAJNWzkbpPp2ko3bN8qdomjQgAJyVAE9J3Q5EAaUE3xh+MGTMm5owzzq gQACgF2LFjRywAZs6cqcaPH6+D+yFDhsSB/owZMwqBaw7XW3uuuYLBeJsEwOe/rrPXXD0SwBQAkEbOCoC6JQAFACGE EEIcEQBY6EndZ9ACwHEJgCANu7Po2A6KygAs4BHwzZ492w8BUMcOXkgCQNK1BRE/ANfArFmzNN/61rdiAbBp0ya1eP FijQiC6667TguAK664Qo0cObIiC8AM7tOQ60yutfZcb2nBWoMCQDUj8O/89Sb3hZ///Ofq3nvvVS+88ELm/cG8njCm 48aNU8OHD1fXXnutP1kAmfNIreuJCxRCCCGElKgEAAs71HyazZ+CkgENBY3lkwBSoy0iwJYBaUJABACCvvvvv98/CV BzbKMgJQBAkz9bBOAaAJMnT457ANx3333qr3/9q/rzn/8cX1vnnXeeGj16tJYAABLg5JNP1gJArqPyBP7VQVt18J0t Aao+3YAEKFvgnyQAkAFw1113qa1bt6beG0wBAHmEsfdSAKTOHxQAhDTKiSOuroJ/F0IIaaEAwCIP6Z6SDRBURkDDO8 flLAVAejYW5KYMQKAHkkSAFwKgiASoGt+wBIBdCiDBeJIIQEB32mmn6eD/S1/6UgVybeHrF1xwgf5eUwDYEkBev3OB f/KY5xEBSUF/ogjIGfyXOUAUCYDdfwgAZALgPrFkyZKKe4MZ/GOsMX9g7FEC4KwAKCQB8mSTcIFCSB4BMHnZriooAw ghpAUCwJYA2PUBjRwH5f+OjxsiwJQAWSJAmr2h3hsp39j1TZIAp/bu7pcIiIoGa/6+B7JEgEgAEQD/M6dLLADkuSkB RADIz5Zn17+2DMgSARXJAObc8JkIyHNdlXXXP+2+sHfvXn1vuOOOO9T06dPVnDlz1KJFi/TXjj32WH8FQIE5hAKAkO aLgId2fKQREXDG9Xfz70MIIc0UAKYEkJ0e7Pxg8ffqq6/qhR4lgNsSIEsEYBFvlghIHXeaBAAXDjrKo5KA2mIglFMB kkSABPAI8HHd2FkAwv79+7VEkkwAUwDYu/7Tz+lbUqGULQKijOsqTwaBS0Eh7gmY/3EvMCUAeOihh9QPfvAD/T0yv9 gCYNKkSf4LAEUBQEijILgXzI9NEUABQAghLRAAsuCTlE8gIkAkgPfZAHXXj5dfAtjZAEC6uqO+2wbBngRxZvC2fMYl as3CSfrRiYyAut9RYQqAJBEgAZ6UAiDQx6MZ/IscgACoFfz/ZM7VatG4s0t+/aTv7qZJgChXKYlb1xDmfcz/y5Ytiy XALbfcom644Qbd4BEZAbgvSLmHKQCCyQJQYWcPEdJo8G+m/JuBPp4j+N//oWIWACGEtEoAiARAwydkAmCxh0UfFn/4 3ObNmykBHJUACLySsgFwcsD777+vZQBAp3dp9gZEBJhB3MCBA9XQoUM1kROL24Rd/hy7elFCnbh+NP4LQQSY2QAiAV 577TX9KCIAj9u3b1fDhg2ryB6Rn8V1gtd6+YHpGkiA8mYBqKoa78RrIYcAqLz03LxeIAEw/4sEgByeOnWquvnmm9XE iRPVpZdeqr7yla+oo48+Oj4BQgTAlClT3BYADUoACgBC8mcA2BJAPmcKAEoAQghpgQAwywGQ6mlKgJ/97Gfq17/+NS WAo4FfmgQQEYBsABzxZjZ7k9pukQA4Ax6vs2HDBnXPPfc4IgCMAKxA8J9HAng/sXwWuNvZAEjzR8CPNHBcH0888UQc /EvJgAijSP/dInVmv57qnWcX6+AfQAS40VciORvAbACYmingQfCH+R7yF/M/Uv9/+MMf6uAfIBMAEgDXwznnnBNLgP PPP9+PMoCiWUQUAIQ0LALM4N/OAGAmACGEtFAAoNsz0jtNCYDF36OPPqpeeeUVvSskJL3GsOO7xkSuLYAK7xK7JQEk mLclAIJ7CAAc82Y2eJOUb1MArFmzRg28crqav/Il7yRAvLubENyZAiCEiQUB+uRTv6iDdYw7xh+IBEDQj+vjww8/rK j9x/WE77/sssv09QFZBAEAUD6ybckshwRA7WyANFHkS/CHewLkL+Z/gOP+RAJAAFx55ZXqiiuuiCUABABYuHCh+wKg AQlAAUBIY6UBdjNACgBCCGmRAJAFH7o9QwCg5hNpn9j5kcUfFn1Y4GFnyJYACPpXzx4bQwlQTgkgvQFMcBSg3ehNUr 4R4CHwe+ONN/RrIPjf/4eP3BvbKKcASEnvDm1RjyBd0vYlGwDXgNkbQDCDf1wXkAV4RIAIUDaCEhL0kVh64wX6tSVD wJlrJ8pb7//5pRYp90tHcE+A/MX8LwIA9wERACgFwK7/SSedFEsA3EO8EAB1SgAKAEIaywaQ4J+7/4QQ0gYBIAs+7P ojzVNqPmXxJws/WwLIYv6//+Mxne77+43/SglQYglgi4AkAWDWeIsEkEwA1HEDt4K4bAmQp8lbSAt7EQDYtcfuPcbb zAbA9SIyAMeHmmn/AAE/MgCQNYLSEUgAvA5OksD1hmZy6Bng2vWTVCaSdl2kC4DIqUwBzPMy95vBvwiAiy66SA0fPl zfOyACcH+4++67KQEoAQipKwPAPCFAMgIoAQjxs/SHlEQAYLGHGl8s0CXd0077BKYEMNm17C61e/l8LQAGDx6sRo8e 7VagWOCbE4PGhACgrBJg7ty5aubMmeq6665T5513ng7qzPPeIQBwLSDl2xQAGOM3Vt2rxxnSxysJYI1pyAIAu/XYtZ cGkHjfSzYAwPXy7rvv6iAQH3+04yfqv15aomZ/85/UwJO+qrNFUDICEYCfR1kBXhcCANefKQHKfA1VBvHVZQC1rots ARA5IQAw35vzvwT/tQQAftY9UVgd09cjACrKigghuQWAWQbA0wAI8S/wZ2lPyQSALOyxkEMvACz4kAlgp32aEgDlAV jkYRcQ2EIAQAKICHAh1bceCZB2hngZm8eZEmD8+PEajE9aFgDqvfG9+Dp+9j8fnKH2rFig3v7pIvXigonelAPUygII bVcPu/XYtUfwjl187OYjmIcQMBsFgq5du6qbzz5eXxsQRMgYQKmI9IsACP7N0gEIAJEAZc4GyLeTHxWbYxw6Ox5zOG Qv5ntbACD4HzlyZJUAWLBgQSwA0CcAuCoCoiISIKVZZOT4go0LLtLa91hUFfwj8Afc/SfEP8En73NKgA4LALPjt3T9 xmIOC7yktE+AhR849dRT1fHHH6/Pfv7+978fiwDBPAu8vIu/hB29OleJSev6Mi7wTQmAxTkkgJzrLoG/dHpHszdpIi gSAIE/Sjx++dD3HN3dyycB8qZ7+5oFgF17CAAd+H/WABK7+9jlx24/dv0lsMP1ADGE7BCzRAS88MILaufOnXGwD0QA iARARkoZr6VmCLwsQVh5bbkhAWT+NwXAF77whVgAoLQIAgAnycg1gCazwLwuXJECue8LduPQxGuAAoAQM/i/6cEVqQ KAAQIhfpX32BKAkq/NAsDcvTMDfwELcpzzjPrvtLRPpIZDAPTv31+deeaZeuEHCWC+jpwlb4qAUu32Rxm79/WsEFMW 9mUTATIWQ4YM0Qt4CACMtez4I9CXM96l0zvGEinfdr23swIgZZyjjIAtxGaAMsbSABLBPXb5sduPXf+/7Vuvv/67tY /rrBCUhuDj119/XTeGw+scdthh+nOQAGguuW7dOs1TTz2leeCBB5xPFU9MHY//f6Ja04QTpQAiAWT+Bwj+bQGAE2Qg ADCfmBLAFAGmEPAmEyChYWRU41ZBCUAoAFao3/z+L1XBAYN/QvySAGYZgA3/Ri0UAElBvxn4m7tzAIt3HPGEHWIJ/C X4TxMAkASysyyvkyYC2i8Dsup3G1yVR7VJ/n2dzwDAc0gAPEewf8YZZ2jkjHfp9I6MDqn3xueuueaaOLXXaQEQ5RvL 9OslnIUagADALj92+6XRJ0A2CDJDpC+EKQAQHApJO8CRh3/HipMBlB/yCBIAZV+Y903M4B/3DFMAYB4RCWCWArgU/J s9YlIlQOqRkKYEiKzrg5kAJGx6/vNZsQDAc7sRIP9GhPgvBpgF0EIBgMWYHfQjqBPQ5X/WrFkVIMgTCYCjnsyUT0n7 tAXAuHHjKoLGJDqTFVAg6K9HAhR4vTKUB5gCAJx88skxsuNvjqEc8yb13l5lAOQcsxCD/jQRgF1+7PZj1z8pmEcm0K 5du/Tzs88+W82fPz/mxhtv1I0n8Xlfg38z6Isy/nNRAACUfWHeF8zgH0gTwK9//ev6HmFKAGeD/6zd/5rzRXU5ABcx hHwqAEC/MTO1CBAJ4O+9gRBCAdBmASBMmzZNM2rUKDVixIiKoD0JSAAs8CTV08Tc+QHS8Mlu9GWCXeRbb71VB5amCC hTwFdIAjTwunm6iLdSAGA8ksYcY4PsDfuMd9R8I+0bO78I/pzuAVA4+OekIwIAu/zY7bfHH89xbvyzzz6rJcDatWs/ LR/4e+D/4IMP6kfIRQiAKVOmqMsvv7xCBPiw6DPf03kkgEsiQBq+oucLpK9gBv/gkUce0fcayRA466yzYgGwceNGd8 dYRbkEcpYAYPDP7AJSmVWG4F8eRQLgkQKAED9LANL6A/Dv1OIeACICsKsPJJiXj00ksIcEQGNAQdJ5zZ0fHCWH4P7b 3/62zhTAo7koFFAmgN9vlgK0txygiRIgag7tXhSaAsDsxC47/vJc5IzcqNH4LekUACdPAmDw3/DCLWnc5fMQAcj2Mb MAkBouAuCmm26qEAB9+/aNn/tSAlBEALggA0QAQO7IvUHA/I/5fd68ebFovu222/TuPwSAmQXwzDPPuDlv5BAAkZVx RglACUCy7yWSBWAKAREBlACE+DXPm3O9ufvPe0AbBIAtArCbYzJp0qRECYBg38be+UkK9m3wO8sxqUcdpLP/77YAkK DfFAES/F922WVqx44deszQ/R0N4FADjjRwqfdGsOfWjbpY2n+eJBBOStUS4NBDD60SAHhE4I/rDwGlLQB8kgCqDgHg kgTAfI4MMukTgzl/woQJ8RwPnn76aQ2C//XrP20YibEXGeBueUc+aZjskSPOGYRYMllkgJkVwL8RIf4gJ3wkNQTk36 eNAiCpPMCUAkjRhQxYuHChWrRoUdWOjx38Y+cHiz+TpNdGADBzZpkm9+w6/bx9A/L+TBkW+aYAyOrTYN6Ycf47joBD EzjzmDcEAkj5dmtHr5lZGVzM5wGB/Zw5c/T1AgEgYgBHBErwj8+jLMnLpoBpQX/K18ouADBHmEeJSsaXzPvoDYBxtR f4+Dx+Bo+bNm1yMnsonwBIk72dy/wipOwSQLIBuPtPiN9ZAECO+6QA6JAAyCsF0NgJLFiwQJ/zjN08gM9JzacNSgv6 9eunRo8erc4991wtDaQm+Lvf/W6JJ/h8AX59jQU7n+6bJQDs4B9nwGOnD49yFJx0eQdo9oagzq0sgGLBf9J4RSn13i RbAnznO9/RQb9cXxIkIviXrCM0mvR10v78RABjIndIAiQJAICyL1MAXHXVVer222/XINjHiQDm9/suAPLcGzhn1J86 SsIrLyOEsPyLtFgA5JUCdnNB2eHB4q937966ozwEgJwgAAmA70Hwj+ZQ+B53Jvsoe2c/5wKxDOm+aQJAgn/py3Bmv5 4aCIA1a9aogVdO1xIA44W+EADP0ewNP4uUb9cFQNLpDMljZYwnywAKL/Dsz0EiIXhEKvlhhx0W5ITumgCQciHMJXYG AOZ2AaIY9wXM/xABcnrA1q1bHRzrohkAUY17BgOdPAtEdokmhBBCOiAAZPEHUL+JhRyQo57Q8El29LDrIwLAlgCSBQ CmTp0apwI7IQE+e5J9zFOeTtHVu3+dkACmALCD/5cfmK7eeXaxFgBDhw5VGzZs0FkAdgBnd3F3uQ9A2tGMWYGZi8e5 lQ00FoUAmDx5sk4n79atW9DBf9kFgBwlKwIA84jZ4BWZXzL3X3jhhfpe8OKLL8aB//Lly9VLL72kDjnkENWjRw+vBE DeniKdPAbWRQHANFFCCCGkQwIAAR4W6HiEBEBnZznqCc/R7AlfEwGAxZ8sABFUYgfILAUw04BdkQCVnZyTJUC+BaKq scPcOQHwkzlXawGAx+UzLtH1/5AAAGOEFG7s3OEkCDnfXRq4+SEAVKYAiNN8lftnu5clKwByCQJgzJgxqkuXLswAKP G/FXOESIAkAQDhC0QAIOgfO3asWrp0aXyCjNspvo1LAL7vWQJACCGEOCcATAmAY56ACAAs+JD2icAfz81sAFMCiAhw UQAkBfpRXQvEzgsAM/hHg79F487WwT/YtmSWWrNwkhYBk0/9ojq1d3e1c+dOPVYiAOSMdxEBLgqAIum4puihBGgOuJ Zmz56td4VDndBduX5qCQD0fEG2FySAlAGceeaZ6tFHH/WktrcRAUBYD0oIYT8IQhwSAPKmXLJkSYUEEBEgRztJnSfS PrHzg8WfWRNq8sADD7hVBpAgAaobwUW5F4lRh1LJTQFgpv4jwAcQAcgCAEtvvEBdOOgo/XnU+yL1FxLAzACQppDo9O 6GBKh3Z67yZ7KOdiPFBMDhhx8e9ITu0nUjEiBJAEDwSskXvg/iF3O9PwKgPglAAZC/zt8+HorHRRESFnISBE+EIKSE AsDOBjDPecYiEBIAaZ9Y+Al33HFHzMMPPxz/vJsCIEoQAdXBZfbpAZ0VAObuv/l1EQECUrOBCIDXXntNj9eNN96oZs 2apYEIQC03Or2XfyyL7v6nixsKABIaWQIAmV0iAfBIAUABUFQC2MdDsQ8AIeXM0GmmmLOPg+w3ZmYsACgBWJJFOiwA krIANm7cWHXOs2QBSL1nFlI/7tIbPEp5Xqvevyy7fyIAkoL/pPHG98oRXhAA69at05+/7rrrYnCUG5Bj3lwQAPlT/w sIAE5QJBAJAIGIkxsk+IcElHldRACAAID09WsRVy0BKudxCoB6F5aTl+3SMsAUAlxwEtLZ9ybel+b7UD5nf77euOKm B1fEIPg34wRmApT3OiCBCgB5fOaZZ6rOeUa3ZwiArNdB4I+gccSIEU4KgNpNAaNS1v5i8W6m/9cabwT9kACCCACM35 QpU9RNN92kx92lYx1bIQA4OZHQsgBuvfVWHfzjfT9z5kwtAXDUqykBwhAASfM5BUAjIoCp/4SUO+hr1jGduDf85vd/ iTElgGQEUAAw+CclEQAS/MvnUAYgRz0BHPVU6w2LBoCCWw1KVNWCLqpjwddJAZAn+E+TAE899VQc7MvOP44IcyeTo5 5zuJPHlhKAhF4GIPMI3vsI/nEyjJkJEIoASM7o8lsA9Bt2Nd8PhAQQ+CVlADQzQwevIcE+nlMCUACQEmcA2LU7mzZt 0mzdutXrjt5RDTFQPLhUpRYAtgQwBYCUcACk/7shc6I6x6iGAOhAPwdCyjSPYE5AwD916tQKAWD2fPFTAqSVdfknAD CGCPwFLsoJ8T/4z8oCaCRTxyz9kd8hjwj6TRHAMSlHnxb+PQIWAGlvRPkazonv0aNHwIMUlV4AFAn+TQEA5PQGc8zl SEd53r179xJP2PWOT/Zi3gz+KQJIiALAnhOAzBciDF3L+GpUJEZRZ3u+tFoAUAIQ4rcAQOCXtftbRADY5T0S+EvfD1 MESG8AiACOR+eD/1rXAfFcAJCAL7y/T8Zz586tyv6QMg7p6YDTAMA999yj+0Bk9YLwIfsjyvEfrx/iqwRIEgAS6JtS UOYHfwSAShWCSe99X+YDEQCyKKQAIGmBIHs4+CUB7LGsVQZw4oirY+yAXwJJmUfk9A8zyDRFMseiPCLIHDv+fSgASE ASwBYAUgKAxf3FF1+sJkyYoCZPnqyZPXu292e8UwAQohIlgA0avvolAOqbF1wfW3sXjwt0klQrbqZzM1jwI/3bpNZJ HQj87cBRdpJNJPi3jwAl5ZYAzAagACAUAvHiHgIAR4NdccUVasyYMV73gghhsU9Io3ODDf82/o0t/ybEDvizxABxN7 vDTgXPkjsiAMzA3wz0k8QAr5Hyvq/NceN4UQAQUrEg7Nq1q+4B0a1bN9WlS5cg35wM/gkhhIQaLGTVEDNg8EME5M3q MMsAkmr9zcZ/lETl3/1PKtVI+zk5vYF/QwoAQgghhBASCPZOMSUA5YF9TTR6kgBprwRIatiYNHY8upECgBBCCCGEMJ BgoMdrgH8HDwSOPIoQsL8fxzeaWQAsGaMAIIQQQgghgQUQSB9mqjchfkgAu6+DLQDi558dGcumsRQAhBBCCCEkMAHA MgBC3H8vS/CfVApgp/9L8E8BQAFACCGEEEIC2z2kACDEn/ezHfiDmx5coTMAZOcfyPueAoACgBBCCCGEBFTvzz4AhH geqP49yJcSAP2cJQAUAIQQQgghJIwUYQn2JfA3P0cICUMIsAkgBQAhhBBCCAkoPZjBPyGEUAAQQgghhJCASwIIIYRQ ABBCCCGEEEIIIYQCgBBCCCGEEEIIoQAghBBCCCGEEEIIBQAhhBBCCCGEEEIoAAghhBBCCCGEEEIBQAghhBBCCCGEEA oAEgAnjrhaw78FIYQQQgghhFAAEAeR83nTzumVwH/ysl0anuVLCCGEEEIIIRQAxFEB8NCOj9T+D1VVgI/AXz6P5/g+ SgBCCCGEEEIIoQAgHmUB4FF2/RH8y8eUAIQQQgghhBBCAUA8FQN2tgAlACGEEEIIIYRQABDPhQBKAkQAUAIQQgghhB BCCAUA8TD4R8BPAUAIIYQQQgghFAAkAAEgDQPxyOCfEEIIIYQQQigAiMcCQIJ/ZgAQQgghhBBCCAUA8TD4N08GYAkA IYQQQgghhFAAEMc4s1/PmsG/ifQAYBkAIYQQQgghhFAAEA8kQBRFVan/Zg8AZgAQQgghhBBChH79+lUQYsBu/kcBQE otAAQJ/m96cEVFBoAE/2wCSAghhPi7cMcaAIS6cOe1QEj988eBAwcqCEUCRBn/OSMAGNyFx+/WPq6BBBAB8Jvf/6VC AjD4J4QQQvxcvJuL9o0bNwYlApq9aCckJE444YSKgD+0LICoxn9OCAB2eA+T6ef0VVdeeaVas2aNlgAiAHr+81kVEs Dn64I3/Rb9XSP+TQkhxKW0XQAJcNttt+nFPRfw4d23G7l3h5pFEioI/DFPhJjyb88fTvcAYPAfJiIA5q98SUuAfmNm ahEgEsD364ICoDlzh3mdTD71ixouBgghxD0pgEU9JAAX9ZT3RX92//79Qd/3uZ4kHRUAzQzc8DpDrp3NAfGUvn0/zQ LAOEs5gCkBfA/iKAAanx/MBpHLZ1yieXTSCJ1hIiKAfytCCCknXft01fP04MGD43t+qP0AmL3XmADYs2cPBQDnFNJO ASBBf7NTt+X1KAH8D+KSJABgAEfyXDubFt2s+c8HZ6iBAweqoUOHakJuLFWmxQCzvAghNt26dVMLFy5UBw8eVK+//r p644031ObNm/Vjl2O6BF0GwOujPgmwfft2SoAA/j9POeUUNWjQINW/f/9YHvbp0yfIdZ6MebPGPioS+NtntjciAcwM glBqwRnI3a0Df+zaAmkMyDRukkcQ4vHN1ffp6+acc87Rgf+GDRvUPffcE9z1U8ZFJPu8EEKSgjUE+uPHj6+43wv42p cv/LIWuiC0LEBzUc+SgHw1/xQAYQiAkSNHVshCyENIRMhESMWQxWHLjgE0F3BmcG4e2ybntzciAMyfNXf5eNP0Fwb9 pJ5rRuQRrhk8Pv3003FviYFXTtf9JeR6QlkJd/+ZAUAIKUdwBw7tdWji17DDt3btWt0PYMiQIerkk08OWua6GtgldW XPu86rJQDsmn9bANT6Pe3oGN/KsUt63SK/y7XrCoG/BP9J0hAyUb4W4vquZQIgKTC3U/8l8BcZ0KwsAPM4OPPzvIn6 w7Bhw9SECRP0YwgNAKuJDPzcrW/G61x22WX6Opk2bZr61a9+pRtGCZj0sesPAYBHBP/7//CR/jyCf+kt4c91ElVdN0 whJYT4Aub1559/XkuAEBsDui4A5KhHM8jGDm0zgrSkmn/JHBFZJB+n7Qon/ftaHbA1cyzTBEDe3+fStXXnnXfqsQSQ g0nXT69evbzdRMwzF7SsBMBuuJWnHKARCWDv/gt4TfORN0n/JEC4WR9+CoBmpYBjUsdrQAJAAIAf//jH6vrrr6+QAA KCfSkrkc+FIAFCEkKEEH+yAWwOP/zwmFDTuV3f/TcDbDR8RJo2dmqTMj8arfnHI9LB5WP8DvyunTt36t+d9O+DRHBV ACQFfUkf+yAAEPjLOo9zQRvKSLJ25mst9s2SgGZkAtivzbIAP4EAQFpXmFkAnwZ3ETMAqkCjlxNHXB3PJZIJACAArr 766lgASANJCfbfWHWv2r18vvrv/3gsFgNuBv15JIBbUohzHiEEi/v169erd955R/32t79Vb775pgYlAFIGICIghN09 X5oDYqxMAYCPUaudtGvfCgEgn3vrrbcSrxv8u7Zs2dLSMoAkAdDMndtaAiDr9V26riZOnBiDDI80aWh/LbRsoJb1AC i6uJNAvZnBupkNwBunf0GigGyAcMsB/M0GSBrzPKd8IPg3M4ogiSAB7r///lgAmNfPb37/Fw1OlMBN4O2fLlIvLpjo sACwFz7K2eCfWQCEhLfDX08mwCEDDtFAAogQYClA5NS4b9y4MQ6w0a09KUCH/GmWANi9e3fV62OXH787SQCsWLGibQ IgbfzaIQCyPl/ma0qCfkgiEYPCY489ptatW6evH2kGiEdcE4LrIiBq8L+2CwBTAgi8CZJaIBA0T31gA8gwpE+eoz7N 3X9kA0gDIAAJYM83+Fjq/kUC/PKh73lihKNYAkSJ2QFuSD5e/4SEl+LPv0d4Yy8SQHb77QAdmR/1XBvyen379s0UAH v37tXrBjv4X7VqVcubACZJgGYLgDwZBmmlAS4IJQT7kAADBgzQpO3+JwH5YzeLDEkA1vsz3OEhHZMAUkKCa4iLBj8z PWxRaM8X8rEE/yKDxo4dq02v3YTUPoo0SQKwTKR8ko/vCUJILXr27KmOPPJI1eX0LppDT+8aZBaAiwIAWRtSooej2+ wAHWUf9QqAffv2VQiArVu3Vr3+jh079Jnx5s8iVXzevHkUAMrv9TXlYwcyAAhpNECUgI9vXD93/fMe9WkKADNwtHf8 zbKjNAnAv385JR//LoSQWtxwww0alAJg93bgwIFBlwK4Erwh+IcEMDMAzLR97PA2kgHQo0eP+ONt27ZVHQMonePLIG /KIgBcBKJHwJjL81CC/Hb1BaEAIB0Dtf+o7w43Xdj/+v8iR33KtWAG+Ph++Rkz4De/JgLA/e7/kZdjzxIfQki9IgCn wHQ5sYs68cQTg+0J0Gjw2Am6HNOlIiBvVAAgG9DMAFi9enV8DCAeUSN+7PBjS53N0WwBUKvngOvgPe9rzX+jfQEoAI g3gUKjR0mS8o9xraM+ZUJPai5qnjRiiwG5ZpgCVh7ZkzbmfH8TEl5PAP4twuTLF35ZZ3EgMwAnO+A5mj02KgDwGqYA gGRYuXJl/LEvdd1FBYCPEsDnmv9OlwpRAJDSBYj8e4QRHKYd9WlKAHPH3+4BwOulvOUe9udMyce/V9igyVPwdZe8Dk gAoHQDJQHPP/98QwIA7Nq1K1UA4BG/p2wCoJk7t6EKANb8swcACSADgAFdmFIgacxtCZDUAJDXSrmC/6wGj6bk49+M AgCpwPX+PH4WqaEAr+VaanizAoEQF/3EPQEwZMgQHZxDAOAREqCe1zJPAUCgnyQAyhYMNvvItrSAn/MAoQAg3uwQEy ISQMoDmEruzu4/JR8xufPOO/UCXs55biQLAALgiCOO0IE/zod2QQC0YieQAoC4gATneA4JIPIPpz0UeZ2XX345/hkz +JffUdad4LRAvZFj3prZW4BQADS0SHe36RYhhJBW7P5T8hEwcuRIHfSjDlh2/3HGM74mO3p5QbCPn5efEwlg/i4Xgv 9GgwAGAsRFpAwAz3HUI5o8FhEA+Bk8X7p0aSnr/RsJ4lv5s4S0LANAJADA88mnflHDPzAhhPgvAFiWQdolABDwy8/h dfDxqFGj9Mfnnnuu/l2hCQAGBsSVrD7JBuhyepdCAgDHQUrQX8Z6/0JBVx3Cju9zUtoSgKQujctnXBIDIcBmDYQQ4p cAME9poAAgScG/HAWGRbt5FBgC+SIp/Pg5HPdlCwApKRg7dqz+fWU5Nz7Pjn0zUoEZGBBXMAUAsgHySoAnn3yyQgC4 Gk/U+/53+UhIEkAPALwh+w27Ol4U2kKAf3BCCPEv/V8yAJqZBdCvX7/A/8Zu3TOxw3/gwIH4YwT9CMbN+799FniPHj 3i78m7xli/fn3FeeB4PfM4MLxeJ0oB8gb3zRQAtYRAGXZ8uf4jSRx6ele9qz9t2rSa39vlxC7qiSeecHbXP+97uVnf S0hHBIDdqIsTPyGE+C8Ami0Bhh3flX9nR4CsQfAPCSCfGzRokNq8eXPFGgDPsWNvZgDgfO8iAgABPsRBklCQYNPMOp DMgHbu9LdbANTzPe0SADirG2d2p53nXUsQIPgDLqd8N+Pv72Pwh0wdjG0eAbBs2TLv4omiJQC815DSCoCkUgD+kQkh xH8JIGUAZj8A+xhAIU/j2Pljz2YWgCP3UBEA5nj179+/andfUvhNAVA0A8A8DswWCvI5iAcICPNn7X9fSAKgkzuIsh bcvn17DMZw3759+hECCOCcd3yMZm8Au8NI+8bOrw/BX9Tgf77OcXlKgMrc5b8dEoDBP7OLnBAAhBBCwpIAIgIgAUQE mNkAgvQJwE6xuVscngCIcgb3kZPBPxg8eHDV7r6k8Js79ggIiwgA8/vt1zMlAQREnn9nK4L/vAKgnsV9np/P+vd0Mh tAgMAByOSQ5wKOekO3dwR9go87vwz+CUmXQiArYwhZRcgu8lEA5HnfN2NuoAAghBDStGwAyQIwJYCIALM3zJZHZjID wGMBgDE+ePBgYnDeTAGQlGVg/95WSoCsQK2TAqDov5W7coSQToJyLgGZXcgWg+DFHA/MLCIf55l2S0EKAEIIIU2XAG bQLzv/+JwE/w/PnKBGjx6dGvyjB4DvAqD2jdxdAdCnTx+1cOFCNX78eNWrV684QDSzApohAMzXw+/B78Pvxe/vpABI W7C1UgDUWiS2QwDkrfk3OWTAIRrs9q9evVqf845O79IxPpSaf+7+k9B3/o844oiqrCDJFPJdMLY7E4gCgBBCSNNLAu R4QEEyAUwBkHQOfCjBf+3gz936f6Fbt24VO/QI8JJ27CVgrBVc2t8nGQDSIE4+xu8t+m9tVQZA0b4ARa+XIkcLtiOw TKv5l1r/3bt3a7Zu3aq2bdumA34TX1L/oyb8x/sJCTH1P9Tso3a/7ykACCGEND0DAEG/2fRPpACeI8BPEwAIzkJJ/U ++2UfKtSMAs8bMPgbQ3vGXXeM8AsD+vqSMgKzXadW1VfQ4r2YLgDIuMM0FuQTzSZgBv2/HvOUZIwb9hHzKxIkTdeo/ JMCAAQM0ebOIfOgJ0IgErLehLC88QgghTc0AsI8CROAPIAEgAAS7DEAkQSh/r5AW/Wkp/3l2bpK+p2gJgY/jzaCREO JTBgAkgGD2BJB+AMgk8rEnQLuzhSgACCGEtA0RAQj+ccPu0iVK/Dr/VuEIgLK8HgVA6zIBDu11aOLXsOt/yimneJ8F wLp/QvIzatQonRGQlj1kf97neaFV8z4FACGEEELaFhDmqflv1+u4LAFcCBalLwOaMyYt5NHpe+XKlXHTv9CO9WLwTw jp2H2IEEIIIaQdAWEzajWb9ToUAK0HTRl37typ3nrrLS1t9u7dq3bs2KHFwLHDj/Wi6V+9qb311u8S4isjR45U5557 rho7dqzODrLnBZz2EtJpAC29fxBCCCGEtDMtvNOvQdpH1z6flvwMHjxY9e/fXw0aNEgv7kPcdeOOPyHZQA4KdtYQso ns02RCKgFo1txBAUAIIYQQQgghpBQMHDhQZwMg2N+8ebN+PHjwoFq4cGHqUa+hZQ9RABBCCCGEEEII8QZkCiFjCJlD 2PXv06dPsFlDLAEghBBCCCGEEEIIBQAhhBBCCCkf/fr1C+64v1bU8BJCCAUAIYQQQggpVbBvs2rVKjVv3jzW8PL6IK QmOA0g+ECdAoAQQgghhLgiAA4cOKCP/9uyZYtasWJFLAIoAHh9EJIHzCGhzBntyhqiACCEEEIIIW3JAgh18c7An5DG RGKoc0krJCIFACGEEEIIIYSQUksAITSZSAFACCGEEEIIISTIbKKQSwGakUlEAUAIIYQQQgghhAQiE/iHIIQQQgghhO TmmGOO0QT7N/g8miKEAoAQQgghhBDitwDA6Q7BSoDKiIoQCgBCCCGEEEKIvwLggw8+UM8991yYEqA6qiKEAoAQQgpP SlGk4d+CEEIIoQCgACCEAoAQ4rkA2L9/f9ASgGdFE0IIcUkCPPbYY5QAvHcTCgBCCKlPAOzZs4cCgNcCIYQQRwTAyp Urw5QAyTdxQigACCGkqATYvn07JQCvBUIIIY6UAQQpAdJv4oRQABBCSN6afwoACgBCCCGUAO5mAfAeTigACCGBBO/N qPm3BYDvjQGTgn0KAEIIIa4KgBNOOIECgNcGoQAgrtOvXz9NqF3ao8/+47XwKd26dVNvvPFGUwSAXfOP53jtk08+ue Jj/E4fr4c0AWB+PpTrT+YZIdR5hvMNcQkEe0EFfFWEHfBBALz++uvhSoD0BQ7nB0IBQNxelB84cCBm48aNQYmAKOG/ UAUQnvft20ctXLhQjR8/XvXu3avpNf94xGJCPsbvwO/auXOn/t1Z/7Z2BPzR34wr4ePWSICK4P9j4/f9LWqpjOj09W XOMyAUCRBl/Md7EHFBAOD9Gq4EiHSsF2rAZwuA4CRA9gKHcwShACB+7MoBSIDbbrstiMk9qvFfKAJIgjEE5gcPHkzc tW+FAJDPvfXWW4nSyf73tXL8W5W2nyUAar2+69eiBA8yhqFlAYQ+vxD3g38Ee+EKgCh4AZCWBQCuv/56SgBKAEIBQH wKCjGpQwKE+uYJVQAMHjw4MUBfv3590wTA7t27q14fpQL43Un/PnytXQIgbdzbIQCyPu/qtSiBQ4gp/6HNJYQCgAIg rCyAYCRA7YUO54sEjjvuOA3LhygASAlB2jUCMARfkvofUh8ASbsOdYGOsbYzAOz6fzx/55136rou5PX69u2bKQD27t 2r+vfvnygAtmzZ0tIAsh0ZAHle30cBQAhxXwAg+KMACHsOFgnw3nvvVZUChJEJQAlQT/ZfuAKgc/MGBQCpCRqvod4b Kd+Y2BGobd68WT+GcMxLZnLuJ1EwAgAlH6YAwDVgB+i//e1v6xYA+/btqxAAW7durXr9HTt2qEGDBiUKgBUrVlAAUA AQQtq8gL/zzjsDzgCIKAASBMDbb7+tpbxIABEA/kuAXAseb/5/u3fvrglWAHy+CKMAIP4Ffgj00YDN3PkX8LXLL71E DRw4UOOzAEj72p/+9Kcggi9TApgZAGba/ptvvtlQBkCPHj3ij7dt21Z1DCC+55RTTqkK/letWtWW9HG7DKAMAsCn4B 9jC8GDLA/JNurTp0+QpQBZ1xkhZQn+L7roooAFQEQBkHBNAJTkvf/++xUCwJYAeXD2msglAfJQfgGAdV+9IkAEwLRp 09yUANU38QYEQEQBQMoV9IGkTu/4PBbsa9eu1X0AhgwZEh/b5t3f4eMod3aAz9eC2fQRpt8MyBsVANg1MDMAVq9eHV 9PeFy3bp06/5sjqn4WX5s3b177BcAn+RoDNiIA7J4DkE2+7v6PHDmyIrsI1wOyjpB9VKbjHzuVbcT7EWnFbq1JIwLA SQnQhMV7yBIgKWAfMWKEvpYgAFAGIFkAIgDmzp1bIQHkeRrllgIpQXv+hU+dlE8A3H777erxxx8vJAEk+Me84Y0AKD SP2ME/BQBx8Cbw/PPP6+AwxIaAIS3U7aaPyP6AAMLnDz/8cP18wIABDQsAvIYpACAZcJPotGCyx9jM/pD/Pvnkk4Zf G6+RJAB8vL4Q+Evwn5RlhOwju9+Er/NI0QykTqd9NpL66TQNBY3lEgAI0NC0DRSVAZj3x4wZo2bPnu2HACg8ruEKAJ E/ANeAcMYZZ1QIAJQCoHRPBMDMmTP1nI7gHptGEujPmDEjN+UQAVEHBUC5RIBIgPnz5xeSACIAMHeMGjVKXXzxxYFJ gCQBEFEAkPJmA9gg8BOC/LsEvEuHsg8IAQigRgQA2LVrV6oAwCN+T9kyTJJ2aikA8oMbP4J7ySRJCvJ79erlbdPRPP KwjGMuCz5J/QxaAHggASRNW0SALQPShIAIgFmzZqn777/fPwlQc4yjoCSAuQsvWR8AAgjXAPjWt74VC4BNmzapxYsX a0QQXHfddVoAXHHFFVr8mlkAEuCbr22D60u+p/1ZATkDc9VOCVAOGVCPBDAFADJHnBUAdUsACgDiCFik45g3dHpHsz dZACLokzIAEQEhLNaZrvupAIDFl7HHI66Feq8vEQAI9JMEQNmuq2aOf1bA7+t1hTF3t9YzbHmIBR7SPs36z6BkQEM7 x+UsBcAOLQIsUwYgMwskiQAvBEARCVA1vmEIAJmj5Ug/EwnMMf5g8uTJcQ+A++67T/31r39Vf/7zn+Pr6bzzzlOjR4 /WEgBAAuD+DgEg11Ba4I/rKonWX2t1BOSf/XDVpxuQAOm/qjwC4Oc//7m699571QsvvJB5PzDT/zG+48aNU8OHD1fX XnutP1kAmfeDtOC/fRKAAoA0nAmA3VqAwE+EgFkr7jvYrTV3bD9f0IchAiQ4x3NIAFwDeN6zZ89Cr/Pyyy/HP2MG// I7yiqV0gL1okFdVsDvq1SaOHFijIxxEvbXQioBKHMWAHZ6sOMjMjiojICG08fLKQJMCZAlAqTeGynf2PVF4JckAU7t 3d0vEVAgWPNlDSDBmoDrQJ4niQAE86eddpoO/r/0pS9VINcTvn7BBRfo7zUFgC0B5PXleupMT4BawXd2wG6+WKIIKH Q9lbMUwBQAuC/cdddd+iSnNDFsCgBkkGD8vRQAqfcECgBCiEdIGQCeH3nkkeqGG24oJADwM3i+dOlSJxtKNrJrH8KO vx34IwPADB4BAhA0fES2kTQDxOP27dtjfBEBUZ3/lVECYOEHGukI7f+izy0JkCUCsIA3SwQklTtNAoALBx3lUUlAbT HgmwRIIkkEiAQQAfDe/C/HAkCemxJABID8bNKuf+czxWoE+ZlfU5VzwmciII8AqH79cmeFYf7H7j8EADIBcH9YsmRJ xf3ADP4x3sggwvijBMBZAVDofhDVlEcUAMQ5sIOLIK7L6V00p59+epApvWZ2QGjZIZINgPEvIgBwlJ8E/WWs969nJ5 cCIB0sFCABJIMobfc/CaSX7t+/32kJ0MwTI8ogAWSxh8Xf3r171auvvqqOPfZYSgCHJYCdDQCksRvegzYI6CSQMwXA 8hmXqDULJ+lHJzIC6r8BqtAaAiaJAAngcT0g0LezAATM4cggkUwAUwDYu/7Tz+lb0msnWwREGddTngwCV44DNO8HmP 9xL7jjjjvU9OnT1Zw5c9SiRYv013BP8FYAFMgiogAgXoKgD2AnGEEd6sRDresNsTmgKQBwDeSVAE8++WSFAHA1uEs7 yq+oAOBckq8MiX+Pciz6ZNcHiAgQCeB9NkDh2nE3JAAW6knZADg5AGe8QwYANHuTem8gIsAM4rAOGDp0qMaN923CLn 8NkoJA+dj39YApAuR6kVIABPp4NIN/kQMQALWC/5/MuVotGnd2yeVRemCXJgGiXH0kIufuBZj3Mf+bEgA89NBD6gc/ +IH+HrlGbAEwadIk/wWAogAgAYgAnO3Z5cQu6sQTTwwvSAk8oEP2BwQQroFa34tr5IknnnB21z+tN0S9AiAk0PhR6N GjR/w8lCDfl0aiWNSh5hOZAFj0YfG3bNky/bnNmzdTAjj63k6TACICkA2ALu9mvbekd4sEwDFweJ0NGzaoe+65x7H3 dLHgP48E8D0jwMwGEAnw2muv6UcRAXhEOdewYcMqSkfkZ3GN4LVefmC6BhKgvFkAyf0CakmANFkQVUgF964BSF9IAM z/IgFuueUWHRPgBAdkBOB+ID0fTAEQTBaA6nz/EAoAQkjLwK4Pgvs8AgA3C9+CvaIlACFfK5CEvtf819sPwCUJgAUf dntMCfCzn/1M/frXv6YEcFgCSDBvSwAE9xAA6PRu1njLrq8pANasWaMGXjldzV/5kncSIA7wzBrvBAEQQnZWUjYA0v wxl2MHGNcFhL8E/1IyILv+Mt+f2a+neufZxTr4BxABbjSVTM4GMBsApmYKeHKfgwSA/BUJgMywqVOnqptvvlmX/l16 6aXqK1/5ijr66KPjYyBFAEyZMsVtAdCgBKAAIIR4E9jV+p4yd/lvhwRgyn91ar9vNf/N7C1SZgGAhk/Y4TElAFI/H3 30UfXKK6/ohaGQ9BrDju8a49x4F04Vd08CSG8AExwFaNd6y64vAj8EgHLkJ4L//X/4yMH3ck4BkLLDG0I/AIAAffKp X9TBOsYb8geIBEDQj7n8ww8/rKj9h0zC91922WX62kCmCAQAQO+IbUtmOSQAamcDpGWJ+HKN4F6AzC/IX8z/P/zhD3 XwD5AJAAmA8T/nnHNiCXD++ef7UQZQtI8IBQAhhBDCmn/XF35o+AQBgLRP7Pxg8QcBgOOesPDDQg+LQ1sCIOhfPXts DCVAOSWALQKSBICZ5i0SQDIBkMoN3HtPFxMAIUsASduXbAAIILM3gGAG/7gWcI3g8corr9SgZwQyCdFEcumNF+jXdu u6Se8NkHRdRCkZYa7eC5D5hblf5n+RALgPYHyvuOKKWALgvgAWLlzovgBoQAJQABBCCCHEyYUfdn2w0yNpn1j8iQBI kgCyqP/v/3hMp/3+fuO/UgKUXALMnTtXzZw5U1133XXqvPPO0xLAPPINAgAp39j1NQXArmV3qTdW3at2L5+vx9srCW CNf8gCALv22L2H7DGzAXCdiAzAaTBm2j9AwI8MAJSMoG8EJABeB8dIQjahjhy1465dN0k9ItKuiXQBEDmVKYB7ATK/ ZP6X4F8EAEoBsOt/0kknxRIAAtkLAVCnBKAAIIQQQoiT9Z8I/LBQlx0fe+cHmBLABAEigkMIgMGDB6vRo0e7tetX4J sTd45LXv5hSoDx48drMEZpWQBI+cb34uv42f98cIbas2KBevuni9SLCyZ6Uw5QKwsgJAGA3Xrs2svpD3i/SzYAwLXw 7rvv6gAQH3+04yfqv15aomZ/85/UwJO+qktF0C8CIgA/j7ICvC4EAK4lVyRAZRBfXQZQ65rIFgCRM/cDCfrN4F8EwE UXXaSGDx+uZQFEAO4Ld999NyVAi8e3JQIAg8tFECGEEBIWssDHYg69ALAeQCaAvfNjSgCkh2KRiN1AYAsBgABTRIAL Kb/1SIC0s8TL2EHelABI44UEMM99l47vaPaGem9pIigSAIE/sjt++dD3HC3tyScB8u74+gZ267Frj+Adu/jYzUcwDy FgNgoEXbt2VTeffbwWQ5B/yBhAnwhpFgkQ/JulAxAALkiAfDv5UbG5xTEJgPkb87w99yP4ryUA8LOul/9FRSRAQsNI 5wQAbuL1/jx+Fo3DAF7LxSPkGrlR25MFG4QRQghxIfA3jwDDgg4LvKSdH4CFHzj11FPV8ccfr49/+v73vx+LAME8E7 y8C8GEnb16VopRlLjGL9tiX8ZjyJAhauTIkVoAoNZfdvwR6Msxb9LsDdcEdn3tlG9nBUCK7Ek7DjDEZoAQADrw/+z0 B+zuY5cfu/3Y9ZfxhwxCVghKQ8z+EABnyu/cuTM+Ng6IACi7BGiGuMsSgy5IAATxyPRCYG8LAMz/mD9sAbBgwYJYAE AwAlfnikL3g5QTI6IyCwA08kCTD9zg5bERAXDEEUfowB8NZlwQAM0M2MtyDBQbbxFCCKkVBNqBv4CFOY56QgCYtvOD ABECoH///urMM8/Uiz9IAPN1gLy+/L6yBYGpi/R6VoopjcLKJALMDAA8xyIezzHWZ5xxhkaOeZNmb1jbSco3PnfNNd fEC3unBUCUbxzTAzl/JYCsIeX0BwT32OXHbj92/f+2b73++u/WPq5LQlD6g49xHCxqwvE6hx12mP4cJABOlli3bp3m qaee0jzwwAMan9aqlaIoqjU9lL6XiC0BRP6aAuALX/hCLAAQ+0EAyPHQACfMgKSTgryRAPbRoYkiqEQCAIMnR7zI7v +AAQP01/r27VvotRDs4+fl50QCmL/LJQFQNHhP2v3vpACAyccRXGnHc9V68+F8d4Bj3pychJv092cWByHE16DfDPzN XTqARTy6PCPQk8Bfgv80AYAFogSO8jppIqD9MiCrjrfBlXlUm+Tf11kBAHCPF2TH3zzjXTq9S8q3VxkAOccthKC/1o YSBAB2+bHbLw0+AUpBUBYiTSFNAYDAUKh3LeqyAIiUH5kjpgSQuR8g+LcFAI6PhQBARpEpAUwRYAoBbzIBEuaLWn6x LQJAbvitFgAI+OXn8Dr4eNSoUfrjc889V/+usgWDrRIASa/XzmBS3nBI5RPw99+3b59+xCQNdu3apT9++eWXNatWrV JPPvmkrv+TN6/Tk3GD/zFwIIS4DhZkdtAvAR5Al+dZs2ZVgCBQJAC6PZu7PrLzYwuAcePGVQWQNp3JCigQ9NezSisY UHYyK0AEAFKwTRFgjhvEjX3MG9K+sfOL4A+7vk73ACgc/HMOwVhjlx+7/Rj/pCAeGUBYU+L52WefrebPnx9z44036l Mn8Hl/M1Sj1OMAXV9XQgKg5wvmfBMz+Me9whQAkAQSR5ilAC4F/zEqvVloljCMKuYdUxK1QQD069cvvtEmBf+nnHKK /hj2FwJABgWBfJEUfvwcUntsASAlBWPHjtW/D41EzJ/D59sVANYK/hsN2OsRAK2eDMzJGWMDevToET8XevbsqY488s iK3QDfJmgG/4SwHClUASBMmzZNAzk/YsSIiqA9CUgALPBkt8fEXPwBqfm0G36ZIIvg1ltv1QGmKQLKtOtbSAI08Lp5 uom3UgBIHbYE/GbwL+Mi71/UfiedAuDkSQAM/uuay7HLj3G35Q+e48i4Z599VkuAtWvXflo+8PfA/8EHH9SPkIoQAF OmTFGXX355hQjw4R5hvpejnGtO1wQAQM8XSF/BDP6BNAH8+te/rgWBKQGcDf6zdv9rZgxVlwOodgsAPMrnEPQjGDff dHg0BQCCRPmevJPD+vXrYwEgrycp5PI7k0oB7H9fqwVAnmC8WQIgT0lAo5MBF9mEkHYjDV+z0jpRhoRyJB/npjzzdh kXeiICsKsPJJiXj00ksIcEQKMnQdJ6zcUfzpNHcP/tb39bZwrgURaFJigTwO83SwHaWw7QRAkQNYd21gHbAkCCflME SPB/2WWX6fPf8f5FAzjUgCMNHDvBkvKNwM+1c92LpP3n8T8Uup9/DdcDsnzMLADsCosAuOmmmyoEAGIGee5LCUARAe CCDEDWj5z2goavyPgSzOAfPPLII3p+lwyBs846KxYAGzdudHecVZQreyxLAERNXHvUFfyDQYMG6XoO2+Bhx97MAECK eBEBgAAf4iBJKMjkYGYd1Pp3tmr3v50CIM+CsFEjWKTm3wRZGgCSZvXq1Wrp0qXqtttu04RQ8//JJ59ouPtPSH7MLu +4ZyDzC/IXczswy458FJO+ZBGJCMCCzmTSpEmJEgDBvo29+EsK9m3wO8txTUQdpPNNACX4TyvRMNcKyNxEF3jUgZud 3rHbi11ft97nzRQyUVACIK8gOPTQQ6sEAB4R+OPaQzBpCwCfJICqQwCU9X6B4H/17LGxAMB7Xu4JAuQv5vt58+bFWW aII7D7DwFgZgE888wzbq4LcgiAyCo3a5UEaEgAIG3D3t2XFH5TABTNAMD3mxkAplCQz0E8QEDk/beGIACaJQGSav6l 1n/37t2arVu3qm3btumA38SX1P+oCf/xRk5I9s4/Tnuxy4iktMj3jCTf5g+zPMCUAkjVhQxYuHChWrRoUdWizw7+sf ibMGFCBUmvjUBg5syZJbo+suv08/YNyPsznb5OsgSAHfzjGDhIGzxKN3hp9CY9hBAQuJUFUCz4T1xDpqR8k2oQ2M+Z M0dfJxAAIgZwRKAE//g8ypF8zhSrCvpTvlZWAfDOs4srJADmBZSPSZNY3ANkzpf54+mnn9Yg+McmAT6Hucfd/mLZEi BKqPWvTiKL2tMDIC2oHjx4cNXuvqTwmzv2soOTNwA1v99+PVMSQECUXQDUU5+f5+dbJQCSUrQkmE/CDPhd7fRfdDxq TcqEkPyp/6GWK4UwZyQF7qjtBDjnGXIfu3oAn5O0TxuUFuCePnr0aN0IGNJAaoO/+93vlvg6yBfg19dYsLPXUJoAkO BfSjLO7NdTg4X+mjVr4vPgMWYoCQF4jnpv/Cx2fV0XAEmNGZPHyhjLwMoA6pUA3/nOd3TQb/akwiOCf8k2wikTXkvj hPVp2deiIgB+v/FfYwGA97v0eYEAkHIvEQCI8ezNAIDP42fwuGnTJif7h+QTAGmZXs0p+2pIAOCPfvDgwcTgvJkCIC nLwP69nRAAWcF5OwRA0X8rIYSUBTR2RQAICSBlRHnLjnzpCVDvXO3yHJ8U4NvNBWWRd9VVV6nevXvrY+VwT5cTBCAB 8D0I/lEfiu9xRwhF2Tv7OReJZbjfI8A3BYAd/L/8wHS94wcBMHToULVhwwadBWCPld3IzeU+AGmnMhRdR5Js+Wt/Dr vJCByxi3zYYYeF93cpuQDAGNllAKYAAJjbTQGA+f/222/X4H6AEwHM7/ddAOQRw205BhA3Xzuo7tOnj07rGz9+vOrV q1c8yGZWQDMEgPl6+D34ffi9+P15/p2tWqilveFaKQBqvcmb/eaXybZ3716JX8OuP3oxeJ8F8HGUa9LljZyQYhkAkA CC2RNA+gFg/vexJ0DI5UXSCRopnFjUAen2jJpP2dnDwk8EgC0BJAsATJ06NU4JduK6+OxJdqfnPM2iqncByyIAfjLn ai0A8Lh8xiW6/h8SAGCMsIuLQA1NIOWIN6nh9kMAZG/OxIt8riEaBg1FIQAmT56sd5K7desWdPBf1mtIJIApAKRhKA J6OwMAc7+ALDEE/JC/uF/I6QEoR3ZP+BTNAIhqCOOotQIgDbzRzB16BIBJO/bSWK7WxWF/n2QASGApH5flDV7PyQBF 082bcbRgI29Y/L0hXZJ24tDvAW9iafoXWpdu3rgJaRwcJYeMgLRyI/vzPi/kipYhubqLJ+c5QwKguZN0e8Zz1Hviay IALrzwQg2eI7jEItAsBTDTgV2RAJXNnKKMRk+RytsIsN33IVMAmME/GvwtGne2Dv7BtiWz1JqFk7QImHzqF9Wpvbur nTt36nESASDHvIkIcFEAFFmMm2NMCdD4fILMEgiAMWPGqC5dujADoMRjBQGAucIUAJhHzNNd8H0ifmXuf/HFF+PAf/ ny5eqll15ShxxySNw03hcB8Pkcki4BqjMDOiAA7JScpB1/6S6fRwDY35eUEVD2m3srBEAn/38gW3Czfuutt7Sg2bt3 rz7SB2Lg/G+O8KLpX707dX/60594wyaEkDoFgCkB0OkZiADAQg87P1j84bmZDWBKABEBLgqApEC/WBZA53oCmALATP 1HgA8gApAFAJbe+PeF/KCj9Oex24eFP9YVZgaA9INAszc3JEDt1P+sn8vKAuCaohi4jmbPnq0DwiDnVIeuG8zPmCdE AqQJAGR8iQDA/D927Fh9ypgcH+t2zFG7xKtIiVHHBEBWCn9W3U7e2p4iJQRl3sUpy+vVQ9++ffQYoPEj3og4gcE+ht HryfVvbjRaIcQ1Ro4cqQM53Nwxp9hzPcq+Qtj5D60+GOO5ZMmSCgkgIkC6O0uqJ3Z+cH3gvGgzLdTkgQcecKsMIEEC VHeDj3JLgKgD14sIAHP33/y6iAABu7NABMBrr72mx+rGG2/U57sDiACkc6PZW/nHsejuf/qYUQA0LgAOP/zwcKWqQ9 dMXgGAUi9IAJnjMf8/+uijnqwFGhEATYwt2yEAyvJ6FACEEFIukE0k2On/KD8qcpSsjwLAx3uAKQDsbADzqCfIIUgA 7Pxg8SfccccdMQ8//HD8824KgChBBFQHmNmnB3RmvSASIEkA2OON75MGXhAAcmT0ddddF4Nu7kA6vbuSBdB0AcD7Av E8C0wkQJIAwLwv/V7wfcgEgATwRwAUzfByQAAUqflv1+u4LAEY/BNCQgBNwpANgGB/8+bN+hGnvaDha0hNnULaDbSz ADZu3Fh11JNkAUjKZxbSRM6pDYOU57Xq/cuyC4jFuVkCkDXWCPqx0BdEAGDMpkyZom666SY95m5l/DRfAPB+QEIgSw CgrEskAB4pABwSAM04oqlZr0MBQAghboAyAJQYIejD3J902ktItZw+3wNMASCPzzzzTNVRT2j4BAGQ9ToIIrFzPGLE CCcFQO2mgFFpa4BlIZ8lAJIkwFNPPRUH+7LzjwZhrkmcYg0AkxfzlAAkVAmAMgAc3yjBP8qAZF4QEQAgAJDx5Vc2YL UEqHz/OyYA8tb8t+M1SOtAbY6vx/75VnNFCCFlFQAS/MvnUAYg3Z4Buj3XWgugAaDg1t9AVS3qooxA0WUBYEsAUwBI 9gZA+r9b41j0OK4aAoCbPySwLIBbb701rv2fOXOmlgDf/e53KyRAGAIgaS53TAAQ/4J9m1WrVql58+YFnZbLmzQhhD SeAWCL/02bNmlwzrPPnb2jGmKgkXOe27mIzxP82xJAGjea4y6nOchznPHuTjPAehb+2ZmfXGOQUMoAZA7B+x3BP46F NTMBQhEAyRuMFACkgwIAb1L0ZNiyZYtasWJFLAIoAHh9ENIo6PIedDAc4FySleUnXzvssMMcPOe508GlG2NvCwDJ4J ByDpwGAHDGuxz95bP8iXL8x3sF8VUCmBIR8wEC/qlTp1YIALPhq58SIC3LmAKAlCgLINSUf96ICWkNWASEOLewrIiE mgFiCgApAUDwf/HFF6sJEyaoyZMna3DGu+/HvFEAEAqA6vlBEGEoc4Vr5V6NlhBFTV4rUAAQQggpVaZRqLKRi34Sug zAwh6NHCEA0BgMR0SOGTPG6zIQZhsSSoATEgWABPpmWZBIQn8EQHpJUNL7v1lzAgUAIYSQ0kkAIbSMAC78CUVApLp2 7arLP3AEaJcuXZhxyGuDBDofmA1CBUhCvwRA+6UgBQAhhJDSlhuFXArAhT8hhBBKwWr4t2EPAEIIIYQQQgghhFAAEE IIIYQQQgghhAKAEEIIIYQQQgihACCEEEIIIYQQQggFACGEEEIIIYQQQigACCGEEEIIIYQQQgFACCGEEEIIIYQQCgBC CCGEEEIIIYRQABBCCCGEEEIIIYQCgBBCCCGEEEIIIRQAhBBCCCGEEEIIBQAhhBBCCCH1csb1d2v4tyCEEAoAQgghhB DiuQCYvGwXJQAhhFAAEEIIIYQQXwL9tM8/tOOjxK8zO4AQQigACCGEEEKIY8F/WpCfFejX+jlCCCEUAIQQQgghxJEM gLzy4MQRV2v4tySEEAoAQgghhBDicfYA+gQASgBCCKEAIIQQQgghngqA/R8qZgEQQggFACGEEEIICUECSAYATwwghB AKAEIIIYQQ4nkZgJQCUAAQQggFACGEEEII8XT3H8G/lAJQABBCCAUAIYQQQggJQAAwC4AQQigACCGEEEIIBQAhhBAK AEIIIYQQ4rIAYPBPCCEUAIQQQgghxDHO7Nczd/AvTQB5CgAhhFAAEEIIIYQQTyRAFEUa8+g/Sf+X4P//vWVS0H+3Bx 54gNcPIYQCgBDiPsccc4wm2L/B5zMuIYQEIQAECf5venCF+s3v/1JV+8/6f0IIoQAghHgoALZs2RKuBKicdUkNjjvu OE24f4PoM3gtEHf53drHNZAApgDo+c9n6WBfgn8KAEIIoQAghHgoAD744AP13HPPhSkBqmdeksIJJ5ygDhw4ELAAiH Ts75sAQGDH4C4spp/TV1155ZVqzZo1WgKYAsDMAvC5/j/67D9eD4QQCgBCEhb9gDt+FAAUAG7TvXt3TbACoOEx9lcA INijBAgLEQDzV76kx77fmJlaBEgWgIghX68LCoAW/E2ZHUVI+QSALP4aWQAy1TfcXb9wJYCfi/4kCfDYY49RAng8P2 Duf/PNN+u+D8hcMG3aNDclQMPjbM4FUSkCd5tGXqvI54n79O37aRaAKYBMCeD72FMANJfJp35RIw0l+TchpEQCAIs/ WQBykc+LLO+if+XKlQFLgMh7CSACAOMcpARInoG9FQC33367evzxxwvdByT4xzXijQAoNM528F8OAZCUqt0MGSCw9j scCSA9ASAB8PH+P3xECUBqzhXLZ1wS8+ikEbq8REQA/0aElKQEAAs+LP7MXaCgZED6X5tQAAQvAFAGEKQECGheEAkw f/78QhJABMCdd96pRo0apS6++OLAJECSACiHBDAFgCkE6g3ezMCfwb//yIkACNyANAbE2DOII3lKhzYtuln954Mz1M CBA9XQoUM1IV47kfEfrxFSOgGARR8Wf5INEFRGQPZfnGQIgNdff50CIJBeAJQAcUEjJUCCABgxYoS7AqBuCVBOAWDu 2EvwL9QjAeysAt/rwMnnEkBStxn0kzxgxx/zwpur79PXzznnnKMD/w0bNqh77rknuOsosv7jNUJKJQBsCfDzn/9c00 hdqFcSgG/axIU/Fv3hZgFEwWYBBDXWAQoAzP333nuveuGFFzLnfjP9H3PBuHHj1PDhw9W1117rTxZA5tyfFvyX6xox RYBNvRLA907w5FOGDRumJkyYkCh8whh3f+f7VmaNiDjC49NPPx03lhx45XTdXFIkAHpKcPe/s/cFXrcUABUSAIs/PG IBuHfvXvXqq6+qY489lhKAF2C88L/ooosCFgBRUAIAWR7BSoDUuSDyWgBg/r/rrrvU1q1bUyWwKQBmz56trr/+ej8F QOr874YASArgcY57UQEgr4GfZS+AsCSApHVL/X9YJ0T4Ndc3e8wuu+wyLYnQA+ZXv/pVfEIUQKCPXX8IADwi+Mc1hM 8j+JfGkj6tB+17QJkFAE95oQCoWgQi8MfiD4gIEAngfTZAvlFwPqgzaUQAOCkBGh7PKBgJYAuA4CRA5jzgrwSQe4DI 4CVLllTM/Wbwf//996tZs2ZpAYASAGcFQCEJUCv4L68AaIYESFtEcjHpJ5IFkNRcMhzp71d9flMCks96QgAIAPDjH/ 9Y3wtMCSAg2JeeEvI5PySAOyK4lTKIOC4AZBGInR8s/u644w69AFy2bJn+3ObNmykBHJcACOq2bNmigzpQVAZgUh8z Zoze9fNCABQe13AEQFoWAJCbPCWAfxIAmV+Y9zH/T58+Xc2ZM0ctWrRIfw0i2FsBkHv+d1cAmMF/M9JA5fW4o+Rvxt /+/fv1Tq+d+RFKBkDkmQRoRjDYv3//imtBMgEA7gVXX311LAAQ5AsI9t9Yda/avXy++u//eCwWA+5LIfcEAIUABUBm OQAWf6YE+NnPfqZ+/etfUwJ4IAFkR1dEgC0D0oSACAAs+rH4904C1BzjiFkAIUmAHMGgbwIAGV/IAjAlAHjooYfUD3 7wA/09cg3YAmDSpElaABx//PH+zv3KPQFg7gA20hAwTQI08/VI+coAAII8UyKFVQbgbz+Aesp5ZPdfrgGRRLgfiADA OhHf95vf/yUGx0nic2//dJF6ccFEhwVA9TLAVQHAki4KgKpFINI+sfNjSgAsAB999FH1yiuv6J0gIUgB8NkiMHK8FA Dp3FjImzIAAR9IEgG1BIAzXV6LvfOCFQCmBHjvvfeqSgHCyAQISwJgTocEgPQVCXDLLbeoG264Qc2YMUPfF3CPwPvf FgBmFsDo0aPVGWecofFx/q81F5St/tMuA+BijxSRAHYpQFjXj58CoN7A7wtf+EKcBYBHrPsgAYDcF3BPkOASQb7U/Y sE+OVD33P4VADzeogqbgcuCgCzvIfzXeACQCQA0j4hALD4Q03oD3/4Qy0AkP49ceJEdf755+uyAEoAt4M7UwJkiQAE ejjuCwv6b33rW2ry5MmZEsCJ44MaWOiHlgXw9ttv6/IRuU5EAPgvAfJeI35JAJR9iQTA/D916lR1880367n/0ksvVV /5ylfU0UcfHV8DIgCmTJmiBQDuG0Ouna32/c//VT2OHxiMBDAFQFkXe1xQkSLI7q4pAcIUAJEXQb/5HI35ipR1mOUg Y8eO1WB9gHsB1nvIHtu5c2fV6SMiAkwJ4H5PiOq1n2sxgX1kLOc7CoBYAmDXHzs/svhD8C8CgBLAPwmQJQIQ5JklAv gYC/8kCTDs+K5q4MCB+nVKLwKK5XnlWvzLG9aHs1+loc+ePXvU+++/XyEAbAmQB2cXf00SRa6UAmBeR9kX7gGQv5j/ Ae4HmPsvuOACfc6zSADcC8wygGuuuUYLgOPOGKW++PeFn1NlAUXzPx0RAITUmwEggZ+5WxhWI0A/gn85zSEpCyBtTE 05gHn9xBFXx98rAsA8LjKt6SgwJYD7AsDsE+F2Bgj7uFAAVO0CoeYTaZ+y+BOwAMTxHsCUAF6VBhT45ijp+x2UAHY2 AEDqN3Z/EQDanHbaaXrxbwuAj/9rjxYAy5cvj3cBvZAAORf/rgqApIAdWR+4PjDeuBYkC0Cul7lz51ZIAHmeRrlFQU rQ3mBaeH10XgKg5wuyviTzy57/r7jiilgC4D4AFi5cWFUCgAwANH9yatenznmgrCUAhDSzj4Q0f+Tfxd0MgKQU8DQB IMEhRBAEgHkN2Lv98jryPWbPCPe7/0deXg/sA0ABUBUIYBGImk8s+LDzI4s/UwCIBMAiEYE/jpICthBwSwoU39YXCR A52hREdvWTsgEQ9GH3FwEg2LRpk7rvvvvUX//6V42IAFMCQAD86Ec/Ut+Zt0Td/MiPdSBZ7gCgvjG3x9oOACrewCUO 9OWIR4A+DwICOFMAQAbt2LEjFgAzZ85U48eP1+M/ZMiQONCHOCwCJBKunfY0lCwYjLdJAFReT+XIBEDPF8n8sud/lA Jg1/+kk06KJQBKxyAA8P4HRx11lOp31CHq5rOPV9sf/z/eSwAKAOK7AAjnFAD/x9MM2pN2gHXWgBXASwaASAOzuaiJ BP/mySPOlIcGfC3wvR2oAJBAQBbiCOiwCMRCTxZ+dvAvQcOpp56q0zzRBOr73/9+LAIEWdiXOw24ciEe1bM7nPAa1Y FiuXeBkySAiAAEgIsXL9aB/5e+9CUNSgVMCYAAEa+Ds2GvuuoqDQSAG7uAxYL/PBKgbIGAeZSbgABcQLCH5m4A/R5E AED8YOyBCILrrrtOCwDsBo8cObIiC8AM7tMQadTe+SFPJ/c6C/oaDvzL9f6AuDXnfnP+x30Bc//w4cP1fQIiABLg7r vv1hIA73WUAwGRAM4t/BqQAFy4EN93kIn742li7upXdPo3Mj5EANhp/uZuv/k1nhLi1rUgY8a/SQACwNwBNAN/86gn NHxCzacZ+GPxJwtA1IhBAKAj6JlnnqkXgZAA5ut0ZqFfbDcwdfe+SQGAKyJAgrgkCYDgHgHgn//8Zx38/8+cLvoRHW AhAUwBILuA4Gtf+5oOAHY+eYcXEiCWQ0bmhysCwJQAADV8tgiQbr5o9ig9ACTrA2MvPSLOO+88ne4NCQAgAU4++eSK /hDlCfyrJUB2xk71HFD16QYkgAvzAQQA5nNb/Jrzf5oAwM/ivY7gX3Duxlu0T4g5riV4z3OnjRBST5mHGbTbwTskgC kC7CNGzb4CDP4d7BXxIf8O3gqApKDfDPxl8S8gvRO1ntjlk4WfLP7SBAAWibITKK+TJgI6sfhP3O1vUxqwC0eGiASQ VG8T7Pwi+JMMAIDg/7XXXtOiCGP8xhtvxKcCyE6g7AC6sSgt3vchSQK4UvNvzwGmCMB1gPE1sz7M7A/JAMHY43tNAW BLAHMO6LwIzCH/opTAzi4DqWMOcCEjCEE8erzInG7v/kP42AJgwYIFFQLA6RtvEQlQQgFACCGNZAXk/V4z2Af/7y2T gi4XeeCBB0o5psz0CVgAYGFmB/1p6b8CFvMiAVDzKYE/Fn+yALQFwLhx42IBUMb039w7f0UlQB2pv2UNBsx07loCQC TA9u3bYwkgmQAS9LsXDBQTAC5KgKzyH5kbRAKIAJCsD/O5KQFEAMjPlmfXP3/5T7a4U+bMXH09eJAFlCUBZP43BQDO hhYBgDkC9xkcI2i+912VAbklgJ0BVLr/j8jh5luEEBfEAf8W5czqyJuJYX4//34eCgABNdpg1KhRukbbDNqTgATAIg 8LPhtzAQiQLQCymoJhF+nWW28tdwOwIhLAowZgSRIAHd/R9A1130j9RtBnBoMIAHFyBDJCbAGA88TdDARqSICEHeG0 UwFcFQESwGN8k8SPgDIQNA2UTABTAJRn178xEZAVCObJIHD1SClTAkjWF0ia//Fex/0F14tIAMhj4LUESBjnqOq+Uw 4JIPPw5FO/qOEiixBC/Av+sxo8pkkbypwAegCICMCuPpDFnHxsIoE9JADSPQUs/MzFHxZ5CA4R3H/729/Wi0U8ygLQ BLtJ+P2dOwKsiRKgScd/RSUNCkUCSK036r7TsgAQCOJ78XX8rAT/uD569+6tj5LxQQLUygKwdwIjFTkTAJoiQLIBpB RA+j3Y447xhgCoFfy7IYKSgvZsCZAlAFwO/k0JgNNekO1lYs//pgCAJBAJgK9/4xvfcDcjIOM9nz7W5ZQANstnXBID IcDeAYQQ4qcAKJoVQDwUALYIQAd/k0mTJiVKACz2bGTxl4ZZPyro46KunF6CBWHUQdy4AE0JgMwOSABzRxjPwRNPPK E+/PDDuImgSAA8x/hCACD7QySA6z0BUmvCU9OB3Rl7jIudDSASAP0eZMzN8g8EfGYDQPlZea2P392m/vPBGWr6OX3V Pffc40RDyNSTHnIIgEpnGFVP6o4JAIDTXlDuJdjzvzQB/PrXv64FgSkBcJ3ge+We4sWxgFG2AEh//0cdfW/3G3Z1vB D0oVSDEEJIdfBvnuJgCgDu9FMAJJYHmFJgypQpWgYsXLhQn/MsIsDEDPbnzZunJkyYUEHSa/cedrna/4dPFx87/mVO CRYe2XX6efsG5P8Z5ZQAADjrHXW/EABI9ZYdYQT6EgBKCjgCxnfffVf/3OWXXx5LAAiAX/3qV2rp0qX687h+nDgZIC UDJGucs9OBy38tSOBuZwNgjDHeKPkQ8SPBv5QMyK6/ucuI4B+nQgwdOlTjjPxJ2dmNzJ3h1LGvnsxdPCMewT+OdMU9 Ab1eBHv+f+SRR/T8LhkCZ511ViwAIACldwwQCeDEdaCi3PN/fgEQdex9bTf7YuBPCCF+CYCsEoBm/J5+/foF/reO/B AANtjpSQrcscMD0O0ZDZ+Q8gnwOVn82cjiQhZ7CAKOPW2kzgAAEADlkAD1SYGiwb5ri38zAwDPsXjHcwSCSPsGEgBK EIhgAaUgIgBeffVVfU2hO6r0gcD3oqkgSkXKHQhklIHkbPhmlwa4IgFwgsPH/7VHjyP6OgCRABhzCCBkfZi1/zgy0g z+5b2PnX8E/hs2bHAkAyBfNkBy2neUOpm7LABwxKstgFH2JfJX+svcdttt+vqAADCzACABgPSJEUq/A12gz0P6NaFK kw3GXX9CCPFbAtjHOjZ71x/rQ/6tPRQAALXet9xyi7rmmmv0cwTuSQG+3VwQC4pzzz1Xg8WevdCQ56tnj9WIAMDzMi 1GIpV0nnvtbuGupXsXEQBy1JsggZ+5+ysBIOjatasWAAABBMb3d7/7XSwAcG0hAEAgATlQzsVoPb0c0q+N2tdOeTIA 8J4XZExxzKPZG8Acfxl77O5+7Wtfq2gA+fTTT+vynzVr1mjxN3/lS6UPPuz3frbEScgUMAJ9V4P/JAmAcUTjWDkeFg JAsr3M8QYI/tevX68/d9VVV6k5c+bo+wJKCOR7lyxZoil7b4h8Y5/sBlWiKLY/TwghhDSvDECyAezjGpN+Rshzasz8 sWczC6DFa5aOCQDs7A65drYGzxEEYIEm9aBY2EktsNR8YucH34NHCAA879GjRywEskRA2XYjkhbvZj1ovnRP92WACA AJ2m3Mpm/27u/q1at1B3EEDv/7v/8bf/6Pf/yj7gUAAYBHNIvEaRQvvPCCE5kgjQQBrkgAjAPGc/ny5epHP/qRlnsi AiQbAOUfIgMwxjL2EAD/8A//oN5///14zLHrj8ARjwj+pQTIFQGQJAHTj370VwCY4gcCQBq9igDAPC/3ARMJ+gHE0N atW9XGjRvjwN+VnhD5xV/6PFLPKbOEEEJIvaUA8piWFWD2B8jTmN1vAZA3ZvNYAOz7n/+rjjtjlH5+1FFH6ZQPc1EH CYAUT6n5xHPs+piLvrPP/vQiEQkgdd+2CChl6kWSAKgRyEW5gkc3BQBAsG+e8W42fZPdX4CAwQ4CZNcP3cMRPEogic Bfgn9XBUBycJA2WUSFT5rslASAAPzOvCV691YkoHlyB8YR/R6k5EMk4ZYtW3Tmh8wDZgkQmsehJAC4koJcOQckB3MV 41v1/dlziYsCAKCExxYAInu/+c1vxmn///iP/6gGDRqkERHwi1/8Qn/fV7/6VS8FQL6yAeWsFCKEEFJ+CYBmgNIUMC srAF/76sU3ql4jx6stj8xkBkCoAgD0OH6g+uI/n6Uf+x11iBYAeDQDd5EAqPcEIgBk8YfP4YhBXCj4nEgANxrA5QmS VKFUb9dEgC0AJOg3RYDZ9A2p39j9NQNASe83O4i7U4dadOc/qgoAXS0NwbhAAt78yI8rBICAnVxTBqDkA1kf+JoZ/C M4lAwSfG72N/9J7Vp2l3pj1b1q9/L5TswDSYF7lgBMkgWuHwUoAkDe9xhPOwNAZI8E/rhu8H7v27dvnDEG8DmUA4gA KP/9oOhxj3lLRtyVQoQQQtzIAkDwn5QFIB/L9/YY8HUd/D88c4Iu/04L/nU86LkAqH1f9lgAADRvw0L95rOP18G/KQ Cw8BMJICLAbPiExR8eUSsuEgALRlxUSdkArtofcwcwyrlgdOlceBEAsutvIme9m0EhUr/NABBp/tjpFwmwZ88e/Th2 7Fi1ePHiiqCye/fuJbse8gqAtFTvKPO6iApPOO2XACjPAJA7kgUk9f0Yf+nzAFDyYWYAITBE+YDZ/BFfw6kAe1YsUG //dJF6ccHEUs8BSen7lXLH3wwgUwDIaRAiADCectSrWf+Psi9kfkH+yn3g9ttv1+95WwI888wz+memTp3qtACoHNdI 1WoWySwAQggh7ZAAEtybjwBSQBBRYAqApHtyKMF/p3f/SyEAJAjY/vj/iSWAKQDMIN5s+CQ1n6YEALhokDYK3M8GiF R6M6eogASInBQAdvBvZoaYASCABEDX+CQJgLPl8Xk0GBNQJgDKLgCiAj9bSwIk15yX4/0vEhDI+Mr7FtcBTnowmz0i 6wNjLgIAxz+aAgCvIzLhlw99z8mOsqYEsAVg5JkAkLlAJECSAJBrBfM65nlIX8z5kg1gSwA8F2HsRilAlHNc85cJRS WWf4QQQvwSAbLrL+UA0vRPPo/nWI+lCQDc28MO/tu3jotKs9hN2KnHx9/4xjf0Ys6s85WaT6R9YtFnCoAkCeB2NkD2 AjC/AIicEgAS/Ev6N856Twr+EfwJtgQQAfD666/rz+H7J0+erMERgYcffnipBUCUORnUEgaRMwJA3us7n7yjQvRIYI fnyBSymz0i6wNjLuP/4x//WF9LV199dfw9Zl8Rt28EUe5mjy43BM0SADKOMqebEkBEADJHzFIgNJkUmXTJJZfoe0aZ jwRtRAAknhSRkWVCCCGEtKIkQDIB5GsI/AEkwD9dcI1em4EuXbpUvIZIglD+Zp28J0el/+N8tnjD+fBmzSeaPckuj0 iACy+8UIPnWEzKwtCUAG5mA+TZ5YmcFQEYK1MA2MH/x+9u0yndaOqGHhByzrukfWP3FwGgnQmAxnHY7TezANBZHMH/ IYccUuoygLTgP61ZXD0SoIzvdVMAYCxljKXPgyl38BxjLZkAQAQAxhjga5gD3BYAaan/yvkMoDQJkCYAzCwA9HyBBJ B5Xub+f/u3f9Nfl/vDpk2b9M9I8I/yATx3TwKohiUAewIQQghpRyZA0tdFBBx5WJdPM3MvGZr4df4tKQDiY79EAKCx kykAZJGHnR8pC8CxgbJ7mER5z4SvTwAUlQCRQwJA6rnRIG7o0KE6GAD4vNk8ELu/tgDANQMJAAEAXnnlFf152ziWWw Ak794XFQAu1gOLBJD0/t/97neZEgAkCQD0BREJ4L7881sCZAkAs0kkRC6CfIytSAAIAFwTL774YkUWgCkAEPyjlMRF AVD5vm0sC4ACgBBCCKEAcEIAYPfWTPO0Gz5h5weLv0cffbSCO+64I+bhhx92MBCIckuAPJQ5A8AM/mX8sfOP4H/Dhg 1qzZo1OgNAggHzyDABQZ8c+4frBkAAPPvssyUd9+zgPzt9v3gWgFMT1N//0UuXLo1Fzx//+Efdu8Hs8yASwBQBCP4h f5D2jaaggk8ZQOZ1EnkkAvDexzyA8ZPgv/ewy9Wxp42syALAWGJMUeoFCYB7A+Qv5nxcM0j/f+mll9TWrVvVYYcdpo N/gIaT5RUAaRIgf/lQ8pwfUQAQQgghxA0BYEoACAAs+LGgk90dUwBgRwiPWPwhSLCPgnP/RIB8u/1JAWTZF/wiAMzU fxl7BPwQADrwv3K6mr/yJX3WO457kzHFrq+AAHDnzp368//+7/+uewDs2rWrIgvAjbFNT9uvXsCn7PbbQYCDAgA7tq bc+eCDD6qaPcp1APGDsceOMAJDPMopA8LcuXM9EIAqOVMkhwiIHJgPMA/ceuutn+78//09v/8PH+nH1bPHVmUBSL8X /BwkAASANPnE96HcBycHuHMPqNX/I08fkMr+ESpiwE8IIYQQhwSABAIQAHjcuHGj+sUvfhGXA5gyQBo/YfGH3R50fp YjoBBI4HO+HAtYqxzADhzLuvMjAsDe/bdrwwGCfwQDyArAWe8oD5DO8ZL2DRD4IRA0A4G1a9fqxnHlaP5XSwA0O1PE vmbced8j0MOYXnPNNRo58hFCR9772C1GpodcJxh79H1Yt26d5qmnntKYvQR8EABpu/suZQBllQFIGRAwBYB5bYgEkE aAEABS6y/3ALcyP/IKAKVqHf3HHX9CCCGEeCEAlixZEi8Kcc4zjnpC0C/BANI+ZQEoAkACf6kDdbcpmKrqBG7LgKwF YBkXgyIAkoL/pOtAygJwdBzOepdO7xL8IxhEQCCN/5JEQhkDvMaDc7d2eou89zGeeP8jA0AEwOLFi+P+Dmj2KBIAWR 9ZGUC+NASs3Q/E3TEXCSACYMe/zIlJkwC2AMDcL/O/SGCXxjv/OFIAEEIIIcRDASCLPQn+ZXFnLurR7AmgRABpn+bu vx8CQFUt7lSGDLAD/zILADP9P++1sHv5fPX2TxfFx71J/TfqvhEMYOfXjXGmAMibCYCmb9LfAUDyoMRDRAAEAD6GAD B/Vpq/oQTA9TKgJAFYpIeEiwLAlABpAgBAAKDXCz5vBv5yz3AzC6AxAZBeNkQIIYQQCgCHBIAs/GSBJymeAA2fUPOZ 9HVfBIC9wEvqEO2SACgS/JvXw4sLJqpfPvQ9/RxBPwJENAZDoCcCwKR79+6lzABozq5tbQHgahCAMUP6PsYVAsDO6I AIEAmAfg925geCf/QRAV27dnX4vZ8yrimCQDm8G2z2ApFxNIN/Ww7ZAsAsA8DXIQblKEC3JEB9GSJJ404JQAghhBDn BEBSSjd2dmRxZwb4tb7u0yBmLfLKvgisVwDINSAlACIBRACg5tvc/UWauCC9AfwSACpXKrCrwYA0+TN3fzGWOP4Rz9 HgESc9QAKg30PS96FMAILQ3UyI5Pe+nQ0QeSAA8twDbAlgCgC85837gAT/mA/KfQpAczJEku4DZe4FQwghhBAKgEKL QnNxZwf4tb7uzUBmLO7KngFQT/Cfdi3YAkB2fxEATp48WYNeAeVpBhg1uWbbTwFgB4DI5kBgj/GU/iAiAqRPQNL3de vWzUvxV10WEM4usCkA5KhXCfRNRAaGIgB8eu8TQgghhAKgagGYVefrTx1wvoCgnq/7FAhgjKXjO55DAGD3FwEggn/0 iPD3jZ0vEPBhrCWwx5h26dIl/jzkjp0BYH+fzxIgqweAr+9/KRMxx12ErwnmAz8FgKqZ+UEBQAghhJDIp/8Zc6ennq 9TAPgTCMhZ7wLqvpH6jd1fnwLAegMBX/4/UcaRR+jk/T7f3vMhvvfTTv5w+xQIQgghhBAKAEIK1woTv0Bgn6eUI+/3 uSoAmvV9hBBCCCGEAoAQQgghhBBCCCEUAIQQQgghhBBCCKEAIIQQQgghhBBCCAUAIYQQQgghJOCAhL2bCKEAIIQQQg ghhIQhAPbv3x+0BGCzXkIBQAghhBBCCAlCAOzZs4cCgNcCoQAghBBCCCGEhCABtm/fTgnAa4FQABBCCCGEEEJ8rvmn AKAAIBQAhBBCCCGkJPTr108TasO26LP/GLw3Pv5JNf+2APD9Oku6lnh9EQoAQgghhBBSiuD/wIEDMRs3bgxKBEQJ/4 V4HXTr1k298cYbTREAds0/nuO1Tz755IqP8Tt9lEBpAsD8fGjXmkhGIVTJ2OpxpwAghBBCCCGFFuYAEuC2225TJ5xw QpACIDQZ0LdvH7Vw4UI1fvx41bt3r6bX/OPx9ddfjz/G78Dv2rlzp/7dHb8G/maM+MetkQAVwf/Hxu/7WxTE/GJKRh CKBGj33EIBQAghhBBC6lq0I/iHBAg1jTYkAYDA/ODBg4m79q0QAPK5t956qzSZJs1O288SAKGUBWAOMQP+0LIAOiEX KQAIIYQQQkjqri+Cr8GDB8cp/yHV/8vOa6gp/2YQhmsgKUBfv3590wTA7t27q14fpQL43Vn/tnak/KcFZO0QAEU+7x oI/CEBQkz575RIpAAghBBCCCGJ9d5I+cauLwI/7PRu3rxZPx5zzDFh78x9EgUR/Jtp2LLbbwfo77zzTl1SSF6vb9++ mQJg7969qn///jX/fe0IzFohAPK8ftbn2TiQUAAQQgghhJCG070RnKEG29z5F/C1yy+9RA0cOFDjswBI+9qf/vQnrw OwJAEAAWQH6L/97W/rFgD79u2rEABbt26tev0dO3aoQYMGJf77kB1AAUABQCgACCGEEEJIgwIAJDV7w+dPOeUUtXbt Wl3/P2TIkLhzu3d/h4+j3NkBPl4DaRkAZtr+m2++2VAGQI8ePeKPt23bVnUMIL4H11uSANiyZUtLU8cpANoDxheSB5 keUm7Up0+foAJyezx5CgAhhBBCCCkVqNt9/vnntQQIsRFgCAIAJz2YATZKP8yAvFEBgNISMwNg9erVsUzC47p169T5 3xyRmqGwYsWK9gqAT/JlBTQiAOyeA8g0KUvteCsYOXJkRXkRrgmUHaH8qExHQHaq3IgCgBBCCCGEdCQbwObwww+PCT WN1vcU7CQJgNIPZH9AAGHs8XzAgAENCwC8hikAIBlWrlyZmF2Cf8+qVava0jjOHmOz9EP+++STTxp+bbxGkgDwdfcf gb8E/0nzC8qP7J4T3qbjFyxBogAghBBCCCEtA4twdHpHszfUe2PHFyDwkzIAEQE+LtajAv/5KAAwvgj25XPo+YDPIf ujEQEAdu3alSoA8IjfkyQA8Ll58+Z1RAAkjTsFQPHsIcwrkk2SNG/06tXL41NHas8bLAEghBBCCCGlygRAwAYQAIoQ kHKAEI4KRMBmBm2+igAEa2aJBwQA+j6I+MEjxr5euSQCAEF9kgDo9LWURwDUO+ZZAb/P2SUYd1xXplhi9lCbsw4IIY QQQgghJA8SnOM5JAAEEJ737Nmz0Ou8/PLL8c+Ywb/8jrKKpLRAvWhAlxXw+1xaMnHixBgZ5yTsr4VUAtDKa4ACgBBC CCGENASCuCOPPFJ1Ob2L5vTTTw9yR8/MDgjl/13KAPAc18ANN9xQSADgZ/B86dKlTp4m0ciufSg7/mY2CYJ+ZABIKZ Hw2GOP6aaPKDeSZoB43L59e4z7IiAqXFbUimwBCgDiFSeOuDqGfw9CCCGkfSDwAwgG0aANqeKhpvWGdD679AnAc8if IgIA14kE/Wn1/q7t4lIAZINgHxJASojSdv+T2LNnj9q/f7/TEqCZp0ZQABAG/38P+icv26Ue2vGRfjzj+rv5dyGEEE I6IAKmTZumupzYRZ144onB1vf6nsZtYgoACKC8EuDJJ5+sEACuBnZpR/nxWmldHxL+PSgASOAg2JfgX6AAIMS/9znf 14QQUs7ADI8o/cCuPgRQrZ+BIHriiSec3fVPwu7k364dXRdB80ehR48e8fNQgvxOniRCAUC8C/73f6iYBUCIp+9zeV /zvU0IIeUEpR8I7vMIgGXLlnkX6BUtAQg+g/fEEz2u+a9fBPAYQEJy7gwiOIAAAAwUCPFTAJgigH8bQggpZ1BX63vK 3OW/HRKAwX9yar9vNf/NKieiACAkQwJIFgCDBEL8e3+bso+lPoQQQghr/gkFAAl4918EgJQAUAAQ4vd7nhKAEEIIIY QCgARcG2w/Z3BAiL/vfQoAQgghhBAKABKgADAb/0lgQAFASDilAfx7dJ4TTjihoZphnA3t9t8gamxBxmuIEEKIDwJA AjT+wUmraoPM1H85BYACgJAwBIDZ9JN/k86CAP7NN9+s62fPPfdc/bNHHHFELANcPEO+3kA+qftzp6QA624JIYQCoG k7tPyjk2YuUG56cIX6ze//UpH6L6cAMDWYEP+C/aTgn+/1zu/64+gmBOzy2AwB8Nhjj1UIgJEjR5Z2178ZAXsnz4RO ur+i8zY6cKd1564lCHDEG3D1jPdm/f2Z2UEICU4AsFETaYcA6PnPZ6UeA8i/FSH+CgD2AegsCMoR9EMCyO7/gAED9N f69u1buAQAPy8/JxJg1KhRFb/rlFNOKW2gaAZ7RQO/pN1/+zXaKQUkwDfP5Mbff9++ffGZ3WDXrl3645dfflmzatUq 9eSTT6onnnjCizPeowb/4zxBCAlWAHBxRpoNgv4kAcDu/4T4SVKgzx4AfgkABPzyc3gdUwAgQyAkAZD0ep0IKs3dfo wN6NGjR/xc6NmzpzryyCP1jr/gWwkBg39CCAUAIR0WAKDfmJlaBIgEYDBAiL8gu0fe31ICwPd7e9L8Dxw4kBj8S0CO gA8CQII+BIVFavjxc+vWrasSAFJSMHbsWP37Bg4cWPWz+Fon0sGzduzrCQLzCIBWpJmz5p8QUtZsX85NFACEVEwKCP 7lUSQAJwpCwigFoABoD/369dPBv9nhH0E/gnFzvsWjKQCwSyzfk3dOX79+fSwA5PWkhlx+Z1ovAPwb8W9t5a5vHiHQ bAGQVRLQrPKAIjX/JpA0AGO0evVqtXTpUnXbbbdpQqj5/+STTzTc/Sckf6YXsrkAnoOsOQZzEuYmX9b1ReeKVs0nFA DE2eBfMgBkkhAJACgACPFbADDbp/0CwAyuBw0apDZv3lwx1+I5duzNDADUiBcRAAjwIQ6ShILM9WllAEn/Th8EQNFs hEYkQFLNv9T67969W7N161a1bds2HfCb+JL6HzXhP84bhCQjpWIC7hnI/IL8xXwDzDnIx029MswlFADE+ZQgkQEiAe Q5/06EENL84B/079+/andfUvhNAVA0AwDfb2YAmEJBPgfxAAFR5N/bzOC/rAKgWX0CzHurBPNJmAG/q53+cy2Scy7i OV8Qkg+c9ALsPiLSW8T3tP8yCEQKAOK8BDD7ATD4J4SQ1guAwYMHV+3uSwq/uWMvOzh553Tz++3XMyUBBETZBUA9tf l5fr7VAoAQQlpdBlCkP4xvPQHKMEdTABA2CSGEEFIooMZce/DgwcTgvJkCICnLwP69nRAAWcF5OwRAPf/eeu+rvXv3 Svwadv1RiuF9FsDHtWULpQshxcoAkN0FCSB9RPL2HfGlJ0C9c0bT5vcQ6kRxdBSPhSOEEEKaIwD69OmjFi5cqMaPH6 969eoVB4VmVkAzBID5evg9+H34vfj9af/eZvYAqJUBUCtlv5kCIE+w2cxAVAQM/uZJC3GUe6xcuTJu+uejgM+bbcHg n5DiGQCQAILZE0D6AWD+97EnQBn6iwSRAcBO0YQQQkj9EiApqO7WrVvFDj12gJN27KWzfK1g0/4+CUBlZ1k+xu8tQx BYT2PAovXmzThasBHwt965c6d666239Pjs3btX7dixQ4/D+d8c4UXTv3oX6n/6058Y/BPSAKNGjdIgIyCt34j9eW8z mTNEI0sAUoJ72d3PCvDZMZqQcr+P+XcgxO1eLEk7/nK8XB4BYH9fUkZA2ReArRAAnf5/6tu3j/67o+8Dei+gAWPSKQ zeXuN/i7jjTwjxTzh0YsHQbAGQN8WfgQYh5ZV4/HsQ4rYMSEr5zxO4J31P0RKCMu/ilOX1CCGkDIwcOVJz7rnnqrFj x2qpaM/1KPsKYee/0eyxYEsA0ur8zR1/ZgAQUp6+HFkSj+/RsK4Fjrf/AqAsr0cBQAgh5QGlRCZ2+j/6jxQ5Stb1Eq O85WfeCYB+w66uO0NAJACQRaXU/ctz9gEgpPM7/Um7/a1s2MnTIdy6Foj7EiBPzX+7XsdlCcDgnxDiM9j1BwMHDtTZ AAj2N2/erB9x2gsavra750snBECaEAhKADSyWDd3lBDs20KAC01CyhP04THpexoRdTJ/9PznszTynBKgfNeBzM38m/ gnAJpxRFOzXocCoMXrtn79vD3+r54FPCGkMSGAHiPoNYK5P+20l1DKAbwvAUDgb9LoDd9uDMhFJiHlq/dPe1/W+77F vHHTgytiEPj3GzOTAoDBP+mABGiGAOB7tnzBvs2qVavUvHnzglucsyEgIcT1+azjCwUE/ZL+2wwBIAtNDnBYteTEr9 TvLEGQJAswb/zm93+JQfAfwtExrgoASgBC3BMABw4c0KUZW7ZsUStWrEg9IpICgBBCKAAyBYC5iJeFPAeH5A0iKQPc GrtGGnbaJwYkXQuS/o8sAJEAZkkAx6Hz71sRAGz8SIjbWQChpvwz8CeEUAA0KV2QO3WkaCBhBhQMItySAEUbdp444u qKsa4VUCZJAM4v5ZIA0qslbzNAjCH/joQQQog/4BjA4IPxEAUAIfWWANgBBSWAe+OXp2GnGfzbgb6ZVm5KIVsCUACU rwzAHPukppCEEEII8R+UF4WYVWRnF1EAEFIDOwikAHA3GKxVygEBIIGiZAjYMkA+D+Rz0hiQwX/5swDSToZIywJgxh ghhBDiT3mRSIAQy4za3V+EAoB4uavMv4db41bre+wMAFMCSLBvft4UAAwUy/teTcrqyLVQ+OzEGPaMIYQQQvySAEJo GQEUAITUCBzSvmYGf/x7+Rs02qn+EkQWDSRJecoBhLwCgE1jCSGEEP8kQKhNRm0JwBIAQqLsI+TMWnIGf2GKAHaUd/ 99ndT8MWnnH8h7nQKAEEIIIYQCgARQM54UFFIAhFfuwdKPsMp3EPCzBIAQQgghhAKABBQsJAX6DAQJ8fRGZQX57O1A CCGEEEIBQALLAjDThc2z5Pk3IoQQQgghhBAKAOJpyjAFACGEEEIIIYRQAJCAasH5NyGEEEIIIYQQCgBCCCGEEEIIIY QCgBBCCCGEEEIIIRQAhBBCCCGEEEIIoQAghBBCCCGEEEIIBQAhhBBCCCGEEEIoAAghhBBCCCGEEEIBQAghhBBCCCGE EAoAQgghhBBCCCGEUAAQQgghhBBCCCGEAoAQQgghhBBCCKEAIIQQQgghhBBCCAUAIYQQQgghhBBCKAAIIYQQQgghhB BCAUAIIYQQQgghhBAKAEIIIYQQQgghhFAAEEIIIYQQQgghhAKAEEIIIYQQQgghFACEEEIIIYQQQggFACGEEFIK+vXr V0GIN2nzP14ThBBXOOaYYzTB/g0+n8gJoQAghBBC8gT+Bw4cqCAUCRBl/MfrgxDiigDYsmVLuBKgclInhAKAEEIISe KEE06oCPhDywKIavzHa4T48j4H4f4Nos/wWwB88MEH6rnnngtTAlRP7iQHxx13nIZzAwUA8WxXL/r7hR1F4U2GXMAT UhsE/ggMQkz5twUArwfiu+gLVwJEeo3vswSgAKAAqHdeCFcAtGdeoAAgbQ3+zVTejRs3BiUCuJP32d+hwTEPVR4RQo hvC/2VK1cGLAGioCTAY489Rgng+bqve/fummAFQFPGmAKAeLr7bwIJcNtttwVx82dab2UQ38jP7t+/P2gJwJ1hUubF X6MLQNb7UgBQAPgnADDWQUqA5Ju4t/eAN998s+77gAT/06ZNc1sA1D3O5nxAAUA8lwJ4w0MCMNWXAiDvz+7Zs4cCII D/z1NOOUUNGjRI9e/fXw0ePFiPeZ8+fYKcH2TMyzz2sviTBSB3+niPzysBXn/9dUoAT+9pZhlAkBIgfYL3VgDcfvvt 6vHHHy90H5DgH9eINwKg0DjbwT8FAPGErn266gW8LORD7gPA66FxgbB9+3ZKAI///0aOHKneeOMNtXnzZv2IAOHgwY Nq4cKFqlu3bswYKvECEIs/cxcoKBkQ0GK/WQLgzjvvDDgTIKIECDYLwG8JMH/+/EISQAQA5oNRo0apiy++ODAJkCQA IgoA4jZYsGPhjgU8FvLmwr7LMV2CXszz+sjOCEgSRRQA/goABP4S/JuiUBg/fnz8tRCzglwQAFj0YfEn2QBBZQRkDy 6xFvwXXXRRwAIgCloABDXWAQmAeiWAKQBGjBjhrgCoWwJQABAPgzss2LFwT1rQ42tfvvDLauDAgRqfF/VZgZyPQiBv lkctAWDX/NsCwPdskqTrwkcBgBs/5gOA9P+kMe3Vq5e3451HDrow7qYE+PnPf65ppC7UKwng0fsWQZ1JIwLASQnQhH rfUCQArg9s/gQrAdIXOF4LAMz99957r3rhhRcy534z/R9zwbhx49Tw4cPVtdde608WQOYckRb8t+4aoQAgbQsCD+11 aOLXsNBfu3at7gMwZMgQdfLJJwfbB8AnCYCsj2bs1CbV/Is4kmtFPi5TangzxzJNAJif9+HawRiGfDa4T3OASAAs/v CIBeDevXvVq6++qo499lhKAE+Cui1btuigDhSVAXifjxkzRs2ePdsPAVBHym+oAiA4CZC9yPFaAGD+v+uuu9TWrVtT JbApADAfXH/99X4KgNT5gQKABJwK+Pzzz2sJEGJDQB8EgJzsIP0eUPKBrI8k8dNozT8esZiQj/E78Lt27typf3fWv6 1dAX+zx9J+raSPXU0bFyZOnBgDuZOUMQTsr4U2D7gyR2Chh8Afiz8gIkAkgPfZAPkG3fnATgI6EQG2DEgTAiIAZs2a pe6//37/JEDNcY6CzwIACPYoAfyVAHIPEBm8ZMmSirnfDP4xD2A+wDWBEgBnBUAhCVAr+KcAIB5lA9gcfvjhMdz5cz P4xwQuQTbGFP0eknbtWyEA5HNvvfVWYkBo//vaMX7NTtuvJQCyXr/s15cE/bg+zLpxgB2idevWqfXr18fNAPGI60Fw XQREDf5X9kUgdn6w+Lvjjjv0AnDZsmX6c+gDQwnghwQAeK9iEW/KALxfQZII8EIAFJEAVWMdtgAITgLUXuh4KQGQ+Y V5H/P/9OnT1Zw5c9SiRYv01yCCvRUAued/CgASAFi4YyH/zjvvqN/+9rfxIh8lAFIGICIghBpfX5oD2gE2TnpICtAx 9s0SALt37656fZQK4Hcn/fvwtXYJgLQxbIcAyPp8ma8rzAOQAAMGDNCkycIkMLZ2n4iQsoBcaQyIxZ8pAX72s5+pX/ /615QAHpUEmBIgSwRg0Y9GX2eccYb61re+pSZPnpwpAZyQfDkX+3nwXQK89957VaUAYWQChCUBMLcj4wtZAKYEAA89 9JD6wQ9+oL9HRJAtACZNmqQFwPHHH+/v3K8oAIgnO/z1ZAIcMuAQDSSACAGWAkROjbudAWDX/+M5xE89izh5vb59+2 YKAJhmnBmfJABQq9rKMoB2ZADkeX1XBUCzMos4D5dzEYi0T+z8mBIAC8BHH31UvfLKK3onSAhSAHy2CIw8kgBZIgCB nlkigI+x6E+SAMOO76obBON1Sv8+zz9p1RQDpgTwZf4WAfD222/re7JcHyIA/JcAeSWRP//PmNMhASB9RQLccsst6o YbblAzZszQ9wXcI/DetwWAmQUwevRoLQyBj/N/LRnY7HUcBQDhQpw0Zdw3btxYIQCQ3msH6Mj6qFcA7Nu3r0IAIIXY fv0dO3aoQYMGJQqAFStWUAA4sIDEGAs9evSIn4cyt/h6XCgWeEj7hADA4g81oT/84Q+1AEDTJ2R/nH/++XreoATwQw LY2QAAO78I/pC1Y3Paaafphb8tAD7+rz1aACxfvlwNuXa22vc//7fc80H9N1LvBYA0ecV4v//++xUCwJYAeaj1e8rX VDYqIAHyoHL2l+i8BMCaTSQA5v+pU6eqm2++Wc/9l156qfrKV76ijj766PgaEAEwZcoULQBw35D3f4/jBwYjAUwBwA wA4jU9e/ZURx55pOpyehfNoad3DTILwGUJYGYAmGn7yO5oJAMAAaF8vG3btqpjAOX4ODv4X7VqVcubANpjVxYB4GoQ eeKJJ3pb899ouZDLEgC7/tj5kcUfgn8RAJQAfkkABF5J2QDY+UXwBxkANm3apO677z7117/+VSMiwJQA08/pqyXAj3 70I/WdeUvUzY/8WJcQvLHq3pLOBcUH8fMfyScByjIXpAXbSQE7xgzXBgQAxl6yAEQAzJ07t0ICyPM00sQAJBKunfb0 k0gLtlOC9gZ3hIuUkZSllARzP+Z1lH3hHgD5i/kf4H6Auf+CCy5Q55xzTiwBcC8wywCuueYaLQCOO2OU+uI/n6XLAp xZCzRBBFIAkCDAhABQCoDgDTf+kEsBXFj0YxJG2YbcbLsc06UiIG9UACAQNDMAVq9eHR8DiEc0ijt2eHXQgK/Nmzev 7QKg2Qu2rNfOcwKAq1LJ15r/ECUhgnrUfCLtUxZ/AhaAV155pcaUAF6VBhQMBn3oE5AmAUQEIBtg8eLFOvD/0pe+pE GpgCkBkNmF18E6YNq0aeqqq67SIJi8+ezj1c4n7yjxXFAs+M+SAGVdF5hN3IAE4RdddJEGjR4FpG+bAgDjj/EVATBz 5kx9og/GHsdCS6CPOaMIEvi3Z/c/Tw13ewVA5b+nPAIYPV+Q9SWZX/b8f8UVV8QSAPcBgBOlIACOHvz/VJQBIAsAAn D74//HawmQJAGb8d5vuwDAIAedKq0iBvgFRQBu+F1O7KJ3BENe6Ltw7eBma/Zu+PKFX9YSB59HY0c8R6+HRgUAXsMU AJAMWHjIx2UKzJq1YMsjAEKZX1hq5G7qLxaBqPnEWgDzuyz+TAEgEgCLRAT+0izWFgJuSYH6doTTdobLtrivNfYSzN sSAMEfBMCf//xnHfy/N//L+hGCDxLAFAB4v0MCCF/72te0ACj/XFBA+BhjXisAKNN8LxJARAB24AUEeqjrBmj4KAIA mR8YeyCC4LrrrtMCAIHgyJEjK7IAJLg3X9umc6dI1HqfRnXNAY0F/+XMAkPPF8n8sud/lAJg1/+kk06KJQBKxyAAzP f/UUcdpfoddYh+/8sc4JsE9lIA4EZe78/jZxEIAryWa0Fhs4IAVxb8XKSHDSZqCIHnn3++IQEAdu3alSoA8Ijf02kB 0Mr3KwUAcTnwN4MDLAKx0JOFnx38y87hqaeeqtM80QTq+9//ftURke3d5Wss8K9Y/9dZG54cS7ghAiSQk51eEwR+2P WXDACA4P+1117TacG4ZpBNJhJAQHNAd9YXxTM+0iRA2d/rkPUieyQwlwZvOO1BegBI2QfkjzSJPO+88/QuLyQAgATA fd1sEJkV+Hf2CMkofzZAWuZHAxKgTCn/tTLBzLnfnP9xX8DcP3z4cH2fgAiABLj77rtjCSDvfQAJAHzNBGvl+78tAg BvTkzecs5zI1kAuOkfccQROvDHjcMFAdCKIIALfuKKAEAanxzviEdIgHpeyzwFAAuCJAFQtsVgM2u4swJ+zgWkjIGA HfibRz2h4ROCOzPwx+JPFoDDhg3TAgCnepx55pl6EQgJYL6OvegvjwhIW5Q3fxfQJRFg7ubWEgAiAdDzQySAmQng5u ZCwZIPByVAUjaALQIw/hhbs+zDLP+QEhCMO77XFAC2BDDngfLMAfmyAZKC/kQR4GjKf5YAwHxui19z/k8TAJL1hfe+ c4G/MZz1yt9mloK1XADA3om5ld1/nPGMr8livkhTKPy8/JxIAPN3udLIqZ6U7lqLfgYApIxIcI7nkACSAYRmj0Ve5+ WXX45/xgz+5XeUdTGY9p5t5Kx3vveJC4t/MwCQxbuA9E7UeiLVVxZ+svhLEwBYJEoAKa+TJgI6uQuYVsvdylrg5N9X bgmAhm+o+UbaN3Z+EfhJCYAIAPSMwLVgCwB0EndTBNSQAAkBYVoqsGuZPyICRAKIADDHXJ6bEkAEgPxs2q5/Gbv9Z8 0DFdOA2efDFkKeCEBTAKDHi8zp9u4/YjlbACxYsCAWAK5nFRfKBHNBAMgbvdUCAAG//BxeBx+PGjVKf3zuuefq31Wm 1P52CADuAhJXkDIAPMdJD6gBLiIA8DN4vnTp0tKl+zcaxLfyZwlp54I/qwZYwIJeJABqPiXwx5pBFoC2ABg3blwcPJ YvFbhA+m9RCVBH5+8y7xabEkBSvZH2nZYFgH4A+F58HT8rwT+uid69e6vLLrvMCwlQKwug8lHWkOUO/JJEgLxXMbZJ Yy5g3NHsTTIBTAFQvl3/+kRAViCYJ4PApcA/SwLI/G8KgC984QuxAECsBwGAYwTtpsBeSwC7EWjZSgDQXTvpZivBv3 QBx4Ld7AKOQL5ICj9+Dp2+bQEgJQVjx47Vv8/uGI/Pt2uXv+iOfTN2AWsFBQwUSJl6Qkg2AI54LCIAcBqEBP1lrPcv NOnW8d6kACBlBQszWeCjaSuAmEeXdjNoTwISAIs8LPhszAUgQLYAyOoMjl2kW2+9NT4GrJ1dwAsH/3kkQFM6gZdbAm BMIQHMgBDPwRNPPKE+/PDDuImgSAA8x/0EAgDjLhLAnaAgnwSwr6vqQCBSrpR/2KcFSCmANHy0xQ/GGgKgVvDvxrin C8I85R8+Bf9JEkCyvkDS/A/ph/sMrguRAJDHwGsJkDDe1e/9EggA85gtBP21zgHHmd7yPXmDh/Xr11ccBYbXMzuB4/ WSSgHsf1+rBUCeYLxRAVCkERgDBlIWTAGAbIC8EuDJJ5+sEADOTvp1zgGunQhBwhIANtjVB7KYk49NJLCHBEC6p4CF n7n4wyIPKeII7r/97W/rxSIeZQFogt0k/H4z4Gj/OeBNkgBNeN2ySgAZH/SIwZoNAgA7vRIQIvhD/T8CAtkBRuD37r vv6p+7/PLLYwkAAfCrX/1KZ4bh87hmXAkIk8Y+q4QkOxBwIyPAzAYQCYCGjyJ9zP4PGH+zAaD8LMYWr7Vp0c3q43e3 qf98cIa65557HFgXROlHPeYQAJWXTOT8Zh8kAE57QbaXiT3/mwIA14RIAHz9G9/4hrsZARmZP+nCpzkSIGpF8A8GDR qkzY45GHiOHXszAwDdQosIAAT4EAdJQkEG38w6qPXvbPXufzsEQJ5gn00DSdk49PSuelcfu4W1vhfHQGInyNVd/6Kl Q41+LyFlkQLo4G8yadKkRAmAxZ6NLP7SMOtHBfxOPA68cnocJHQmRTjqGJXzRHPTRluRAYDnkAB4jmBfzvmW4E92gL HegwQSAfDqq6/qUyIeeOCBOAME34umgpBEIgJKLwCifOInOxsgckYEJGUDYNwR8KPng2R+yPhLyYDIPFnrI/hfPuMS Hfwj83fo0KEaFyRAWlBnHv1ZROa5usaX41zxPka5l2DP/9IE8Otf/7oWBKYEwPWC75V7ilMSIGfmV/r1oOp+z7dMAG AA7d19SeE3BUDRDACzE7gtFORzEA8QEHn/rSEIgE5NEDyvm2SBmzaC+zwCQCZ73wRAK743hFISzivuZgdABEyZMkXL gIULF+pznkUEmJjB/rx589SECRMqSHrta665RvUedrna/4ePtATY8S9zNJ27VrLr9POWDuT9GVfmCVMASKd3QXb8ze DvueeeiwPHrl27agEAZBPod7/7XSwAcA2grADXEORAOeeJejM5koOAWl8vEzi+7eP/2qPHEo0dgUgABHbIAEHZh1n7 L+OPNYO96Tf9nL468N+wYYMjWQC1swGSd3wjLwUA3sO4J6DXi2DP/4888oie3yVD4KyzzqqQANI7BogEcOI6UFHu+T /7/V1cArRMAAwePLhqd19S+M03L4xfEQFgfr/9eqYkgIAouwCoZ1Gf5+fLJgAwmePMV7txR95GHgj+gMs13834m/sa AObpA1LmLv/tGNeQgn9cDyBrrsB8gnnFx2siz3zhcjYIdnqSAnfs8AB0e4bYR8onwOdk8Wdj3/sBAoRjTxupg//Vs8 fGAgDPy3O95AvwawsCd+cKEQAStNuYNd8S/MkY4xQYbPQgcPjf//3f+PN//OMfdS8ACAA8okwEfSheeOGFEs4V9Zdx pCUPuCAB5D0KELiL1MG63ewNYF4HMv4I7L72ta/FTSDl9Z5++mmd9bNmzRr9vp+/8qVS3xsq5++oZhZHlQzwKMNXBA COeLUFMMq+RP5ivke2KMo/EfiLAJAYEL1AgPSJEUq/RlD5mz2mi6H6MoBaJgDwRz948GBicN5MAZCUZWD/3k4IgKzg vB0CoEyGUG7OGDsB47Zv3z79CFEEdu3apT9Gt3eA9HDUfSMVzIfd36jB/7ibSHwGiwABASCyxXBzx5wAzPnDx93/kO YCdHy/5ZZbdKB29OD/R49lUoBvgsUfvg+n/QAs9pIEsi2LEPhL8F+WayZ5LGsfGeZS07ciAgDYZ7ybNd8S/AE5BswE Gz54RN0wegfIrjICf8FVARDl2t2Lqq6hek+cbMd6EAH98uXLYxEgpToybhhDkQG4H4j8wfj/wz/8g3r//fcrxh+7/h AAeETwj+wfyIWyHw1si4Ak4RdZ4+ubALAlAMYRjWPleFgIAMn2kvGG8AESF+BecNVVV6k5c+bo5zIfgCVLljjRDySf AKoWgOn3DlMKtrgJoB1U9+nTR6f2obFLr1694je+mRXQDAFgvh5+D34ffi9+f55/Z6t2bNIWbK0UALUWiZ2eIMwJG2 UcAP0c5LmAs95x3JuZEhjyYp/BPwll5/+II46omg9kjvA97T+kOQD13UOuna2BDJAgQOpBsbCThmBS8ymNP/EIAYDn uDZECKRdG2W8ZlJLAWs0/6pu+uSuDLAFgAT9pgiQ4B/XB3Z+Efxt2bJFp/5jTCW936wdrifLsKwCIPE6MK4XV6UQxg Lv/R/96Eda7JkSQIAEQMNH6fkg84M5/gj2cA2Z2T+oHUfw/8aqe9Xu5fNLfc9IkgDZx3mmfb/bmWEiAMzsDwgAafQq AgDzvNwHBNn5l/c/skO2bt2qNm7cGAf/8ui+AEh6j2dnkmVJgKiV/1PdunWr2KFHIJe0Yy/p4bUmDPv7JANAUsPlY/ zeMqZyNnpMX56gvkxBPoMaQkjR1P9Q552QZB8EwL7/+b/quDNG6edJdb2QAEjxlJpPPMeuj7nwO/vss7XUFwngRvf3 fL2AsiWAW03fagkA2fU3kaPeZDyxsMfOrxn8Ic0fO8YiAbBGxCOOfl68eHHJ54W8AiA7WIxSgoio5AIA7//vzFuid2 7l/W+OtSkD0PMBZR/4mjn+CAylhER+dvY3/0ntWnaXbgy4Z8UC9fZPF6kXF0wsvQTI+95PkgWuZwMlCQCARp62ABDZ +81vfjMO/v/xH/9R930DIgJ+8YtfOLQuKC4A8pUNtLgHQN6FWdqOv9SI5xEA9vclZQS4dONvlgAo28Set+bf5JABh2 ggczDR4zgfmD45Mi6UhTx3/0moTJw4Uaf+QwIMGDBAk3f+8KEnQCPvfRfnih7HD1Rf/OeztAA46qijdGOwNAmAek8g AkAWf/gcjhiEBMDnRAKUu/t7/rFLq/eMcgWQ7goAO/i3JZ8EfwASQN77tgTA0XL4PFKL5WhJVwRAVOBna0mAMq4nMC 43P/LjKgEg9f24BqTRI5BTxczxR/aAefqDeY1AAMic8suHvueMAKjM7vBT/mUJAMn+wXjaGQBS9iWBP64dvNeRISgZ YwCfQzmAO5sCRQRAkb4RHRYAWSn8RVL0kr6naAmBKw2/XG8Ml1bzL7X+u3fv1iBNZ9u2bTrgN/El9T9qwn8MDEloGQ CQAILZE0D6AWAO8bEnQIjzBBoCQgT0O+oQvVjHo9xDsPAzJYDZ8VkWf3hEp3CRAFgwoqQgqyTAHaoDgSjngtFlASDB v+z+4qg3UwKYwZ9gSwARAFIiOnnyZH004OGHH+6EAMju+F5rwR85IwDQoBGgvEOCdTnbXSQAjno0T3tA2QfGW66BX/ 3qV7EAuPrqq/XXtFw4+3j9aIrF8pcAVEuAyqMe/ZB/SQJAjoQUAYAxlaNezfp/lH0h8wvyV+4Dt99+u37P2xLgmWee 8UIAVI5pcsp/PRKgFAKgLK9HAdC6cgAJ5pMwA37fznnPM04M+gmpZNSoUTojIG3esD/vcz8A1+b9ovcI1OpisS7Bvy kAJBBA4G93e8YCz5QAABIAaaNyBrxLmQDpgV51w6c8O0AuBAMI8E0BkBT845x3871u9g1A8Icg0M4EQN04dv3NLIBD DjnEiTKAWse95csayEodL997X4J1U/LIbi8koX3aA8o+MN4igH784x/HAgCiRySAD+/9yiDPXwmA97tIgCQBINcG5C 7meUhfzPlyrUAC/Nu//VuFAHCreXit+by2AMzOGumwAChS89+u13FZAjBYJIQQ4rIA2P74/6kSAPK1b3zjG3oxZzd8 Qs0n0j6x6DMFgCkB7L4A7gcCSuU9G9qVYCBLAGDMPn53m07lRlM3lH/IGe+mBEDwZwsAnAUOCQABAF555RVn+gDYHb +TU8XzC4Ay9wPAmOx88o6q0l6MpYyvNHo0szuk1FQyAYApAEQCyJzgngyolfqvCrz3I+8EgC0BwIUXXqjvBZAAZlNQ nDbhRxZAkdKhfO/9jgiAZtRqNut1KADalwlwaK9DE7+G3bxTTjnF+ywA1v0TUhss3nGDx8Id84I9x+O0l5BOA/Bd/G aNpaQD45owaz7R7El2eSABsPiTBSAWkrIo9EsCZJ0O4GYQYAoAM/iXsUfwj/rwoUOH6kAAmJkANgj65Mg/XDMA88iz zz7rhABICv7T54PiWQCuvP9FAkh6/+9+97tMCQCSBABKgjAPoCzIvTmg2RIgckYCpJUAmBIAPV8gAUwBgOvixRdf1F +X+8OmTZvik8fclgD1lA9lZwBFZbvht/M1SBtTvd54Qx/RmJTOi/O+cfOXpn8+p/SyBICQ2mC+EOz5AvOIfZpMSCUA Ic0Tcva3CAA0djIFAMCOj5QE4MhAyRIQpBTAXQnQLAEQlVoAmKn/MvbY8Ufwv2HDBrVmzRr9sdkwDgGfCYK+nTt36q /9+7//u+4BsGvXrhJnAWSn/tfu+ZEuAKKUGnKX3vtoBi2ZAH/84x91E0ez0aNIAFMEIBhEBhAepceAMHfuXMclQLUo igqIgMgTAYC5HEE+BI9IAMz1mP8fffTRigwACoCSCQASHjiaETfmt956S0/ee/fu1XVcWMgfO/xYL5r+1dvgK7RFPS F5wEIfgR/mCHSAxuPBgwfVwoULS3PUa6fnjZAEAM6FxiIPXcLthk+QANj5weLP5I477qiQAZJO7KoAyJIAaZQ5ABAB YO/+m+MPAaAD/yunq/krX9LnvOOoN9kllh1fgEAA6wzp+A/wfWvXrtXrjXI1AVR1pP6rnAIgSukhETn13kfzPzO744 MPPqg67UFkEDI/MPYAfR+wsQSeeuopjT/vfZV4veTxf66UAmA+QAmPBP/XXHNN1VGxkADI7IDsgQTAz2GOx7yP9z1S /1966SXdbPywww5zuhdA8j0/WwBEOd73FACkbXTt82k31sGDB8e7OEjxDS4jgjv+hOQGc4Sc74v5o0+fPsHOFyH2fh EJAAGAawALOtndMRs+YUcIjxL0CZAA4OGHH3Y4c7Dojr9KDAzKmgGQFPzb2Z4I/vf/4SPdDwDnvMvnTQmAYECa/tl1 5eUc++zgv7Eg0f33PYI8jCsCQACJg88jo0PmAASKEIQyvvb7PwkfBEB2jbi74y5ZALfeeqsO/iEBeg+7XB172sjELA Bp+ipZABAA5nWA5p84OQAZAC72Aki/3+cpAcp+HQoAQgghhJQ6GIAAwOPGjRvVL37xi7gcwJQB0vQpLQhw++8QJaZ2 520iV8aFvpn6n+caQPCPzvHoDQCke7yZ/o1dXzfGu5nj5Z8AkDFHcIf3PsZXBMDixYvjBo847UEkAMo+zPc+jotDZg CCPzwHLmcB1DoKsCorwMHMMbMMAM+R+QPxh8ckqSciwBYAkkGC0g+Mv6sCoBEBmKufECGEEEJI2QXAkiVL4gUeznnG UU+mCEDapyz+3Fzw1xYA9u5+1tnvZV/o5wn+zetg9/L5as+KBRXnxmPxj3pgLPZFAJR/7Jspa/LV/LqaBQAwvtLgES DTAz0eRARAAOBjCADz5yXwk2DQBwGQ/d6PqoM8x8pMzbkB44Xgf/XssYnNIkUAAAgAZHuZAgiIAHBTAjRPANjjTwFA CCGkdGBRF3TQy/KgqsWeGfybYNcfzZ4ASgSQ9onFvl8CID2NP6nu30cBINfB2z9dpB8hAfA56QSOMUe9t9SEy4IfdO /evWTXQusFQHrvALfe96jfx9iaAsAUASIB0PAxKUhE8I8yItC1a1dH3/fJ2R3VzQH9KDs154cd/zJHU0sC4NGWACIC 3BIAzZMASWWEFACkFKB5R2jH/mU1+CGEfA4WAJgjOD/wWrAlQFKdOEDDJ6n5lNTfECRAVWp5yRf8Zsf/otfAiwsmql 8+9L2KmmA0BDMFgLnzizRxQZoDlmdntxUlBdU7vy73HhKhYwoAjOXkyZP1c5zwgKMeIQHQ8NFOFcf3TpgwQZcKYH5w 9X0fpdwbap324OrYyxyRJQDsTBFTAJhfFwngWg+IqPB8kn0NUACQjgX7NqtWrVLz5s0LajEfakdvQuqZM0QCmIQmAD hfVAb6SV8zd3jMlE8fJUAtWeT7NZPU5A+LfwgA6faOMZedXwR/CBYBmsqV7zSA1ggAn9Ycdi8PSByMJbJ95PMQAdIn QH4OmR8iC1BG5MsJMkljmdTs05exTwv+7TkAAkAavmZdP35SrA8IBQBp+2Iex7ds2bJFrVixIqgFPQUAIfXPG0JoGQ GcL+oPFtyr/Wx9kODzmMs57yIAIAQgALDzi+BPAkZ//wbhrDcgAGyRg3HH55IyAET+dOnSxfPssMibDIC88tcuFwlx rs+fIUYBQEqSBRDygowLeUKKzxshlwJwzqh/1zDkRWFI422PO2q+kfaNnV9fgj+uOYrLAt/lD+8f+UUBoQAghBBCCC GEeCwA/Cz7aDRbgFAAEEIIIYQQQgghhAKAEEKyOOaYYzTB/g0+n1EJIYQQQgihACCE+C0A0NgxWAlQOasSQgghhBBC AUAI8VcAfPDBB+q5554LUwJUz6yEEEIIIYRQABBCKAAoAAghhBBCCKEAIIQ4LgEee+wxSgBKAEIIIYQQQgFACPFdAK xcuTJMCZA8wxJCCCGEEEIBQAjxtwwgSAmQPssSQgghhBBCAUAIoQTwPwuAEoAQQgghhFAAEEICEAAnnHACBQCvDUII IYQQQgFACPFNALz++uvhSoDUmZYSgBBCCCGEUAAQD0BwF9QubxUM8NIEQHASIHO25TVCCCGEEEIoAIgHAuDAgQMBS4 BIx3YM8NKzAMD1119PCcBrJJHjjjtOQ4nIa4EQQgghFADEAQGAAC9cCRBRAuTIAghGAtScdXmNJAnEcAUA5w5CCCGE UAAQCgAKAA8kwHvvvVdVChBGJkA4EqB79+6aYAXA53dTCgBCCCGEUACQcAQAAj4KAC7iTQHw9ttvqy1btsQSQASA/x Igz+wbeSMA3nzzzbpFgAiAadOmuSkBqu+qDQgAzh+EEEIIoQAgDgiAO++8M+AsgIgSIOGaAHv27FHvv/9+hQCwJUAe nL0mckmAPJRfANx+++3q8ccfLyQBJPjH3OGNACgkAezgn3MHIYQQQigASMkDvYsuuihgARAFLwCSAvYRI0boLAAIAJ QBSBaACIC5c+dWSAB5nka5RUFK0J57Fm4mnZUA8+fPLyQBRABg/hg1apS6+OKLA5MASQKAEoAQQgghJRMAkurZSN2n 0zSU7lm+VG2TRgSAkxKgCem7oUiAtKAb4w/GjBkTc8YZZ1QIAJQC7NixIxYAM2fOVOPHj9fB/ZAhQ+JAf8aMGYXANY frrT3XXMFgvE0C4PNf19lrrh4JYAoASCNnBUDdEoACgBBCCCGOCAAs9KTuM2gB4LgEQJCG3Vl0bAdFZQAW8Aj4Zs+e 7YcAqGMHLyQBIOnagogfgGtg1qxZmm9961uxANi0aZNavHixRgTBddddpwXAFVdcoUaOHFmRBWAG92nIdSbXWnuut7 RgrUEBoJoR+Hf+epP7ws9//nN17733qhdeeCHz/mBeTxjTcePGqeHDh6trr73WnyyAzHmk1vXEBQohRTlxxNUa/i0I IaQFJQBY2KHm02z+FJQMaChoLJ8EkBptEQG2DEgTAiIAEPTdf//9/kmAmmMbBSkBAJr82SIA1wCYPHly3APgvvvuU3 /961/Vn//85/jaOu+889To0aO1BACQACeffLIWAHIdlSfwrw7aqoPvbAlQ9ekGJEDZAv8kAYAMgLvuuktt3bo19d5g CgDII4y9lwIgdf6gACCk2YH/5GW7NGdcfzf/LoQQ0goBgEUe0j0lGyCojICGd47LWQqA9GwsyE0ZgEAPJIkALwRAEQ lQNb5hCQC7FECC8SQRgIDutNNO08H/l770pQrk2sLXL7jgAv29pgCwJYC8fucC/+QxzyMCkoL+RBGQM/gvc4AoEgC7 /xAAyATAfWLJkiUV9wYz+MdYY/7A2KMEwFkBUEgC5Mkm4QKFkLzBvwT+D+34SEMJQAghLRAAtgTArg9o5Dgo/3d83B ABpgTIEgHS7A313kj5xq5vkgQ4tXd3v0RAVDRY8/c9kCUCRAKIAPifOV1iASDPTQkgAkB+tjy7/rVlQJYIqEgGMOeG z0RAnuuqrLv+afeFvXv36nvDHXfcoaZPn67mzJmjFi1apL927LHH+isACswhFACENA6CfHPXXz6mBCCEkBYJAFMCyE 4Pdn6w+Hv11Vf1Qo8SwG0JkCUCsIg3SwSkjjtNAoALBx3lUUlAbTEQyqkASSJAAngE+Lhu7CwAYf/+/VoiSSaAKQDs Xf/p5/QtqVDKFgFRxnWVJ4PApaAQ9wTM/7gXmBIAPPTQQ+oHP/iB/h6ZX2wBMGnSJP8FgKIAIKSZEsAM9PFcMgEoAA ghpAUCQBZ8kvIJRASIBPA+G6Du+vHySwA7GwBIV3fUd9sg2JMgzgzels+4RK1ZOEk/OpERUPc7KkwBkCQCJMCTUgAE +ng0g3+RAxAAtYL/n8y5Wi0ad3bJr5/03d00CRDlKiVx6xrCvI/5f9myZbEEuOWWW9QNN9ygGzwiIwD3BSn3MAVAMF kAKuzsIUJaKQT2f6iYBUAIIa0UACIB0PAJmQBY7GHRh8UfPrd582ZKAEclAAKvpGwAnBzw/vvvaxkA0Oldmr0BEQFm EDdw4EA1dOhQTeTE4jZhlz/Hrl6UUCeuH43/QhABZjaASIDXXntNP4oIwOP27dvVsGHDKrJH5GdxneC1Xn5gugYSoL xZAKqqxjvxWsghACovPTevF0gAzP8iASCHp06dqm6++WY1ceJEdemll6qvfOUr6uijj45PgBABMGXKFLcFQIMSgAKA kPSd/qyAXkoATAFACUAIIS0SAGY5AFI9TQnws5/9TP3617+mBHA08EuTACICkA2AI97MZm9S2y0SAGfA43U2bNig7r nnHkcEgBGAFQj+80gA7yeWzwJ3OxsAaf4I+JEGjuvjiSeeiIN/KRkQYRTpv1ukzuzXU73z7GId/AOIADf6SiRnA5gN AFMzBTwI/jDfQ/5i/kfq/w9/+EMd/ANkAkAC4Ho455xzYglw/vnn+1EGUDSLiAKAkNy1/lkBvdkDABKAAoAQQtogAN DtGemdpgTA4u/RRx9Vr7zyit4VEpJeY9jxXWMi1xZAhXeJ3ZIAEszbEgDBPQQAjnkzG7xJyrcpANasWaMGXjldzV/5 kncSIN7dTQjuTAEQwsSCAH3yqV/UwTrGHeMPRAIg6Mf18eGHH1bU/uN6wvdfdtll+vqALIIAACgf2bZklkMCoHY2QJ oo8iX4wz0B8hfzP8BxfyIBIACuvPJKdcUVV8QSAAIALFy40H0B0IAEoAAgJDmwz5MBYPcAoAAgxN+eH6QEAkAWfOj2 DAGAmk+kfWLnRxZ/WPRhgYedIVsCIOhfPXtsDCVAOSWA9AYwwVGAdqM3SflGgIfA74033tCvgeB//x8+cm9so5wCIC W9O7RFPYJ0SduXbABcA2ZvAMEM/nFdQBbgEQEiQNkISkjQR2LpjRfo15YMAWeunShvvf/nl1qk3C8dwT0B8hfzvwgA 3AdEAKAUALv+J510UiwBcA/xQgDUKQF8mCu4QCPtvqbMYN98pAAgJDwZSNosAGTBh11/pHlKzacs/mThZ0sAWcz/93 88ptN9f7/xXykBSiwBbBGQJADMGm+RAJIJgDpu4FYQly0B8jR5C0kCiADArj127zHeZjYArheRATg+1Ez7Bwj4kQGA rBGUjkAC4HVwkgSuNzSTQ88A166fpDKRtOsiXQBETmUKYJ6Xud8M/kUAXHTRRWr48OH63gERgPvD3XffTQng6FzBXV dShhIB6QHA0wAI8Wfn33yf8z5TMgGAxR5qfLFAl3RPO+0TmBLAZNeyu9Tu5fO1ABg8eLAaPXq0W4FigW9ODBoTAoCy SoC5c+eqmTNnquuuu06dd955Oqgzz3uHAMC1gJRvUwBgjN9Yda8eZ0gfrySANaYhCwDs1mPXXhpA4n0v2QAA18u777 6rg0B8/NGOn6j/emmJmv3Nf1IDT/qqzhZByQhEAH4eZQV4XQgAXH+mBCjzNVQZxFeXAdS6LrIFQOSEAMB8b87/EvzX EgD4WfdEYXVMX48AqCgrcjQY4+KMtKPnjHnNSfo/TwIgxE/BZ7/X+f4ugQCQhT0WcugFgAUfMgHstE9TAqA8AIs87A ICWwgASAARAS6k+tYjAdLOEC9j8zhTAowfP16D8UnLAkC9N74XX8fP/ueDM9SeFQvU2z9dpF5cMNGbcoBaWQChlQFg tx679gjesYuP3XwE8xACZqNA0LVrV3Xz2cfrawOCCBkDKBWRfhEAwb9ZOgABIBKgzNkA+Xbyo2JzjENnx2MOh+zFfG 8LAAT/I0eOrBIACxYsiAUA+gQAV0VAVEQCpDSLjBxcsHFRRtoR/N/04IoqAYDgXwQAr0NC/M0AoATosAAwO35L128s 5rDAS0r7BFj4gVNPPVUdf/zx+uzn73//+7EIEMyzwMu7+EvY0atzlZi0ri/jAt+UAFicQwLIue4S+EundzR7kyaCIg EQ+KPE45cPfc/R3b18EiBvurevWQDYtYcA0IH/Zw0gsbuPXX7s9mPXXwI7XA8QQ8gOMUtEwAsvvKB27twZB/tABIBI AGSklPFaaobAyxKEldeWGxJA5n9TAHzhC1+IBQBKiyAAcJKMXANoMgvM68IVKZD7vmA3Dk28BtgPgBBTAPzm93+pCA 5EAPDaI8TfbADzaFC+19soAMzdOzPwF7AgxznPqP9OS/tEajgEQP/+/dWZZ56pF36QAObryFnypggo1W5/lLF7X88K MWVhXzYRIGMxZMgQvYCHAMBYy44/An054106vWMskfJt13s7KwBSxjnKCNhCbAYoYywNIBHcY5cfu/3Y9f/bvvX667 9b+7jOCkFpCD5+/fXXdWM4vM5hhx2mPwcJgOaS69at0zz11FOaBx54wPlU8cTU8fj/J6o1TThRCiASQOZ/gODfFgA4 QQYCAPOJKQFMEWAKAW8yARIaRkY1bhWUACRUev7zWbEAwHOWnxASTjYA+860UQAkBf1m4G/uzgEs3nHEE3aIJfCX4D 9NAEASyM6yvE6aCGi/DMiq321wVR7VJvn3dT4DAM8hAfAcwf4ZZ5yhkTPepdM7Mjqk3hufu+aaa+LUXqcFQJRvLNOv l3B2awAEAHb5sdsvjT4BskGQGSJ9IUwBgOBQSNoBjjz8O1acDKD8kEeQACj7wrxvYgb/uGeYAgDziEgAsxTApeDf7B GTKgFSj4Q0JUBkXR+EhC0AQL8xM7UIEAnAQIAQf4P/pM+xDKCFAgCLMTvoR1AnoMv/rFmzKkCQJxIARz2ZKZ+S9mkL gHHjxlUEjUl0JiugQNBfjwQo8HplKA8wBQA4+eSTY2TH3xxDOeZN6r29ygDIOWYhBv1pIgC7/Njtx65/UjCPTKBdu3 bp52effbaaP39+zI033qgbT+Lzvgb/ZtAXZfznogAAKPvCvC+YwT+QJoBf//rX9T3ClADOBv9Zu/8154vqcgAuYphx wBKASAf/8igSwN/7AiFM/7fndwqANggAYdq0aZpRo0apESNGVATtSUACYIEnqZ4m5s4PkIZPdqMvE+wi33rrrTqwNE VAmQK+QhKggdfN00W8lQIA45E05hgbZG/YZ7yj5htp39j5RfDndA+AwsE/Jx1ZtGGXH7v99vjjOc6Nf/bZZ7UEWLt2 7aflA38P/B988EH9CLkIATBlyhR1+eWXV4gAHxZ+5ns6jwRwSQRIw1f0fIH0FczgHzzyyCP6XiMZAmeddVYsADZu3O juGKsol0DOEgAM/utbJBL/7iOSASDzvkgAQAFAiH9zuxnoS7aP9PvgnN+GHgAiArCrDySYl49NJLCHBEBjQEHSec2d Hxwlh+D+29/+ts4UwKO5KBRQJoDfb5YCtLccoIkSIGoO7V4UmgLA7MQuO/7yXOSM3KDR+C3pFAAnTwJg8N9wOUDSuM vnIQKQ7WNmASA1XATATTfdVCEA+vbtGz/3pQSgiABwQQaIAIDckXuDgPkf8/u8efNi0Xzbbbfp3X8IADML4JlnnnFz 3sghACIr44wSgBkAJPseIjJAJIA859+JEP/krgT8IgM437dRANgiALs5JpMmTUqUAAj2beydn6Rg3wa/sxyTe9RBOv v/bgsACfpNESDB/2WXXaZ27Nihxwzd39EADjXgSAOXem8Ee27dsIul/edJAuGkVL24O/TQQ6sEAB4R+OP6Q0BpCwCf JICqQwC4JAEwnyODTPrEYM6fMGFCPMeDp59+WoPgf/36TxtGYuxFBrhb3pFPGiZ75IhzBuF9wpCAkg3A4J8QvyWAmQ HA1P8OCYCk8gBTCiBFFzJg4cKFatGiRVU7Pnbwj50fLP5Mkl4bAcDMmTNLNMln1+nn7RuQ92fKsMg3BUBWnwbT0OP8 dxwBhyZw5jFvCASQ8u3Wjl4zszK4mM8DAvs5c+bo6wUCQMQAjgiU4B+fR1mSl00B04L+lK+VXQBgjjCPEpWML5n30R sA42rv9OHz+Bk8btq0ycnsoXwCIE32di7zi1kBxMWsMkII53XSAgGQVwqgsRNYsGCBPucZu3kAn5OaTxuUFvTr10+N Hj1anXvuuVoaSE3wd7/73RJP9vkC/PoaC3Y+3TdLANjBP86Ax04fHuUoOOnyDtDsDUGdW1kAxYL/pPGKUuq9SbYE+M 53vqODfrm+JEhE8C9ZR2g06euk/fmJAMZE7pAESBIAAGVfpgC46qqr1O23365BsI8TAczv910A5Lk3cM6or3aUEEII oQBoE0kBvt1cUHZ4sPjr3bu37igPASAnCEAC4HsQ/KM5FL7HHesbZe/s51wgliHdN00ASPAvfRnO7NdTAwGwZs0aNf DK6VoCYLzQFwLgOZq94WeR8u26AEg6nSF5rIzxZBlAXWmf5ucgkRA8IpX8sMMOC3JCd00ASLkQ5hI7AwBzuwBRjPsC 5n+IADk9YOvWrQ6OddEMgKjGPYM7ntwpIoQQ99L4SSACQBZ/APWbWMgBOeoJDZ9kRw+7PiIAbAkgWQBg6tSpcSqwEx LgsyfZxzzl6RRdvfvXCQlgCgA7+H/5genqnWcXawEwdOhQtWHDBp0FYAdwdhd3l/sApB3NmBWYuXicW9lAY1EIgMmT J+t08m7dugUd/JddAMhRsiIAMI+YDV6R+SVz/4UXXqjvBS+++GIc+C9fvly99NJL6pBDDlE9evTwSgDk7SnSyWNgCS GEkHqCfzTy40ktAQoABHhYoOMREgCdneWoJzxHsyd8TQQAFn+yAERQiR0gsxTATAN2RQJUdnJOlgD5Foiqxg5z5wTA T+ZcrQUAHpfPuETX/0MCAIwRUrixc4eTIOR8d2ng5ocAUJkCIE7zVe6f7V6WrADIJQiAMWPGqC5dujADoMT/VswRIg GSBACELxABgKB/7NixaunSpfEJMm7X+jYuAVx9n7by9bmoJIQQNyQA5+qABYApAXDMExABgAUf0j4R+OO5mQ1gSgAR AS4KgKRAP6prgdh5AWAG/2jwt2jc2Tr4B9uWzFJrFk7SImDyqV9Up/burnbu3KnHSgSAnPEuIsBFAVAkHdcUPZQAzQ HX0uzZs/WucKgTuivXTy0BgJ4vyPaCBJAygDPPPFM9+uijnjT5akQAkHrq/LnYJCSsMhw2heS1QEokAORNuWTJkgoJ ICJAjnaSOk+kfWLnB4s/sybU5IEHHnCrDCBBAlQ3gotyLxKjDqWSmwLATP1HgA8gApAFAJbeeIG6cNBR+vOo90XqLy SAmQEgTSHR6d0NCVDvzlzlz2Qd7UaKCYDDDz886AndpetGJECSAIDglZIvfB/EL+Z6fwRAfRKAAqC2ALDPhpbnPDOa kDB2feUoSHmkBGD9PymhALCzAcxznrEIhARA2icWfsIdd9wR8/DDD8c/76YAiBJEQHVwmX16QGcFgLn7b35dRICA1G wgAuC1117T43XjjTeqWbNmaSACUMuNTu/lH8uiu//p4oYCgIRGlgBAZpdIADxSAFAAFFlcgv0fqopHCAB5zr8VIeUQ AOZ7thm7/Qj6Qb8xMykAmPpPyiYAkrIANm7cWHXOs2QBSL1nFlI/7tIbPUp5Xqvevyy7fyIAkoL/pPHG98oRXhAA69 at05+/7rrrYnCUG5Bj3lwQAPlT/wsIAE5QJBAJAIGIkxsk+IcElHldRACAAID09WsxVy0BKudxCoBGFppmRgCDf0I6 J+Wk8ZsZAJrv00YCQ9wTbnpwRQyCfzcbS1MAkMAEgDw+88wzVec8o9szBEDW6yDwR9A4YsQIJwVA7aaAUSlrf7F4N9 P/a403gn5IAEEEAMZvypQp6qabbtLj7tKxjq0QAJycSGhZALfeeqsO/vG+nzlzppYAOOrVlABhCICk+dx/AdBv2NUt zQZg2ikhnQ36bOwSnUYEHe4Jv/n9X2JMCSAZARQB5bkOOBdTAOjAX4J/+RzKAOSoJ4Cjnmq9cdEAUHBqAKp2/lVGU8 ByCoA8wX+aBHjqqafiYF92/nFEmDuZHPWcw508tpQAJPQyAJlH8N5H8I+TYcxMgFAEQHJGl78CAME/F+eEhCUBkkoB itaQ24JPgn15bosAjkU5srIoACgAKoJ/s4Zn06ZNmq1bt3rd0TuqIQaKB5eq1ALAlgCmAJASDoD0fzdkTlTnGNUQAB 3o50BImeYRzAkI+KdOnVohAMyeL35KgLSyLr8EAMYPgb8JJQAh/gd/acF/UmB44oirY+xSgqTSAvm8PJoSgFkAnb8G pCSLWQAUAKlvRvkazonv0aNHwIMUlV4AFAn+TQEA5PQGc8zlSEd53r179xJP2vWOT/Zi3gz+KQJIiALAnhOAzBciDF 3L+GpUJEZRZ3u+NPv+b3bnpwAgeUo5+PfwIwBMawRofw2BvykOkoJ983XtAFN6AzD4L08GiDmWfE8HKgBIwBfe3yfi uXPnVmV/SBmH9HTAaQDgnnvu0X0gsnpB+JD9EeX4j9cP8VUCJAkACfRNKSjzgz8CQKUKwaT3vi/zgSkBZLHO9wLJSh 2nCPBDAtip+1L/n5QBYAaOcpKHHfDL5wVTALARYPnex5QAFAAkcAlgCwApAcDi/uKLL1YTJkxQkydP1syePdv7M94p AAhRiRLABg1f/RIA9c0LvtwHuEAnaQy5drbGPtWBfxu3MzryjqeUANgSQESABJHm5xlYllsCmBInz1hJbwf+HSkAiM dCQBb3EAA4GuyKK65QY8aM8boXRCiLfUIaDRIZMBLid5BQK3CkAPCvtKPWeCb1ALBr/llf7pb8SZI4ST+DUx1YwkEB QAJa7Hft2lX3gOjWrZvq0qVLkG9OBv+EEEJC2iGsFbyxJwCvExO7uSCvC3fe66a0AUk7/2jgKE0c+bejACCEEEIIIY FkAJjfwzRvQiHkjwRIey/jc3KKA0vGKAAIIYQQQkjAwQNLAQjxQ96Y/RvMryP4N4N9OTKWTWMpAAghhBBCSEBBg9QO UwAQ4n4GgHkKhKT6m8/jcoBhV/PUGAoAQgghhBASUklAkeZxhBD3yjek67+k/8vOPxDxRwFAAUAIIYQQQjxP85fPmb uG/FsR4mmQ+vcgX7IA8JwlABQAhBBCCCEkwAwABv+EhC0G+HegACCEEEIIIQGlDfNvQQghFACEEEIIIYQQQgihACCE EEIIIYQQQigACCGEEEIIIYQQQgFACCGEEEIIIYQQCgBCCCGEEEIIIYRQABBCCCGEEEIIIYQCgBBCCCGEEEIIIRQApO ykncl74oirY/h3IoQQQgghhBAKAOKBAHhox0dVEgCB/+Rlu/TXTAmQJgwIIYQQQgghhFAAEAckQNJOPz63/0NVIQHw vRADIgIoAwghhBBCCCGEAoB4gF0KIAJAsgNEBvBvRQghhBBCCCEUAMRDKYDAX7IDKAEIIYQQQgghhAKAeJ4ZAAGQ1E OAEEIIIYQQQggFAPEoC0AyAZgFQAghhBBCCCEUAMRjAYDdfwoAQgghhBBCCKEAIJ4izQApAAghhBBCCCGEAoB4HPyb AkAaASYdJUgIIYQQQgghhAKAOL77j0fzFABmARBCCCGEEEIIBQBxiDP79awZ/Mvuv/2cAoAQQgghhJCw6devXwUhBu rmfxQAxEkJEEVRVe2/WQLA4J8QQgjxbwGP+z8IdQHPa4GQ4vPGgQMHKghFAkQZ/1EAkNILAEGC/5seXKF+8/u/xKn/ EAAiARj8E0IIIX4t4s3F+8aNG4MSAa1avBPiMyeccEJFwB9aFkBU4z8KAFJ6frf2cQ0kgCkAev7zWbEE4O4/IYQQ4n /6LoAEuO222/Qinwv5gDIhGhQ/oWaQhAgCf8wPIab82/OGNz0ApPs7g70wmH5OX3XllVeqNWvWaAlgCwAJ/H2+Hmj9 mwdOiZBrhQsBQghxUwpgcQ8JwMW9Ck4CNPKz+/fvD/rez7UkcVoASP03JUAYiACYv/IlLQH6jZmpRYBIANb/kbzBvz l3TD71i9wRIISQktO1T1c9Tw8ePDies0PtBRB80NGgANizZw8FAOcU0ikB0OguPo97C4u+fT/NAgBSDmBKAN8XA6z9 a74EwOOjk0boDBMRAfz7EEJIuejWrZtauHChOnjwoHr99dfVG2+8oTZv3qwfuxzTJegSAF4f9UmA7du3UwIE8P95yi mnqEGDBqn+/fvH8rBPnz5BZgrJmDf9FIAigbh5hFvRIN78Xgb/4UkAkUa2BAC+T+a82TfO8hmXqE2LbtbB/38+OEMN HDhQDR06VBNyZ2leW4SQsgZrCPTHjx9fsfMv4GtfvvDLei4HoWUAmov6UOfxrHt30uYQBUAY68mRI0dWyELIQ0hEyE RIxZDFYdOaAObdjZfgLen89rzBfFbaP/sC+A/GFx3/8YidW2kMyDRukjf4f3P1ffq6Oeecc3Tgv2HDBnXPPfcEd/1w J4kQ4kJwBw7tdWji17DDt3btWt0LYMiQIerkk08Oeh73aS7Pu66rJQDsmn9bAISQQRqSAEDgL8F/kjSETJSvhbix0/ RTAPIE/+auv3RuNyUAqCcglEd2gg9DAJjjLG9gjjnJSvk3j5PENYPHp59+Ou4tMfDK6bq/hFxPKCvh7j8hhJQfNAN8 /vnntQQIsSmgDwLAPpoNO7TNCNKSav4lc0RkkXyctivcjmPj7LFrepDWwO9z6bq688479VgCyMGk66dXr17eSp88c0 HTSwCK1PwnZQJgV7ceASAZAbIzbEsAZgX4GdCBYcOGVUiB8MaZgVsWl112WUW9PxaJAiZ+7PpDAOARwf/+P3ykP4/g X3pL+HV9RAblFQCcswkhWTvCNocffnhMqOncrgf/clY7PkbDR6RpY6c2KfOj0Zp/PCIdXD7G78Dv2rlzp/7dtf597R i/Zo+n/VpJH9cSAC5cXwj8ZZ3HuaBN2SX1LvSaIQHs3WHzUaQAF5R+geB/woQJAfeDiLwXAI00CsWNHUG/CEE8//GP f6yuv/76CgkgINhHSQmQz/khAdIEQFTqcWcmFyEkaXG/fv169c4776jf/va36s0339SgBEDKAEQEhLC750tzQDvAxt ihVjtp174VAkA+99ZbbyVeN/h3IYug3QKgmTu3tQRA1uu7dF1NnDgxBhkeadLQ/lpo2UBNzS5pdLEnAkAW7I0GDWaZ AXeU/AQCALVdMr4I8kKTAJHnAkAEYZGxRbdXYO7+41oBEABXX311LACkgaQE+2+sulftXj5f/fd/PBaLAT/kUOSUAG A5FyFh7vDXkwlwyIBDNJAAIgRYChA5Ne6mAEC39qQAHfKnWQJg9+7dVa+PIB+/O0kAbNmypaVlAHaX9k4JgKzPl/ma kqAfkkjEoPDYY4+pdevW6etHmgHiEdeE4LoIiBr8r+MCwAzYm7WI5ALS35o/Cf5FHoU11n4H//b8UEQAYBI3JQCuE5 QD3H///bEAEGn0m9//JQYnSuBn3/7pIvXigokOC4BKCRA5tPufVgbAeZyQsFL8+fcIa9w3btxYkQFg1//jOTI/6rk2 5PVwklSWANi7d69eNyQJgBUrVrRNALQqAyDP67sqAACCfUiAAQMGaNJ2/5OA/LGbRYYkAOsd36hZi3zu+JCiZQBJ2R 7sAeBH4F9v8IegHz8zduxYfTOXLsAAEsCebxDkS92/SIBfPvQ9DxahlRIgYt8IQojn9OzZUx155JGqy+ldNIee3jXI LACXJQCe4+g2O0BH2Ue9AmDfvn0VAmDr1q1Vr79jxw59Zrwd/K9atarlTQCTsgDKIABCaRZM+diBDADu8JBmSYAwSz 0iL4P/eo/7NBv/iQRAulda81GzRMiWAH5cD35kirCMixCSlxtuuEGDUgAEbwMHDgy6FMCF4A33XJRtSHmeeYSbfB07 vI1kAPTo0SP+eNu2bVXHAErnePNnUSs+b948CgCHBABEj4Axl+ehBPnt7AsS8YZDOoWkdodbNxx5KwGSPq41ztdcc0 3c/M8M7s2jRs2yEfvkEFMCUAiVTQj9f5QAhJBCImDatGmqy4ld1IknnhhsT4BGg8d2lnZK74Yux3SpCMgbFQDYCDAz AFavXh0fA4hH1IgfO/zYUmVv5Anam/Havu7w4z3va81/o30BKACIFxkAkACvvPJKHCiEVQoQqRCaAeY97tPMAJBrwe 4xYn7OPCXEj+7/keNj/f/FVO7+/3+UAIQE2hOAf4sw+fKFX9ZZHBADONkBz9HssVEBgNcwBQAkw8qVK+OPfanrLioA fJQAPtf8l6FUiAKAlCJI5JGPfo+vWd+fddynHAFoBvn2br8tCOT1WQfWeQEw4V/+fxUCwJQALAUgaPIUfM0lrwMSAC jdQEbA888/35AAALt27UoVAHjE7ymbAGh2t/YQBQBr/h3oAUBIK+vGiX/jndQAUoJ5TOpJ6f9mCUC4fSPKHfzLTn/a e7yRY2KJHwIAqcD1/jx+FqmhAK/lWmp4swKBEBf9xD0BMGTIEB2cQwDgERKgntcyTwFAoJ8kAMoWDDYzfTsr4Oc8QC gAiPNBIU+SCFv8mGMvdtdsAMgTR8qd4WGn/6eNN/9mYXHnnXfqBbyc89xIFgAEwBFHHKEDf5wP7YIAaMVOIAUAcQEJ zvEcEkDkH057KPI6L7/8cvwzZvAvv6OsO8FpgXojx7w1s7cAoQDgH4KUKpAgHHNTAhx66KHxDZ67/m6KO5b5hMnIkS N10I86YNn9xxnP+Jrs6OUFwT5+Xn5OJID5u1wI/hsNAhgIEBeRMgA8x1GPaPJYRADgZ/B86dKlpaz3bySIb+XPEtIy AYCFubtNtwghhLRDADD4pwBoVAAg4Jefw+vg41GjRumPzz33XP27QhMADAyIK3Xb8SkBp3cpJABwHKQE/WWs9y8UcN Uh7Pg+J6XNABAJAPB88qlf1PAPTAghfgf/eUsymL3hLwjwDxw4kBj8y1FgWLSbR4EhkC+Swo+fw3FftgCQkoKxY8fq 39eJc+PznMFd65gw1gIT3zEFALIB8kqAJ598skIAuNr8rd73v2tHQpLASgCSjmpYPuOSGAgBdmwkhBC/BAB39sOmX7 9+OviHBJDPIehHMG52arbPAu/Ro0f8PXnXGOvXr684DxyvZx4HhtezSwEgBtq1y19rcd9MAVBLCHS6NICdukkah57e Ve/qT5s2reb3djmxi3riiSec3fUvIg2b8b2EdKQHACb6fsM+P+rLFgL8gxNCiD8CIOk4xmYGlmH/jSOnBIA5XoMGDV KbN2+uuO/jOXbszQwAnO9dRAAgwIc4SBIKss4wsw4E+9/nkwAoko3QbgGAs7pxZnfaed611oYI/oDLKd9NO6/bs/kN mToY2zwCYNmyZd7FEEVLALjmIKUXAHbXbgb+hBDidwaAWQrQLBEw7Piu/Ds7GPyD/v37V+3uSwq/KQCKZgCYx4HZQk E+B/EAAZHn39mK4L/MAqATEgBs3749BmO4b98+/QgBBHDOOz5GszeA3WGkfWPn14fgL2rwP1/njzwlQGXu8t8OCcDg n9lFTgiApFIA/pEJISQcCZCWDWCK4TyNY+ePPZtZACW/h6YF1oMHD67a3ZcUfnPHHgFhEQFgfr/9eqYkgIDI+2/tlA CoZ3Gf5+ezfnenAkpzTQiBA5DJIc8FHPWGbu8I+gQfd34Z/BOSLoVAVsYQsoqQXeRjjJnnfd/UzCJCCCGkXgEgR/zZ JQE20i8A9eJmzXh4AiDKGdy7KQCwMDt48GBicN5MAZCUZWD/3k4IgKzgvB0CoOi/lbtyhJBOgnIuAZldyBaD4MUcD8 wsIh/nmU5IQQoAQgghDQkAkQAiAsxsADMrwOwNs+WRmcwA8FQA9OnTRy1cuFCNHz9e9erVKw4QzayAZggA8/Xwe/D7 8Hvx+8uQAVArZb+ZAqDWIrEdAiBvzb/JIQMO0WC3f/Xq1fqcd3R6l47xodT8c/efhL7zf8QRR1RlBUmmkO+CsROZQB QAhBBCmiIB7AwA+VgyAPB5Cf4fnjlBjR49OjX4Rw8A3wVA7Rt7+Rc7GKOkcerWrVvFDj0CvKQdewkYawWX9vdJBoA0 iJOP8XuL/DtbFfTV0xiw6LVS5GjBdgSVaTX/Uuu/e/duzdatW9W2bdt0wG/iS+p/1IT/eG8hIab+h5p91JEeLbzwCC GENCoBJMA30/0lKwCIJDAFgDR0CzH4rx38uR8E2McA2jv+smucRwDY35eUEVD2BWArBECZxx1IMJ+EGfD7dsxbnjFi 0E/Ip0ycOFGn/kMCDBgwQJM3i8iHngCNSMB65w8KAEIIIU2VABL8m03/RArgOQL8NAHQqp1ad4KDyIvgv1YKf5IkyC MSar2e2xkfnX09QgjpZAYAJIBg9gSQfgDIJPKxJ0AnsoUoAAghhDRdBNgnASDwB5AAEACCXQYgkiCUv1coQVyzA3YK gPJfO7IwP7TXoYlfw67/Kaec4n0WAOv+CcnPqFGjdEZAWvaQ/Xmf54VWzvsUAIQQQtqGiAAE/7h5d+kSJX6dfys/JU Cemv92vY7LEsCFYFH6MqA5Y9JCHp2+V65cGTf9C+1YLwb/hJCO3osIIYQQQlodEDajVrNZr0MB0HrQlHHnzp3qrbfe 0tJm7969aseOHVoMHDv8WC+a/tWb2ttI/S4hPjJy5Eh17rnnqrFjx+rsIHtewGkvIZ0G0Mp5nwKAEEIIIW1NC+/0a5 D20bXPp9k+gwcPVv3791eDBg3Si/sQd9y4409INpCDgp01hGwi+zSZkEoAmjl3UAAQQgghhBBCCOk4AwcO1NkACPY3 b96sHw8ePKgWLlyYetRraNlDFACEEEIIIYQQQrwBmULIGELmEHb9+/TpE2zWEEsACCGEEEIIIYQQQgFACCGEEELKSb 9+/YI78q9VdbyEEEIBQAghhBBCShPs26xatUrNmzePdby8PghJBScBBB+gUwAQQgghhBDXBMCBAwf0EYBbtmxRK1as iEUABQCvD0KywNwRylzR7mwhCgBCCCGEENKWLIBQF/EM/AmpTyCGOofwFABCCCGEEEIIIcFJACE0iUgBQAghhBBCCC EkyCyikEsBeAwgIYQQQgghhBBCKAAIIYQQQgghhBBCAUAIIYQQQghpkGOOOUYT7N/g84iKEAoAQgghhBBCiN8CAEc8 BisBKqMqQigACCGEEEIIIf4KgA8++EA999xzYUqA6siKEAoAQggpNClFkYZ/C0IIIYQCgAKAEAoAQojnAmD//v1BS4 CIiwhCCCGOSYDHHnuMEoD3b0IBQAghxQXAnj17KAB4LRBCCHFIAKxcuTJMCZB8IyeEAoAQQopIgO3bt1MC8FoghBDi UBlAkBIg/UZOCAUAIYTkqfmnAKAAIIQQQgngdhYA7+OEAoAQEkDw3oyaf1sA+N4YMCnYpwAghBDisgA44YQTKAB4bR AKAOIy/fr104TapT367D9eC5/SrVs39cYbbzRFANg1/3iO1z755JMrPsbv9PF6SBMA5udDuf5knhFCnWc43xBCXBMA r7/+ergSIH2Rw+uDUAAQdxflBw4ciNm4cWNQIiBK+C9UAYTnffv2UQsXLlTjx49XvXv3anrNPx6xkJCP8Tvwu3bu3K l/d9a/rR0Bf/Q340r4uDUSoCL4/9j4fX+LWiojOn19mfMMCEUCRBn/8R5EygwCvKB2eqtgkJckAIKTANmLHM4VhAKA uL8rByABbrvttiAm9qjGf6EIIAnGEJgfPHgwcde+FQJAPvfWW28lSif739fK8W9V2n6WAKj1+q5fi5hDzIA/tCyA0O cX4r4AwHs3XAkQ6fiOQV5yFgC4/vrrKQF4fRAKAOJLUIgJHRIg1DdPqAJg8ODBiQH6+vXrmyYAdu/eXfX6KBXA7076 9+Fr7RIAaePeDgGQ9XlXr0UJHkJM+Q9tLiH+Bf8I8MIVABEFQI4sgGAkQO3FDucNQgFA3AFp1wjAEHxJ6n9IfQAk7T rUBTrG2s4AsOv/8fydd96p67qQ1+vbt2+mANi7d6/q379/ogDYsmVLSwPIdmQA5Hl9HwUAIYQCgALALwnw3nvvVZUC hJEJQAmQh+OOO07D0iEKAFJS0HgN9d5I+cakjkBt8+bN+jGEI14yk3M/iYIRACj5MAUArgE7QP/tb39btwDYt29fhQ DYunVr1evv2LFDDRo0KFEArFixggKAAoAQ0gEBgLUBBQDnX1MAvP3221rMiwQQAeC/BMi16KEA+HvwD3EYrgTo7LxB AUBy7cyiAZu58y/ga5dfeokaOHCgxmcBkPa1P/3pT0EEX6YEMDMAzLT9N998s6EMgB49esQfb9u2reoYQHzPKaecUh X8r1q1qi3p43YZQBkEgE/BP8YWggdZHpJt1KdPnyBLAbKuM0LKJADuvPPOgLMAIkqAhGsCoCzv/fffrxAAtgTIg7PX RC4JkIfy/r92795dE6wA+PzmTQFA/Av6QFKnd3weC/a1a9fqPgBDhgyJj23z7u/wcZQ7O8Dna8Fs+gjLbwbkjQoA7B iYGQCrV6+Oryc8rlu3Tp3/zRFVP4uvzZs3r/0C4JN8jQEbEQB2zwHIJl93/0eOHFmRXYTrAVlHyD4q0/GPnco24v2I lDHQu+iiiwIWAFHwAiApYB8xYoReH0AAoAxAsgBEAMydO7dCAsjzNMotB1KC9vyLnwbpvADAuq8eESACAHOHsxKg+i ZepwCIKACImzeA559/XgeHITYEDGmhbjd9RPYHBBA+f/jhh+vnAwYMaFgA4DVMAQDJgJtEpwWTPcZm9of898knnzT8 2niNJAHg4/WFwF+C/6QsI2Qf2f0mfJ1HimYglWHnp97dH+epe9FXrlRtk0YEgJMSoKHFe3Lw57sEsANwjD8YM2ZMzB lnnFEhAFAKgPI9EQAzZ87U8zqCe2wcSaA/Y8aMQuCaa78MyBmYt00AdFYGiAC4/fbb1eOPP17ofiCnh2DemDZtmpsS IPmmXacAiCgASLmzAWwQ+AlB/l0C3qVD2QeEAARQIwIA7Nq1K1UA4BG/p2wZJkk7tRQA+cECDsG9ZJIkBfm9evXytu loHnlY1jGXhZ/s/gQtABx9XyJIw+4sOraDojIAC3gEfLNnz/ZDABQez3AEgATZ0tEfiPgBuAZmzZql+da3vhULgE2b NqnFixdrRBBcd911WgBcccUVWv6aWQBmcJ+GXGcmrb/mCgbjqrUSoPrXRR2/F8yfP7+QBBABgDEdNWqUP1kABeYPCg DiBFik45g3dHpHszdZ/CHokzIAEQEhLNaZrvupAIDBl7HHI66Feq8vEQAI9JMEQNmuq2aOf1bA7+t1hTF3t86T8hAL Pez8mCmgQcmAhoLH8kgAqdEWEWDLgDQhIAIAQd/999/vnwSoOaZRMBJAgjUBGXu2CMA1ACZPnhz3ALjvvvvUX//6V/ XnP/85vrbOO+88NXr0aC0BACQA7vEQAHId1Qr8218KkBZ015YAVZ9uQAKk/+5yCOEiEsAUACgbufjiiwOTAFFHx5IC gDScCYDdWoDAT4SAWSvuO9itNXdsP1/QhyECJDjHc0gAXAN43rNnz0Kv8/LLL8c/Ywb/8jvKKpXSAvWiQV1WwO+rVJ o4cWKMjHES9tdCKgEoexYAFntY9IkQDiojoOEd5HKVAiA9G0GWKQMQ6IEkEeCFACgiAarGNRwBkJT+L8F4kghAMH/a aafp4P9LX/pSBXJt4esXXHCB/l5TANgSQF7fDPzL0vOhlghICvoTRUDO4L+sjQFFAPz85z9X9957r3rhhRcy7wNm+j /GeNy4cWr48OF+CYDM+0CUce1QABBCHEPKAPD8yCOPVDfccEMhAYCfwfOlS5c62VCykV37EHb87cAfGQBm4AgQhKDh I7KNpBkgHrdv3x7jiwiI6vyvrBIAiz9Qb1Mo7ySAgyLAlABZIkCavaHeGynf2PVNkgCn9u7ulwiIigZrfvcEShMBIg FEALw3/8uxAJDnpgQQASA/m7XrX56/QW0RUJEMYM4Jn4mAPNdV9eurUgsA3A/uuusufZRz2n3AFAAoH8HYQwBce+21 /vQCyLwPRDXkEQUAcQzs4CKI63J6F83pp58eZEqvmR0QWnaIZANg/IsIABzlJ0F/Gev969nJpQBIB4sFSADJIErb/U 8CqaX79+93WgI088SIskgA7PzgEbs/e/fuVa+++qo69thjKQEclQBZIgALeLNEQOq40yQAuHDQUR6VBNQWA6GcCpAk AiSAR4CP68bOAhAwj0MiSSaAKQDsXf/p5/QtqVDKFgFRxnWVJ4PAheMATQmA+R8CQO4HS5YsqZAAZvCPsUYGEcYeJQ DOCoBC94EoRwkJBQBxEAR9ADvBCOpQJx5qXW+IzQFNAYBrIK8EePLJJysEgKvBXdpRfkUFAOeSfGVI/HuUZ/EnCz8g IkAkgPfZAHXXkZdXAtjZAEC6ukPC2SDYkyDODN6Wz7hErVk4ST86kRFQ/8SkQj4W0BQBIpCkFACBPh7N4F/kAARAre D/J3OuVovGnV3y6ydKDe7SJECUq5Qkcuo+APmL+f+OO+5Q06dPV3PmzFGLFi3SX8O9wFsBUCCLiAKAeC8CcLRHlxO7 qBNPPDG8ICXwgA7ZHxBAuAZqfS+ukSeeeMLZXf+03hD1CoCQQONHoUePHvHzUIJ8nxqJYoGHtE/s/GDxh0XgsmXL9O c2b95MCeCYBMBCPSkbACcHvP/++1oGAHR6l2ZvQESAGcRhI2Do0KEaN97TCbv8NUjaAZaPQ9oQsLMBRAK89tpr+lFE AB5R0jVs2LCK7BH5WVwneK2XH5iugQQobxZAdXp34rWQQwBUXnqRc/cASF/IX1MCgIceekj94Ac/0N8jc4otACZNmu S/AFAUAIQQz8GiD8F9HgGAQMG3YK9oCUDI1wokoe81//X2A3BtAYiFHxZ8pgT42c9+pn79619TAjg2nmkSQEQAsgFw xJvZ7E1qu0UC4Ax4vM6GDRvUPffc49h7uVjwn0cChJChlZQNgDR/zOcIAnF9QPpL8C8lAyKMZM4/s19P9c6zi3XwDy AC3OgrkbzTazYATM0UcPxeh11+SADM+yIBbrnlFr0piCMekRGA+4A0fDQFQDBZAKrz/UMoAAghLQ/san1Pmbv8t0MC MOW/OrXft5r/ZvYWKbsAQM0nFnmmBMDuz6OPPqpeeeUVvUAUkl5j2PFdY5wb88K7xW5IAAnmbQmA4B4CAMe8mQ3eJO XbFABr1qxRA6+cruavfMk7CRDv7iYEd6YACGG+QoA++dQv6mAd447xByIBEPTj+vjwww8rav9xPeH7L7vsMn19QBZB AACUj2xbMsshAVA7GyBNFPlQNoK5HZlfIgFQFjZ16lR18803694/l156qfrKV76ijj76aD3+pgCYMmWK2wKgQQlAAU AIIYSw5t/JUgDUfEIAYOcHi78f/vCHWgCg4zMWgOeff74uC7AlAIL+1bPHxlAClEsCSG8AExwFaDd6k5RvBHgI/JDV g9dA8L//Dx85+F7OKQBS0nxD6weAIF3S9iUbANeA2RtAMIN/XBeQBXi88sorNSgbQTYh+kgsvfEC/drOCaQob73/55 ea65lgmN+R+QX5i/kfwT9AJgDuAZgbzjnnnFgC4J7gRRlA0T4iFACEEEII8UUCYOGHxZ7s/CD4FwGQJAFE8vz3fzym 035/v/FfKQFKKAFsEZAkAMwab5EAkgmAOm7gntQrJgBClgAiALBrj917jLeZDYDrRWQAOsebaf8AAT8yAJA1gtIRSA C8Dk6SwPWGVHIXr5+kMpG06yJdALiRJYB7AMq+IH5F/ooEwPwPuXPFFVfEEgD3A7Bw4UL3BUADEoACgBBCCCHOpoCi 1hcLdVn02Ys/YEoAk13L7lK7l8/XAmDw4MFq9OjRbi34C3xzYvBY0hIQUwLMnTtXzZw5U1133XXqvPPO00Gded47BA CuAaR8mwIAY/vGqnv1+EL2eCUBrLEMWQBgtx679tIAEu93yQYAuF7effddnQ6Ojz/a8RP1Xy8tUbO/+U9q4Elf1dki KBmBCMDPo6wArwsBgOsPcwtqyMt+/VQG8dVlALWui3QBUH4RAAmAsi+RvzL/yz0AY49d/5NOOimWAMge80IA1CkBnB YAGFgugAghhJDwkAU+Fn/oBYA1ATIB7MWfKQGwQ4TAH7uBwBYCABJARIALKb/1SIC0s8TL1ETOlADjx4/XYFzSsgBQ 743vxdfxs//54Ay1Z8UC9fZPF6kXF0z0phygVhZAaGUA2K3Hrj2Cd+ziYzcfwTyEgNkoEHTt2lXdfPbx+tqAIELGAE pFpF8EQPBvlg5AALggAWrv5BcJ5CPVqa7xjchgmfft+R8C4KKLLlLDhw/X9wuIANwP7r77bkqAFo9rywQAbuD1/jx+ Fo3DAF7LxSPkGrlJ2xMFG4QRQghxJfA3jwDDog6LvKTFH8DiD5x66qnq+OOP1x2gv//978ciQDDPBC/vYj9hZ694w4 uq16iWAuXKBEAaLySAnOsugb90ekezN2kiKBIAgT9KO3750Pcc7e2RTwLkTff2NQsAu/YQADrw/6wBJHb3scuP3X7s +kuAj+sBYgjZIWaJCMCxcjt37ow7xwMRAGWXAM0Qd1lisOwSAAIAQb099+O+UEsA4Gdd7/9T6D6QcFpE6QUAmnigwQ cGWB4bEQBHHHGEDvxRX+aCAGhmwF6WY6DYeIsQQogJFmUm5i6eGfib5zyj2zPqwNMWf0gRhwDo37+/OvPMM/UCEBLA fB05U94UAaBju/spjbwSF+l11oLme/3Oyp4hQ4aokSNHagGAMZYdfwT6csa7dHrHGCLl2673dlYApIxvlBGwhdgMUM ZYGkAiuMcuP3b7sev/t33r9dd/t/ZxnRWC0hB8jCNhkRaO1znssMP05yAB0Fxy3bp1mqeeekrzwAMPOFEOUDhwjP9/ olrTQ2mvKwTxKPPCvG7fAzD/Y/6wBcCCBQtiAQDBCFydKwrJ4JTjIqOyCgAMnnR4ld3/AQMG6K/17du30Gsh2MfPy8 +JBDB/l0sCoGjwnrT730kBgBs5juBKO56r1hsS57sDHPPm5ATcpL8/szgIIb4IAAnEbcyg3wSLeDR6wiJOAn9Z/KUJ ACwQZYdZXscWAbYMaI8UiGoswFO/2LAASK8dbv9OoJkBgOdYm+E5gv0zzjhDI2e8S6d3rO2k3hufu+aaa+KFvdMCIM o3huljFsbcIetFCADs8mO3Xxp8AmSDIDNE+kKYAuALX/hCTNo6FBLAVwEQqdryqMzNRG0JIHO/KQAwtiIAEPfhXoNj BGV8cbwsKBKDOCcB7KNDE7NAOiAAxPC3WgBg4OXn8Dr4eNSoUfrjc889V/+usgWDrRIASa/XzmBS3lww+QL+/vv27d OPmKDBrl279Mcvv/yyZtWqVerJJ5/U6X/yBnZ6Im7wPwYOhBDfsgAkIEdwJ6DR06xZsypAsCcSAA2fzIWfLP5sATBu 3LiK4DENW0K0Jysgqo8mCYA0GdDOXUBTAABIfkF2/M2xk2PepN7bqwyAnOMUYtCftq7ELj92+7HrnxTQIQMI60o8P/ vss9X8+fNjbrzxRt14Ep83rx+/Mlaj1OMAXV1bmhJAxC/A/G8LgMcff1zfY5BRZEoAUwSYQsCbTICE+aKWX2y5AOjX r1/izVWC/1NOOUV/jMkfAkAGBIF8kRR+/BzSemwBICUFY8eO1b8PTUTMn8Pn2xUA1gr+Gw3Y6xEArZ4IzDcfxgb06N Ejfi707NlTHXnkkRWLAd9KCBj8E8JyJPKpCJg2bZoW9CNGjKgI2pOABMACTxZ8JubiD0jap93wywS7ybfeemtM+0sC miwBombQ3h4AGIeksUbQj6wN+4x31Hwj7Rs7vwj+nO4BUDj455wh8zl2+bHbb48/nqNr/LPPPqslwNq1az8tH/h74P /ggw/qR0hFCIApU6aoyy+/PBYBPu38RwUkgEvrTEgANHyF8DUx53+IYlMAQBKIBDBLAVwK/mNUerPQLGEYVcw7zcn4 KCwA8CifQ9CPYNw2cKYAQJAo35N3Yli/fn0sAOT1JIVcfmdSKYD972u1AMgTjDdLAOQpCWh0IuAimxDSbqTha1aJEc qQUI7k49yUZ94u8yJPsgGwsy/BPJ7bSGAPCYBaT0HSes3FH46UQ3D/7W9/W+8U4RGfT6Lz960mSYCSB/xZAkCasEnA bwb/snEkY4TGb0mnADh5EgCD/5asN+XzEAHIMDKzABAYigC46aabKgSAb2tYc7rwSQAANHxFxpdgzv9AmgB+/etf14 LAlADOBv9Zu/81M4aqywHaUgKQFPyDQYMG6XQO295hx97MAECKeBEBgAAf4iBJKMjgm1kHtf6drdr9b6cAyLMgbHQy KFLzb4IsDQBJs3r1arV06VJ12223aUKo+f/kk0803P0nJD9mh3fcM5D5BfmLuR2YZUc+iknfsohEBKCLvzBp0qRECY DFno25+EvCbB4F8Dn8PqwxynFtRB2hU9eHLQAk6DdFgAT/l112mdqxY4ceJ3R/RwM41IAjDVzqvRHsufUeL5b2nyf5 g/eFaglw6KGHVgkAPCLwx/WH978IAPO5r6I46x5R9vsFsn7kqFfcH1DuJdjz/yOPPKLnd8kQOOuss2IBsHHjRnfHWE U5TnPIFgBRE6+pugUArI29uy8p/KYAKJoBgO83MwBMoSCfg3iAgMj7bw1BADRLAiTV/Eut/+7duzVbt25V27Zt0wG/ iS+p/1ET/uNNnJDsnX+c9mKXEUlpke8ZSb7OH/YpAVjoIVUXMmDhwoVq0aJFsQgwMRd/8+bNUxMmTKjAfl2AQGDmzJ klW/Rn1+jnXfzl+ZlOXi+mAEjqzSDNGs33MUo3cQQcmsCZx7wh1Rsp32693/MKgGL13iQdvM/nzJmjrxcIAAn4bQEQ ogRoxvq/1cH/6tljYwGAMbTvAcj8kvlfysuwkYjdfwgAMwvgmWeecXN9kEMAmOUfaaUAHc8AGDx4cNXuvqTwmzv2so OTNwA1v99+PVMSQECUXQDUU5+f5+dbJQCS0rMkmE/CDPhd7fRfdDyyJmTepAkplvofarlSKHNGUuCO9E6Ao54g+LGr B/A52fmxQWkB7uujR4/WzYCxYJTa4O9+97slbgSWL8AvIgjM9P8yCgA7+McZ8MjawKMcBSdd3qWJMAICt7IAigX/iW vIlHpvki0BvvOd76gXXnghzgzAcwn+IQbQj8R7cWx+7MBaVATAO88urpAAmBfQO0ZOiIEAEOEr88fTTz+tQfAv8SDm HncbjGdLgCih1r+6gixqTw+AtKAaf/iDBw8mBufNFABJWQb27+2EAMgKztshAIr+WwkhpCygsSuCP0gAKSPKW3bkS0 +Aeudq37IEbLDzg7GF5L/qqqtU7969dWd53NflBAFIAHwPgn+kiOJ7JCAo/3URZe/s51woJt3z23VdpAkACf6l4/+Z /XpqsNBfs2aNGnjldC0BMEboBwHwHM3e8LNI+XZdAFSOWdZ71hhHlgEUFsDyXDLGEPxLuRFOmgjm75GQAVC2+4MIgN 9v/NdYAOD9Lk1DIQCk14sIAMz/djag3BfwM3jctGmTk/1D8gmAtD4v9WQZNdgE0A6q+/Tpo1P6xo8fr3r16hW/Gc2s gGYIAPP18Hvw+/B78fvz/DtbtVBLe7O1UgDUeoM3+40vb7jevXslfg27/ujF4H0WwMe1hQvFCyHFMwAgAQSzJ4D0A8 D872NPgNDLi6QZFHZx0OkZSMMnpH3Kwv7222+PBYAtASQLAEydOtWtOuDPnmQ3e8pTL5ocBLRLApgCwA7+X35gut7x gwAYOnSo2rBhg84CsN+/dhM3l/sAJAX/9WwkkeJrVewoI3jETvJhhx0W3t+gxPcJjI9dBmAKAIA53RQAkL+Y/wGCfd wjzO/3XQDkyQpriwBIo1u3bhU79AgAk3bspbFcrQvE/j7JAJDAUj7G7y3jDk6jE3yeoL6db275e0O6JO3Eod8D3sTS 9C+0Lt0M/glpHBwjh4yAtHIj+/O+7+SEECCYRzpBAqC+Uxo+4TlSPvE1EQAXXnihBs8RXCIDwCwFMI+pdSUFuLKeM6 vhU6TyngRQFgHwkzlXawGAx+UzLtH1/5AAAGODtG0EaTgBQs53l/ptPwRAdnZmvMjnJkJTwIkiEACTJ0/W80pZYoRO CuUyzvlmI0DMF9IwFAG9nQGAuV5AiRgCfsz5EAFyegD6kbkne4pmAEQ1ssWizgiApHQce8dfusvnEQD29yVlBJT9xt 4KAdDJ/x9MpDt37lRvvfWWFjR79+7VHX0hBs7/5ggvmv7Vu1P3pz/9iTdtQghpQACYEgDNnoAIACzysPjDIhDPzWwA UwKICHBRACQF+sWyADrTE8AUAGbwjwZ/i8adrYN/sG3JLLVm4SQtAiaf+kV1au/uek2BMRIBIGe8iwhwUQAUWYybgo cSoDnzyf+fvTcPtqsq8/d3IAQwQKkgAokRQgdxCAVIQTFqYhQRlSkyQ4gMMjVBaAKUCSnBgUkkQMOvqQQhsb+tlAxf BIJ0JwSpREgREJCgJUN/+aPtaqmy2i7/sSn3z8+S97DOvnufs89w791rraeop86507nhrn3WXu+z3vddyi6RANhss8 3S/BsEcP1onCQANFf4AkDziJ32YvX/Ns+b+L3//vtbgf+yZcvyBx980I21nRoXiwB4dw6plgAjMwPGSQB0SuEvkwR1 REK31wtxF6cpr9cPU6dOcWOgxo968+kEhuIxjFFPrP/b/BorgBCZPXu2C+Lmzp3r5pTiXK+yrxR2/lNMD/bPczYJYC LAGjzZbo8Wf7pGdGSUvzPkc/3117ufCakJWFECjGwIl9WWANkYXzO+APBT/xXgC4kAZQGIO77214X8jG3d57Xbp4W/ JICfAWDNINXpPQwJ0D31v9PPdcoCYH3RG7qOTADoOen/zZ73NU+YBKgSACr3MgGge4Dmfx0zrvEVYa8Juvd36aXEqN ECoCmvhwAAAGgWyiYyiun/Kj/q5SjZGAVArPcAXwAUswH8bs8SRFoAavF38803t7j88stbfO9732v9vJqBhScAshIR MDLI7Hx6wPgIAH/33/+6iQDjuOOOc5gAeOaZZ9w4fe1rX8svueQSh0SAUrnV6T2EZo697f5XCxsEwHAkQIrBf2j3ir oCQD0BJAFM8Er+at6PYy0wiAAYYmw5GoNbp+Z/rF4nZAnATQAAUkA1wsoGULC/evVq96jTXtTwNaV6ztSCgWIWwKpV q0Z0e7YsANv1qcKOAQtJAJSXAlTXmDcpBdgEQFnwXzbO+l5r4CUBoB5C+vypp57awsbPjnkLQQDUT/3vQQBwT4DISz ZMApQJAElfa/aq71MmgCRAPAKg1/KugATAMI5oGtbrIAAAAMJAZQAqMVLAp7m/7LSXlOo4Y78H+ALAHn/4wx+O6Pas ms9uu3uq/zfC+huUPfZeXz4eAsBP/68z1lroGyYAJG7OPPPM/Nxzz3XjbUd/hVIC0FsjrnoCgHsBxE6ZABASAOrpYh JAjwiAQARA3Zr/sXgNGD2UmhPrsX8xpVsBADRdAFjwb59TGYA1fBJq+BRto9kRO/95h6aAzVzE1xUA2vk3AfCDH/yg rWxD2DGOQRzlOGIR358AQAJA6gJARzda8K8yIJsXTAQICQCVe8UuANrf+wEKAIgv2C+yYsWKfNGiRUmn5XKTBgAYTg ZAUf7rjGeho55i7uyddREDgxz11CQBUJQAvgCwoN9QCUAYmRz9HMVVQwCQAQoJSYCLLrqodYrLggULnAT46le/2iYB 4hMAI+eP8vgCAQDjLAD0JlVPhjVr1uTLly9viQAEANcHwKCow2/SgXCic0mnTD/7ms55Du+op+Gnmjd1AV83+C9KAD u1wR9rw8oAhM54tyMD4xmbzot5fz5IpRwIEAAmAxX877PPPm2ZACkIgOpSLgQANCgLINWUfwJ/gNFBC4EU5xbKiiBF 8VMmAayHgzV01IkAQke8ibi6vI9c0Gc1/uP6gVgFgC8DFfCfddZZbQLATnuJWQCUrwcQAAAAEHmmUaqykQU/pJj94S /8rQRAwf+RRx6Zn3baae5sdyP2Y94QAJCiACjLIipmBZks1PwQWqPXYZQQZUPeKEAAAABA4ySAkVpGAAt+SF0IaIE/ a9YsJwDUHOyYY45xPSBSOeOd4B9SEgBVwb8F+obfMDQmAVAV/Fe99xEAAAAQfblRyqUALPghZREwceJE1/9h0qRJzA NcF5CwDDT800KQgQgAAAAAAAAAiLBMqFgyBAgAAAAAAAAAAEAAAAAAAAAAAAACAAAAAAAAAAABAAAAAAAAAAAIAAAA AAAAAABAAAAAAAAAAAAAAgAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAAAACAAAAAAAGAA9jv9m/wdAA AQAAAAAAAQe/B/47o/IQEAABAAAAAAAEAGAAAAIAAAAAAAAAAAAAEAAAAAAPFlC/jwNwEAQAAAAAAAQGQBvz7eY9YJ +fw7N+Sb3srdoz4W/K0AABAAAAAAABBw8K8gX00C9ehLAKHP29eQAAAACAAAAAAAiCgDwMeyAYqCAAAAEAAAAAAAEK Eg8DMBkAAAAAgAAAAAAIi4TMB6AiAAAAAQAAAAAAAQcY8ACQDLBEACAAAgAAAAAAAgcgFAFgAAAAIAAAAAACLDmgCa BEAAAAAgAAAAAAAg0t1//yQA0v8BABAAAAAAABAY+0/brpYAsB1/PxMACQAAgAAAgAjYfvvtHcn+Dd6dcQEAkpQAWZ Y5/Pp/g5MAAAAQAAAQmQBYs2ZNuhKgfdaFLuy4446OdP8G2Ts0J2Wb6xJ6FQCGBf/n3rA8/+Xv/mdEA0BrAsh1BgCA AACAiATAG2+8kf/4xz9OUwKMnHmhgt133z1/9dVXExYAmYv9myIALFgbreCMoC9e3nzoVockgC8AtvvoAa3rihMAAA AQAJDwol+w44cAQACEzdZbb+1IVgAMPMbNEwCjFaCNtlyA8eWCg6fmxx57bP7AAw84CVAmAAw1BIx1kZ0hfYf/d834 mwI0SgDY4m+QBSCpvunu+qUrAZq16B9NCXDLLbcgASKeHzT3v/TSS33fB2wuOPvss8OUAAOPsz8XNEcC+EG6fTxo4I 4AiB8TAIvvetBJgGnHLXAiwCTAMK4jBEBazN/n/Q7rKcHfBKAhAkCLP1sAssjnIqu76L/rrrsSlgBZ9BLABIDGOUkJ UD4DRysALrvssvzWW2/t6T5gwb+ukWgEQE/jXAz+m3eNFLu263GQ16H2O26mTv1bFoCwcgCTAClcA5n3H9fDYCy78E stbj5jlsswMRHA3wegASUAWvBp8efvAiUlA6r/2oAASF4AqAwgSQmQ0LxgEmDx4sU9SQATAFdccUU+Z86c/Mgjj0xM ApQJgGZKAGvgNqgE8Lu/IwLilgAK2MokQOwSCAEwnOD/sWvPc/zrDRfm06dPzw866CBHigIAsQSNFQBa9GnxZ9kASW UEdP6LQwcB8PzzzyMAEukFgARoFTMiAUoEwKxZs8IVAH1LgDAEQLE3gMmAfkoK/NehHCBe7EQASQBhjQEpA4FO84Qf /L+08lvuujn44INd4P/oo4/mV199dXICICv8x7UCjREARQnw05/+1DFIXWhUEoA3bOnCX4v+dLMAsmSzAJIa6wQFgO b+a665Jr/vvvs6zv1++r/mghNPPDE/7LDD8lNOOSWeLICOc39V8N9sCeCXA9SVAH5TQb8bPIFg/BLAgn41/bPGf4w5 VM0tejR5pGtHj3fffXert8T0Yy9w/SVMAqi3BLv/AOMoAHwJoMWfHrUAfO655/Knn34632GHHZAAXICthf8XvvCFhA VAlpQAUJZHshKgci7IohYAmv+/8Y1v5GvXrq2UwL4AuPTSS/PTTz89TgFQOf+HJwCKtfy9ZAGUZRMUU8EpC4iLQw89 dMT1IgmQzhhnSQXw/f7sUUcd1VYaYqdECQX62vWXANCjgv9N//Un93kF/9ZgMq7rpP0+gACAxgsAWwQq8NfiT5gIMA kQfTZAvVEIPqjzGUQABCkBBh7PLBkJUBQAyUmAjvNAvBLA7gEmg5cuXdo29/vB/7e//e38kksucQJAJQDBCoCeJEC3 4D8MAWAMWlJggT/nw8crASwDIL3SjyyJ4L/fMVUgv27durbXuOeee9z9wJcAhoJ9Kyuxz4UuAbKua0TmEQhAANgiUD s/WvxdfvnlbgF45513us+tXr0aCRC4BFBQt2bNGhfUiV5lgCb04447zu36RSEAeh7XdARAVRaAsBs8EiA+CaDML837 mv8vuOCCfOHChfm1117rviYRHK0AqD3/hy8A/FKAfoM5vyTAdogRAPFx2mmn5Zs2bXLPJQHKsj9ilwAZAqD0vb/rrr u6IF7Xhz7WtSJ0PzjhhBNaAkBBvqFg/8UV1+TPLluc/7//e0tLDIQsiLIO60PmEAhGAPjlAFr8+RLgJz/5Sf6LX/wC CRCBBLAdXRMBRRlQJQRMAGjRr8V/dBKg6xhnZAGkJAHq6P/IBIAyvpQF4EsAceONN+bf+c533PfYNVAUAGeccYYTAL vssku8c38ergAoLvht534Yr8kRgXGW/Cm4U5p3sSQgjfEuvtfjDP57zd6xbJCiBNB1onuCCQCtFfW1X/7uf1roRAl9 7pV/uTa//6p5gQuAogQITwD4DV6Z8xAAboGntE/t/PgSQAvAm2++OX/iiSfcTpCRpAB4ZxGYBRzYCaVzayHvywAFfK JMBHQTAMF0eO3tnZesAPAlwG9/+9sRpQBpZAKkJQE0p0sCSPqaBDj//PPzc845J7/wwgvdfUH3CL3/iwLAzwI4/PDD 8/32288R4/zfbS5oau1nMYhjcQXdygCEgjur907rNIC4dnSLvTr84z3rjqkEgJ/x40sAofuC/R5DQb7V/ZsE+Lcb/z 6SUwGytltCKIF/8X2MBEAAtCSA0j4lALT4U03od7/7XScAlP49b968/LOf/awrC0AChB3c+RKgkwhQoKfjvrSg/9zn PpfPnz+/owSwGq8YUn7rEHsWwCuvvOLKR+w6MQEQvwSoe43EJQFU9mUSQPP/WWedlZ933nlu7v/yl7+cf+hDH8rf+9 73tq4BEwBnnnmmEwC6b8w85dL8hf/473zyLtOTkQC+AGjyrh+LKuhFAii1WwJAG0DpHQlYfH/HkfLvB351BID9jGUA WBbI3Llz3RrBD/j9UiP/9xUlAGUi41sKZuVbNHFFAIyQANr1186PLf4U/JsAQALEJwE6iQAFeX6JgD7Wwr9MAhy6y8 R8+vTp7nUaLwL67fbSRQLE0vnVmvls3Lgxf/3119sEQFEC1CHYxd+QRFEopQCa11X2pXuA5K/mf6H7geb+z3/+8+6M Z5MAuhf4ZQAnn3yyEwA77jcnf/9fF31BlQX0dGcOSwAA9IqldksCSAD45SMIgPAEgGX/FI/37FQK4IsDXwAUX8MP+P 1MI//zvgTg/TW+GQDFsedvgwBo7QKp5lNpn7b4M7QA1NEewpcAUZUG9PDNWdn3BygBitkAQqnf2v1VAFhk3333dYv/ ogB4+983OgGwbNmy1i5gFBKg5uI/VAFQFrAr60PXh8Zb14JlAdj1cuWVV7ZJAHteRbNFQUXQPmBaeH+MvwRQzxdlfV nmV3H+P+aYY1oSQPcBsWTJkhElAMoAUOOnoHZ8+pwHml4CANBPBoDt/vsp4woE0/gbxBH8lwV/ZWKgKAD8TAH7ui8B LHgsC/Zth9kvGYih+3+MvSA0RpSFIQBai3AtAlXzqQWfdn5s8ecLAJMAWiQq8NdRUqIoBMKSAr1v65sEyAJtCGK7+m XZAAr6tPurAFA89thj+be+9a38z3/+s8NEgC8BJAC+//3v519ZtDQ/76Z7XCDZ7ACgvzHPSncIRi7+mxQIVAXdOuJR qM+DoQDOFwCSQTr6xwTAggUL8pNOOsmN/8yZM1uBvsRhL0gi6doZm4aSPQbjYyQAmlZDqPlfi37L/CrO/yoF0K7/Rz 7ykZYEUOmYBIDe/2LbbbfNp227WX7egbvkT936D9FLAAQAxBwo2GM6wX9a41vc1TfhY48mADSP+xLAgnz7Hl8K2Od8 ARBEiWhiAoDeMIkLAAsEbCGugE6LQC30bOFXDP4taNhnn31cmqeaQH39619viQDDFvbNTgNuX4hn/ewOl7zGyECx2b vAZRLARIACwOuuu84F/h/4wAccKhXwJYACRL3O2WefnR9//PEOCYAwdgF7C/7rSICmBQL+UW6GAnBDwZ6auwn1ezAB IPGjsRcmCE499VQnALQbPHv27LYsAD+4r8Kk0djOD3U6uWd9SaHBA/9mvT8kbv2535//dV/Q3H/YYYe5+4REgCTAN7 /5TScB9F5XOZAwCRDcom8ACcDCBWILEvyAkL9LvKnhxR39sqwBvxeE//3+zxWDf/7GYZQEMFaJCAB/B9AP/P2jntTw STWffuCvxZ8tAJUiJgGgbqD777+/WwRKAvivMz4L/d7ru0oDgyEFAKGIAAviyiSAgnsFgH/84x9d8P8fCye4R3V/lQ TwBYDtAoqPf/zjLgBYf/vlUUiAlhzyMj9CEQC+BBDq8VAUAdblXc0erQeAZX1o7K1HxKc+9SmX7i0JICQB9tprr7b+ EM0J/EdKgM4ZOyPngBGfHkAChDAfSABoPi+KX3/+rxIA+lm91xX8G8HdeHvtE+KPK7v/EFmAYMEdGQDpjHenYNAkgJ 894Kf/FxsOQrOze3zZx98lUgFQFvT7gb8t/g2ld6rWU7t8tvCzxV+VANAi0XYC7XWqRMB4LP5Ld/vHKA24/Pc1UwJY qrePdn4V/FkGgFDw/8wzzzhRpDF+8cUXW6cC2E6g7QCGsQvYe9+HMgkQSs1/cQ7wRYCuA42vn/XhZ39YBojGXt/rC4 CiBPDngPEXgTXkX1YR2BXLQPqYA0LICFIQrx4vNqcXd/8lfIoC4KqrrmoTAEHfeHuRAAEIANJuYdBAgeA/zcCw05zi iwC/VITAv/k9IIqixz7mbxWhANDCrBj0V6X/GlrMmwRQzacF/lr82QKwKABOPPHElgBoYvpv7Z2/XiVAH6m/TQ0G/H TubgLAJMBTTz3VkgCWCRBuzVdvAiBECdCp/MfmBpMAJgAs68N/7ksAEwD2s83Z9a9f/tNZ3OX+zDzyeoggC6iTBLD5 3xcA73nPe1oCQHOE7jM6RtB/74cafNaWAMUMoEb+v2Su+RYiAAAgzVKeYmZHMfhX6QZ/r0gFgKEabTFnzhxXo+0H7W VIAmiRpwVfEX8BKJQtIDo1BdMu0kUXXdTsBmC9SICIGoCVSQB1fFfTN9V9K/VbQZ8fDCoA1MkRyggpCgCdJx5mINBF ApTsCFedChCqCLAAXuNbJn4MlYGoaaBlAvgCoDm7/oOJgE6BYJ0MgpAC/yoJYFlfomz+13td9xddLyYBJI9F1BKgZJ yzEfedZkkAMX+f9ztYaAEAxC8Auh33SB+ABHoAmAjQrr6wxZx97GOBvSSA0j0NLfz8xZ8WeQoOFdx/8YtfdItFPdoC 0Ee7Sfr943cE2BAlwJCO/8oaGhSaBLBab9V9V2UBKBDU9+rr+lkL/nV97Lzzzu5IoRgkQLcsgOJOYJZnwQSAvgiwbA ArBbB+D8Vx13hLAHQL/sMQQWVBe2cJ0EkAhBz8+xJAp70o28unOP/7AkCSwCSAvv7pT3863IyADu/56rFurgQosuzC L7WQECBLAAAgnrT/OqUZlG4kIgCKIkAd/H3OOOOMUgmgxV4RW/xV4dePGu64qGMvaMCCMBtHwrgAfQmgzA5JAH9HWM /Fbbfdlr/11lutJoImAfRc4ysBoOwPkwCh9wSorAmvTAcOZ+w1LsVsAJMA6vdgY+6Xfyjg8xsA2s/aa739myfzf73h wvyCg6fmV199dRANIStPeqghANqdYTZyUg9MAAid9qJyL6M4/1sTwE984hNOEPgSQNeJvtfuKVEcC5h1FgDV7/9s3N /ffgOvGMo1AACgPaDv1swREhYAZeUBvhQ488wznQxYsmSJO+fZRICPH+wvWrQoP+2009ooe+2dDz063/Rff1t4rPvH hQ1YdHSu06/bN6D+z+RBCQChs95V9ysBoFRv2xFWoG8BoKWAK2D8zW9+437u6KOPbkkACYCf//zn+R133OE+r+sniJ MBKjJAOo1z53Tg5l8LFrgXswE0xhpvlXyY+LHg30oGbNff32FU8K9TIQ466CBHMPKnYmc383eGK8d+5GQe4hnxCv51 pKvuCer1YhTn/5tuusnN75YhcMABB7QEgASg9Y4RJgGCuA7yrPb8X18AZI0QAAaBPwBAfGn/CAAEQE9op6cscNcOj1 C3ZzV8Usqn0Ods8VfEFha22FMQsMO+s10GgJAAaIYE6E8K9Brsh7b49zMA9FyLdz1XIKi0b2EBoAWBChZUCmIC4Omn n3bX1PXXX9/qA6HvVVNBlYo0OxDoUAZSs+FbsTQgFAmgExze/veNbhzV10GYBNCYSwAp68Ov/deRkX7wb+997fwr8H /00UcDyQColw1QnvadVU7mIQsAHfFaFMAq+zL5a/1lLr74Ynd9SAD4WQCSAML6xBiN333uoc9D9TWRNyobjF1/AID4 BcBoZQFofcjfOUIBIFTrff755+cnn3yye67AvSzALzYX1GLikEMOcWixV1xk2POVl851mADQ8yYtRLK87Dz37t3CQ0 v37kUA2FFvhgV+/u6vBYBi4sSJTgAIBRAa3zfffLMlAHRtKQBQICE50MyFaD+9HKqvje7XTnMyAPSeN2xMdcyj3xvA H38be+3ufvzjH29rAHn33Xe78p8HHnjAib/Fdz3Y+MCj+N7vLHFKMgW8QD/U4L9MAmgc1TjWjoeVALBsL3+8hYL/Rx 55xH3u+OOPzxcuXOjuCyohsO9dunSpo+m9IeqNfbkbzEtFcfHzAAAAwysBUGf/OhLAzwhTs9hur7947oH5tGnTEv87 Z3EKAO3szjzlUoeeKwjQAs3qQbWws1pgq/nUzo++R48SAHo+efLklhDoJAKathNRtnj360HrpXuGLwNMAFjQXsRv+l bc/V25cqXrIK7A4T//8z9bn//973/vegFIAOhRzSJ1GsV9990XRCbIIEFAKBJA46DxXLZsWf7973/fyT0TAZYNoPIP kwEaYxt7CYD3ve99+euvv94ac+36K3DUo4J/KwEKRQCUScDqox/jFQC++JEAsEavJgA0z9t9wMeCfiExtHbt2nzVql WtwD+UnhD1xV/1PNLPKbMAAAD9ZAD4Hf7LGgP6PWH0WKcpe9wCIEMAvPAf/53vuN8c93zbbbd1KR/+ok4SQCmeVvOp 59r18Rd9Bx74t4vEJIDVfRdFQCNTL8oEQJdALqsVPIYpAISCff+Md7/pm+3+CgUMxSDAdv3UPVzBowWSCvwt+A9VAJ QHB1WTRdbzSZPjJQEkAL+yaKnbvTUJ6J/coXFUvwcr+TBJuGbNGpf5YfOAXwKk5nEqCRChpB+3zwHlwVzb+I74/s5z SYgCQKiEpygATPZ+5jOfaaX9f/jDH85nzJjhMBHws5/9zH3fxz72sSgFQL2ygTxYKQQAAGFJgDIZYB/r+z525NfynW aflK+5aQEZAKkKADF5l+n5+z96gHuctu1mTgDo0Q/cTQKo3lOYALDFnz6nIwZ1oehzJgHCaABXJ0jKe0r1Dk0EFAWA Bf2+CPCbvin1W7u/fgBo6f1+B/FwalB73fnPRgSAoZaGaFwkAc+76Z42AWBoJ9eXASr5UNaHvuYH/woOLYNEn7v0M3 +Xb7jzG/mLK67Jn122OIh5oCxw7yQAy2RB6EcBmgCw973Gs5gBYLLHAn9dN3q/T506tZUxJvQ5lQOYAGj+/aDX4x7r loyEK4UAAKD5AsDKAIwqGaDnk3f7hAv+v7fgtK49ABAAEQsAoeZtWqifd+AuLvj3BYAWfiYBTAT4DZ+0+NOjasVNAm jBqJ4CZdkAoQ6+vwOY1VwwhnQuvAkA2/X3sbPe/aBQqd9+AKg0f+30mwTYuHGje5w7d25+3XXXtQWVW2+9dcOuh7oC oCrVO+t4XWQdMk+aIgFUniEkdywLyOr7Nf7W50Go5MPPAFJgqPIBv/mjvqZTATYuvyp/5V+uze+/al6j54Cy9P12uR NvBpAvAOw0CBMAGk876tWv/1fZlzK/JH/tPnDZZZe593xRAvzwhz90P3PWWWcFLQDaxzXLuzWLJAsAAADGQgCYBDAR 4O/4W58A+746AoDgPx+TtVzWlCDgqVv/oSUBfAHgB/F+wyer+fQlgNBFo7RREX42QJZXN3PKepAAWZACoBj8+5khfg AoJAHUNb5MAuhseX1eDcYMlQmIpguArIef7SYBymvOm/H+NwkobHztfavrQCc9+M0elfWhMTcBoOMffQGg1zGZ8G83 /n2QHWV9CVAUgFlkAsDmApMAZQLArhXN65rnJX0151s2QFEC6LkJ4zBKAbKa41q/TChrsPwDAIDwJYAvAizo95sECv tYDQC1HpMAKLsf696edvA/duu4rDGL3ZKden386U9/2i3m/Dpfq/lU2qcWfb4AKJMAYWcDdF4A1hcAWVACwIJ/S//W We9lwb+CP6MoAUwAPP/88+5z+v758+c7dETglltu2WgBkHWcDLoJgywYAWDv9fW3X94meiyw03NlChWbPSrrQ2Nu43 /PPfe4a+mEE05ofY/fVyTsG0FWu9ljyA1BOwkAG0eb030JYCJAmSN+KZCaTJpM+tKXvuTuGU0+EnQQAVB6UkSHLBMA AIBhiwA/+Leu/4Y+/3efP9mtzco2ZkwS8DdNSAB0Cgy0eNP58H7Np5o92S6PSYAjjjjCoedaTNrC0JcAYWYD1NnlyY IVARorXwAUg/+3f/OkS+lWUzf1gLBz3i3tW7u/CgCLmQBqHKfdfj8LQJ3FFfxvttlmjS4DqAr+q5rF9SMBmvhe9wWA xtLG2Po8+HJHzzXWlgkgTABojIW+pjkgbAFQlfqfB58BVCUBqgSAnwWgni+SADbP29z/T//0T+7rdn947LHH3M9Y8K /yAT0PTwLkA0sAegIAAMBYSICyowFNBGyzxYTSdZl9nb8nAqB17JcJADV28gWALfK082NlATo20HYPy2jumfD9CYBe JUAWkACwem41iDvooINcMCD0eb95oHZ/iwJA14wkgASAeOKJJ9znJ0yY0OAsj+J4lu/e9yoAQqwHNglg6f1vvvlmRw kgygSA+oKYBAhf/sUtAToJAL9JpESugnyNrUkACQBdE/fff39bFoAvABT8q5QkRAHQ/r4dLAsAAQAAAKMlAvg7IACG KgC0e+uneRYbPmnnR4u/m2++uY3LL7+8xfe+970AA4GstgSoQ5MzAPzg38ZfO/8K/h999NH8gQcecBkAFgz4R4YZCv rs2D9dN0IC4Ec/+lFDx71z8N85fb/3LICgJqi//qPvuOOOluj5/e9/73o3+H0eTAL4IkDBv+SP0r7VFNSIKQPIv06y iESA3vuaBzR+FvzvfOjR+Q77zm7LAtBYakxV6iUJoHuD5K/mfF0zSv9/8MEH87Vr1+ZbbLGFC/6FGk42VwBUSYD65U Plc36GAAAAAIAwBIAvASQAtODXgs52d3wBoB0hPWrxpyCheBRc+CcC1NvtLwsgm77gNwHgp/7b2CvglwBwgf+xF+SL 73rQnfWu495sTLXraygAXL9+vfv8P//zP7seABs2bGjLAghjbKvT9kcu4Ct2+4tBQIACQDu2vtx54403RjR7tOtA4k djrx1hBYZ6tFMGjCuvvDICAZiXZ4rUEAFZAPOB5oGLLrrobzv/f33Pb/qvP7nHlZfOHZEFYP1e9HOSABIA1uRT36dy H50cEM49oFv/jzp9QNr7R+QZAT8AAAAEJAAsEJAA0OOqVavyn/3sZ61yAF8GWOMnLf6026POz3YElAIJfS6WYwG7lQ MUA8em7vyYACju/hdrw4WCfwUDygrQWe8qD7DO8Zb2LRT4KRD0A4GHHnrINY5rRvO/bgJg2JkixWsmnPe9Aj2N6ckn n+ywIx8ldOy9r91iZXrYdaKxV9+Hhx9+2PGDH/zA4fcSiEEAVO3uh5QB1KkMwMqAhC8A/GvDJIA1ApQAsFp/uweElf lRVwDkebej/9jxBwAAgCgEwNKlS1uLQp3zrKOeFPRbMKC0T1sAmgCwwN/qQMNtCpaP6ARelAGdFoBNXAyaACgL/suu AysL0NFxOuvdOr1b8K9gUAGBNf4rEwlNDPAGD87D2unt5b2v8dT7XxkAJgCuu+66Vn8HNXs0CaCsj04ZQLE0BOzeDy TcMTcJYAJg3T8ubFElAYoCQHO/zf8mgUMa7/rjiAAAAACACAWALfYs+LfFnb+oV7MnoRIBpX36u/9xCIB8xOIu7yAD ioF/kwWAn/5f91p4dtni/JV/ubZ13JvVf6vuW8GAdn7DGGcEQN1MADV9s/4OQpJHJR4mAiQA9LEEgP+z1vxNJQChlw GVCcBeekiEKAB8CVAlAIQEgHq96PN+4G/3jDCzAAYTANVlQwAAAIAACEgA2MLPFniW4inU8Ek1n2Vfj0UAFBd4ZR2i QxIAvQT//vVw/1Xz8n+78e/dcwX9ChDVGEyBngkAn6233rqRGQDD2bXtLgBCDQI0Zkrf17hKABQzOiQCTAKo30Mx80 PBv/qIiIkTJwb83q8Y1wpBkAe8G+z3ArFx9IP/ohwqCgC/DEBflxi0owDDkgD9ZYiUjTsSAAAAAIITAGUp3drZscWd H+B3+3pMg9hpkdf0RWC/AsCuASsBMAlgAkA13/7ur9LEDesNEJcAyGulAocaDFiTP3/3V2Op4x/1XA0eddKDJID6PZ R9n8oEJAjDzYQof+8XswGyCARAnXtAUQL4AkDvef8+YMG/5oNmnwIwnAyRsvtAk3vBAAAAAAKgp0Whv7grBvjdvh7N QHZY3DU9A6Cf4L/qWigKANv9VQA4f/58h3oFNKcZYDbkmu04BUAxAFQ2hwJ7jaf1BzERYH0Cyr5v0qRJUYq/kWUB6e wC+wLAjnq1QN/HZGAqAiCm9z4AAAAgAEYsADvV+cZTB1wvIOjn6zEFAhpj6/iu5xIA2v1VAKjgXz0i4n1j1wsEYhhr C+w1phMmTGh9XnKnmAFQ/L6YJUCnHgCxvv+tTMQfdxO+PpoP4hQAedfMDwQAAAAAZDH9z/g7Pf18HQEQTyBgZ70bqv tW6rd2f2MKAPsNBGL5/1QZRx2hU/f7YnvPp/jerzr5I+xTIAAAAAAQAAA91wpDXCiwr1PKUff7QhUAw/o+AAAAAEAA AAAAAAAAAAACAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAgMSDEvo3ASAAAAAAAAAgDQGwadOmpCUADXsBAQAAAAAAAE kIgI0bNyIAuBYAAQAAAAAAAClIgKeeegoJwLUACAAAAAAAAIi55h8BgAAABAAAAAAAADQ8eB9GzX9RAMTeGLAs2EcA AAIAAAAAAMaVadOmOVLt1J698x/XQp5PmjQpf/HFF4ciAIo1/3qu195rr73aPtbvjPFaqBIA/ue59gABAAAAAABjGv y/+uqrLVatWpWUCMhK/kv1Wpg6dUq+ZMmS/KSTTsp33nmnodf86/H5559vfazfod+1fv1697vH/Vr4X+8qeHt0JEBb 8P+29/v+N4t6jvFJVTCO1fyCAAAAAACA2otzIQlw8cUX57vvvnuSAiAlGeAHZQrMX3vttdJd+9EQAPa5l19+uVQ4jU XAWLYjP8y0/U4CoNvrh34N2vj5glGkIgHGa15BAAAAAABAzwt3Bf+SAKmm0KYgACw4s4Bszz33LA3QH3nkkaEJgGef fXbE66tUQL+7279vtMe5aszHQgB0+nyI16HmDz/gTy0LYDzFIgIAAAAAACpTvhWAKfiytP+UegBY2nWqaf/FANt2+4 sB+q9//eu+rgt7valTp3YUAM8991y+6667lv77JAfGSgCMVgZAndePTQDoupIESDHlf7zHDgEAAAAAACNQ4zXVeyvl W7u+CtRWr17tHrfffvu0d+j+kkj/g78G30UBoGugGKD/6le/6lsAvPDCC20CYO3atSNef926dfmMGTNKBcCaNWtGNY hEAECMcxt/CAAAAAAYsTOrBmz+zr+hrx395S/l06dPd8QsAKq+9oc//CH64EtjrX4PZRkAftr+Sy+9NFAGwOTJk1sf P/nkkyOOAdT37L333qUCYPny5QgABAAgAAAAAABgkMBPlHV61+cVjD300EOuB8DMmTNbx7ZF93d4O6udHZCKBFD2hx +QDyoAlF3iZwCsXLmydT3p8eGHH84/+5lZpcH/ihUrxiSFvK0PwF/qlQUMIgCKPQckm2IO/nUtKcNDZR5WbjRlypSk AvKyfhMIAAAAAABoDKrfvffee50ESLEZYEoCoHjig7I/JID0uS233NI932233QYWAHoNXwAoMLzrrrtKBZM+t2jRoj EXAMLP/rD//vKXvwz82nqNMgEQ8+7/7Nmz28qLdD2o7EjlRypDSnEuGe2xRQAAAAAAQNdsgCIK/IxU02hTSb8unvig sg99LAE0iAAQGzZsqBQAetTvGe8Mk6pd+vEUAKGjwN+C/7L5ReVHxYaT0abj91iChAAAAAAAgFFDi3Ad86ZO72r2pn RvoaDPygBMBMS4WM96+C+Va0ICQKUfNvZ61LXQ7/VlAkCBfpkAaNp1Nczx7xTwx3pdSShp3K2UpGx8d9ppp4hPHel+ 3VACAAAAAACNygTQbq1Q4GdCwMoBUjgqULu1/o5taiLAgnM9lwTQNaDn2223XU+v8/jjj7d+xg/+7Xc09VqqCtR7Hf 9OAX+s15ICf0kAv6yE7KExzjoAAAAAAADoBysD0PNtttkmP+ecc3oSAPoZPb/jjjuCbCg5yK59Cjv+RebNm9fCJE8Z xa+lVAIwmgIIAQAAAAAAA6EdXAVxEz45wfHJT34yyR09PzsgtewQywbQ+PciANTJ34L+JtT7DyOQQwB0DvyVAWClRM Ytt9ziTnxQuZE1A9TjU0891SIWEZD1+R8CAKCCPWad0IK/BwAAwNigoE9oJ1hBnerEU03rTfFsdl8A6BqoKwFuv/32 NgEQaoBXdZRfrwIg9utEwb4kgJUQVe3+l7Fx48Z806ZNQUuAYR4ZiQAAAv93gv4b1/3Jsd/p3+TvAhARek8b/D0Ami 0Czj777HzCHhPyPfbYI9n63lQCOj8LQI/K/pAA0jXQ7Wd0jdx2223B7vrnFb0h+hUA0P0ai7kcgB4AAD0GBfPv3NAK /oU+JlAAiOd9rve0wXsbAKC5KPtDwX0dAXDnnXdGF9D1WgKQ4jWikx+MyZMnt56nEuSP50kiCACIJihQ0L/prbyFBQ kECgDxvd95XwMANDwzs0b2R5O7/I+FBGDn/2/XSew1//32A0AAANRIC7bdf18AECwAIAEAAACg+an9sdX8D6ucCAEA UBIQFMsASBcGiPc9T5kPAAAANf+AAAB2BNsCfwIEgHizfmj4CQAAAIAAACRAW4BAcAAQf/kPf4/moOOdBqkFHeTnU6 gZBgAAaLwAsOCMPziMVmpQMf1fPQBIEQaIXwD4/T74mzRHAOic535+ds6cOe5nt9pqq5YMCPEYuWGc85ziMXIAABCZ AFBAxh8dhhn8n3vD8vyXv/uffLuPHtDa8bdTANj9B4gv4C8TALzXx5/dd9/ddW9WwG6PwxAAt9xyS5sAmD17dkP/Bs ML2MfrWCjqbgEAEACjkp7NHx1GQwD4kql4DCB/K4B4BQClPmMb5L/66qsjPq+gXEG/vm67/7vttpv7ms507kcA2M+Z BNDn/d+19957j8uCqSoYr9qx7yd4L75W8TXGQgro/qrO2+rAXdWdu5sg0PnuQse8hbpAHsbfmQwOAEhOAHAMG4wW2v UvZgCYBOCaA4i35p8+AGPPtGnTXPCvIH80BYAF/PZzeh1fABxyyCGVAmDu3LmjHgyOtgAo+z3F51X/jmEHmhbg+2dy 62//wgsvtM7sFhs2bHAfP/74444VK1bkt99+e37bbbfld955Z/BZBNmA/zF/AECSAoA/NIyWABDTjlvgRIBJAIIBgH hRdo+9v/2yH97zYyMA9FgW/FtArt1eCQAL+hTI91LDr597+OGHRwgAKylQkK/fN3369NKfL/s3jrYA6LRj308QWEcA jPaudVU5gMZFTJ48ufXc2G677fJtttnGXQNGbCUEBP8AgAAAGOcSAAX/9mgSgLpFgDRKAawHAMH/+AT/CvoVjPtzrh 59AaBA0b6n7rz+yCOPtASAvZ6lkdvvrOoFUPVvHY3gv85O/LAEQKeSgF4yFaj5B4DQ1vrMTQgAgNaEYBkANjGYBBBM FADxlwKQ7TO+AmDGjBn56tWr2+ZbPdeOvZ8BoDTxXgSAAnyJgzKhYPN9pz4Aw5YATRAA/fQj6OX39lLz76MMDSFBs3 LlyvyOO+7IL774YkcKNf9/+ctfHOz+A9Qv81JJl6GPO80xmpM0N8Wyri+7jwx7XkIAQBJG0GSASQB7zt8JAGD0BMCu u+46YnffUvh9AdBrBoC+388A8IWCfU7iQQICATD8LIBizb/V+j/77LOOtWvX5k8++aQL+H1iSf3PhvAf8wZAOdYnxt D8rnuGMr803wh/Dopx978JcwkCAIKXAH4/AIJ/AICxEQB77rnniN19S+H3d+xtEVd3Xve/v/h6viSQgGi6AKizw9PP z4+GACgT7BbMl+EH/KF2+u91LDot4pkrAOqhY15FsY+I9RaJPe2/CQIxKQFAqig1QgAA0J8EKAbUmm9fe+210uB8mA KgLMug+Hu7/VtHKz18PAXAWKeMAgAMqwygl+awsa33mzBHZ7EH/JwTDQAAMHymTJmSL1myJD/ppJPynXbaqbU487MC hiEA/NfT79Hv0+/V72/SLs5YCICx3CmyRfbOO+9U+jXt+qsPQ/RZAG9ntcYf6QJQvwxAqf+SANZHpG7fkVh6AvQ7Zw xrrkkiA4BO0QAAAMNn0qRJbTv0CgLLduytuVy3gLP4fZYBYMGlfazf28RFXC+ZAnVTzodxtGC/AkB/awmXsoW46nbv uuuuVtO/GDPw6pZaEPwD9J4BIAlg+D0BrB+A5G+MPQGa0F8keAEw/84NLTp1hKZjNAAAwOj2Yynb8bcO83UEQPH7yj ICmr74Gw0BMJ6CZ/369fnLL7/s5Mxzzz2Xr1u3zi3KP/uZWVE0/et3of6HP/yB4B9gAOwkAGUEVPUbKX4+2vtoB9EY TQnAMAfQgnoJgDpp/ggAgGaX6/AeBQhbBpSl/NdZvJV9T68lBE1eyDXl9Xpl6tQp7u+vpo9qvKjTF6qOYIzymv7fjB 1/AIhPOMQSQPgSoBhMEFwAjP97tNN7t5jNw98sHfHD3yJ+AdCU10MAAACMP7Nnz3Yccsgh+dy5c51ULM7z6vmSws7/ oKVjwQuAaYeeMFCGgN/sTzX/Vvdvn6cPAMD4Cro6JTrDbtjJ6RDNDfyRPfFKgDo1/2P1OiFLAIJ/AIgVlRL5FNP/1X +k2FMm5hKjqq8nIQAGXawXSwJ8IcBCE2B8BYAf8Ol52fcN8l61+WO7jx7gsOdIgGZfCxCfABhGl+ZhvQ4CAACgeWjX X0yfPt1lAyjYX716tXvUUa867aUpDV9HUwBUCYHoBYACf59h3OyLZQAsNOOtGefvEVbQN4yGnWVf07xx7g3LWyjwn3 bcAgRAQ0u1EADxS4BhCADet81l2rRp0R7918/iHQAGFwLqMaJeI5r7x/uo1/EuB4i6BEADrKDfUn+HJQAgrWCSv0tY ad+DNOz0U8d9UaB545e/+58WCv5T6ByLAACAsQj2i6xYsSJftGhRcgtzmgECQAxz2rgLgOJOPYt1II04jSCwn4advg AoZhRot98elQVgEsAvCWAMmjH2vgTgPQzQfAHw6quvup4Ma9asyZcvX94SAQgArg8AQAD0nebHTh0gAdIZu34adu4x 64QR8qCYDWKPZRKA+aV5AqCX97DGkL8jQDOyAFJN+SfwBwAEAEADAkkkQPglAXUadkoAmCDwx91/Df/zvgRAADRL2t kY+mPG3wgAACAddARg8oE4AgCgPn76sB9A8rcJUwR0S/234N8XAH6wb5+3r1k5kTUEJPhvpgTwZU4dCWBZAGSMAQAA hI/Ki1LMKipmFyEAAAYIIvl7xElRABSzAOxzwj5HaVHzJUCxF0StVOR3ToyhZwwAAED45UUmAVIsMxqP/iIIAAgyeC j7nB/48XeKUwAUa/79+vFiRgB/s3BKQPwSjroCgKaxAAAAcUkAI7WMAAQAQI2dw2KAZwKAMoC0sj384JGO8uH3gejU /8Hf+Rd+mQd/SwAAgPAlQKpNRosSgBIAgJoCwO8sz98qnRRyyj/SKuFRwE8JAAAAAAACABITAFUSgEAwraCRv0UCN6 pCkE9vBwAAAAAEACQkAIrpwt3OjwcAAAAAAEAA8EeAgNOFfQFA8A8AAAAAAIAAgIRkAAAAAAAAACAAAAAAAAAAABAA AAAAAAAAAIAAAAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAAQAAAAAAAAAAAAAIAAA AAAAAAAAHAHwEAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAAQAAAAAAAAAAAAAIAAAAAAAAAABAAAAAAAAAAAIAAAAAA AAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAQAAAAAOPOtGnT2kjxJu3/xzUBAAAACAAAAIgy8H/11VfbSEUCZB3+4/oAgF DYfvvtHcn+Dd6d1KELO+64oyPdv0H2DggAAABIjN13370t4E8tCyDr8h/XCACEJADWrFmTrgRon9yhy30/XQGQudgf AQBR7+pl7kJPbzJkAQ/QHS0CtBhIMeW/KAC4HiCFhb9g1y9eAfDGG2/kP/7xj9OUACMn+CjZeuutHckKgIHHFwEAEQ f/firvqlWrkhIB7OS983cYcMxTlUcAISz+BlkAssuX9s5fuhJgbBf+CAAEwGjdA1566aW+7wM2D5x99tlhSoCBx9mf BzIEAMS3++8jCXDxxRcnceMnrbc9iB/kZzdt2pS0BGBnGJq6+LMFIIt8roleFv533XVXwhIgS0YC3HLLLUiASOcHuw dcdtll+a233trTfcCCf80D0QiAnsa5GPwjACABKaA3viQAqb4IgLo/u3HjRgRAAv+fe++9dz5jxox81113zffcc083 5lOmTElyfrAxb/LYa8GnxZ+/C5SUDKgeSEAAIADeeMONc5ISIJF5wSTA4sWLe5IAJgCuuOKKfM6cOfmRRx6ZmAQoEw AZAgDiYOKUiW4Bbwv5lPsAcD0MLhCeeuopJEDE/3+zZ8/OX3zxxXz16tXu8fnnn89fe+21fMmSJfmkSZPIGGro4k+L Pi3+LBsgqYyAzgMKXQSA3uMIgPjLAJKUAAnNC/1IAF8AzJo1K1wB0LcEQABApGjBroW7FvC6yfsL+wnbT0h6Mc/10T kjoEwUIQDiFQAK/C3490WhcdJJJ7W+lmJWUNPnDV8C/PSnP3UMUhcalQRgvq9c/Gvhn24WQIYESDYLIItWAGjuv+aa a/L77ruv49zvp/9rHjjxxBPzww47LD/llFPiyQLoOPdXBf+je30gAGBMgjst2LVwL1vQ62sfPOKD+fTp0x0xL+o7BX IxCoG6WR7dBECx5r8oAGLPJim7LmIUALr5az4QSv8vG9Oddtop2vGuIwdDGHeTAFr86VELwOeeey5/+umn8x122AEJ wLqgbfH/hS98IWEBkCUtAJIa6wQFgOb/b3zjG/natWsrJbAvAC699NL89NNPj1MAVM7/CACIWACIzXfavPRrWug/9N BDrg/AzJkz87322ivZPgAxSQBlfQxjp7as5t/EkV0r9nGTUsOHOZZVAsD/fAzXjsYw5SPBYpoDtNBT4K/FnzARYBIg +myAegMeRVDnM4gACFICDDymWTISQNeHMkCTlQDVi5xoJYDdA0wGL126tG3u94P/b3/72/kll1ziBIBKAIIVAD1JgG 7BPwIAEtgFuPfee50ESLEhYAwCwE52sH4PKvlQ1keZ+Bm05l+PWkjYx/od+l3r1693v7vTv22sAv5hj2Xxtco+DjVt 3Jg3b14LyZ2yjCFR/Fpq80Aoc4QWetr50eLv8ssvdwvAO++8031OJWBIgCyKoG7NmjUuqBO9ygDd+4877ji38xeFAO h5bNMVAMlJgM6LnCglgDK/NO9r/r/gggvyhQsX5tdee637mkRwtAKg9vyPAIDEsgGKbLnlli3Y+Qsz+NckbkG2xlT9 Hsp27UdDANjnXn755dKAsPjvG4vxG3bafjcB0On1m359WdCv68NvHie0OHz44YfzRx55pNUMUI+6HozQRUA24H8hlA No8edLgJ/85Cf5L37xCyRAJBLAAjoTAUUZUCUETABo4a8AIDoJ0HWcs+SzAISCPiRAFp0AUMaXsgB8CSBuvPHG/Dvf +Y77HrsGigLgjDPOcAJgl112iXfuzxEAkAhauGsh/+tf/zr/1a9+1VrkqwTAygBMBKRQ4xtLc8BigK2THsoCdI39sA TAs88+O+L1VSqg313279PXxkoAVI3hWAiATp9v8nWleUASYLfddnNUycIyNLbFPhEpZQE1/WQApX1q58eXAFoA3nzz zfkTTzzhdoKMJAXAO4vALIJSAAk7LeZ9GaB7gSgTAd0EQDDv6d7esAiAQhZAMhKgxo5wTP+/mtMlASR9TQKcf/75+T nnnJNfeOGF7r6ge4Te+0UB4GcBHH744fl+++3niHH+7zYPjMYaDgEAQ9/h7ycTYLPdNnNIApgQoBQgC2rcixkAxfp/ PZf46WdBZ683derUjgJA6WY6M75MAChNdTTLAMYiA6DO64cqAIaVWcQ83EwJoLRPCQAt/lQT+t3vftcJAKV+S/x89r OfdWUBSIDwAzxfAnQSAQr2dOSXFvWf+9zn8vnz53eUAEG8xwdY7KcmAX7729+OKAVIIxMgPQmgsi+TAJr/zzrrrPy8 885zc/+Xv/zl/EMf+lD+3ve+142/LwDOPPNMJwB035h5yqX5C//x3/nkXaYnIwF8AUAGALAQh0aO+6pVq9oEgBbzxQ BdWR/9CoAXXnihTQDohlJ8/XXr1uUzZswoFQDLly9HAAQgADTGxuTJk1vPU5lbYj0uVBJAu/7a+bHFn4J/EwBIgDgl QCcRoEDPLxHQx1r8l0mAQ3eZ6E4J0us0fh7oZcFfMwAIqZdLXQHwyiuvODFv14cJgPglQN1gMB4BrHldZV+6B0j+av 4Xuh9o7v/85z+fH3zwwS0JoHuBXwZw8sknOwGw435z8vd/9ICwygJ6W+wiACBdtttuu3ybbbbJJ3xygmPzT05MMgsg ZAngZwD4uzfK7hgkA0ABoX385JNPjtgZsuPjisH/ihUrRr0JYHHsmiIAQg0i99hjj2hr/gctFwp1F0g1n0r7tMWfoQ Xgscce6/AlQFSlAT18c1b2/YFKgGI2gNDOr4I/le4U2XfffV0AUBQAb//7RicAli1b1toJjEIC1AwAYhIAdtKLxvv1 119vEwBFCVCHIAVA1vu1MNY14sOWAOr5oqwvy/wqzv/HHHNMSwLoPiDUTLpYAqAMgBdXXBPWGqDPOYASAEgOWUGhUg AFb7rxp1wKEMJNX5Oxyjbshjxh+wltAfmgAkCBoJ8BsHLlytYxgHpUo7gdDhsZKOhrixYtGnMBUDdoH8Zr1zkBIFSp FGvNf0qS0BbqWgSq5lMLPs3vtvjzBYBJAC0SFfhbn5iiEAhLCvS+rW8S4N0fDW/hb7v6ZdkA2vlV8CcZIB577LH8W9 /6Vv7nP//ZYSLAlwBaB3z/+9/Pv7JoaX7eTfe48oFmzwH9jXtxvItBwDDuJ2P93vfRuOna0DyusbcsABMAV155ZZsE sOdVNFsUVATtA9aG98f4SwD1fLHMr+L8r1IA7fp/5CMfaUkAlY5JAOi9L7bddtt82rab5ecduEv+1K3/EL0EiEoAaK CTTpXOMwL8HkXA2WefnU/YY4LbEUx5oR/Kzd7v3fDBIz7oJI4+r8aOeq5eD4MKAL2GLwAkGbRQtI+bFJgNS+TUEQCp zC+UGoUV+CuAs6OetAjUQs8/8tEP/nUmvNhnn31cmqeaQH39618fcTqEBYXN3gF8dxHXWvf3uSNcHkOEIQKqJICJAG UDXHfddS7w/8AHPuBQqYAvAVTepdfReuD44493KJAMYyewt+C/jgRo2nxfFXTb+1mNHg3t4voCQOOv8TUBsGDBAnes r8Z+5syZrUBf2UO9oCwSm3tGf57oMRgfIwHQfi01IxPMn/v9+V/3BV0rhx12mLtPSARIAnzzm990EkDvc5UCCZMAwa 0BBpAAwZcAaLB18+735/WzCgSFXiu0oHBYQUAoC34W6WkjYyshcO+99w4kAMSGDRsqBYAe9XvGWwCM5vsVAQAhBf3F wN8/6kkNn1Tz6Qf+WvzZAvDQQw91AkANPffff3+3CJQE8F/HdoabJwKqFt99LP7zXhb3WeOvCwvmixJAwZ8EwB//+E cX/P928Qfdo7J8JAF8AWA7geLjH/+4CwLW3355FBKgJYi87I+QBEDxva4A3NCOrzq8CzV8NAGgzA+NvTBBcOqppzoB oJTw2bNnt2UB+MF9FeMzN9Q5zm34c0Boc4MEgObzovj15/8qAaCf1ftcwb8R3uZF3pcAaJsbQhIAekMqFdjOeR4kC0 ACYKuttnKBv0xhCAJgNIIAFvwQigCQwbfjHfUoCdDPa/mnACjQLxMATVsEDrOGu1PAz1wATQv6/WDAjngylN6pWk8t 8G3hZ4u/KgGgRaIFAfY6VSJg7GVA+U79WO0Alv++5koA2+n1UeCnXX/LABAK/p955hknizTOugfYqQC2G2i7gGFsNP Te+6FMAjR5HrD3ojL2iiLA3rc67cF6AFjZh+SPNYn81Kc+5Wq+JQGEJIDu8X6DyOYE/iMlQK33f9Yh82MACdB0Kagg Xj1ebE4v7v5rrIsC4KqrrmoTAGFnL/YgAUIXABpMm7Rt919nPOtrtpjvpSmUft5+ziSA/7tCaeTUT0p3t0U/AQA0EQ vO9VwSwDKA1Oyxl9d5/PHHWz/jB//2O5p6Y6h6zw5y1jvvfWgKWpgVg/6qnT9DC3mTAKr5tMBf93BbABYFwIknntgS AE3c+au96O9VAvSx69fkAMDfze0mAEwCqPGnSQDLBAi3DKg3ARCiBKjKAPJFgMZfY+uXffjlH1YConHX9/oCoCgBfB E4/tlANTKAsorgrtgHog8RGEI2UFEC2PzvC4D3vOc9LQGg+UH3GR0jWOwHFLUEKGb/NLUEwN7soy0AdCHYz+l19PGc OXPcx4cccoj7XU1K7R8LAcAuIISClQHouU56UI+HXgSAfkbP77jjjsal+w8axI/mzwKMpgAwVJ8tdE9WfbYftJchCa BFnhZ8RfwFoFC2gOhUD6xdpIsuuqjZtb+9SICIan+rJIAavqnmW2nf2vlV4GclACYAdHqEskKKAkBniocZDHSRACUB YdWpAKH1ADERYBLABIA/5vbclwAmAOxnm7PrX78HSOf3ae7f7EcKoUhKgcokgGV9ibL5X+9z3V90LZgEkDwWUUuAEr GTjbjvjLMAUHftshutBf/WBVxvYL8LuAL5XlL49XPq9F0UAFZSMHfuXPf7ih3j9fmx2uXvdcd+GLuA3YICAgVoUk8I ywbQEY+9CACdBmFBfxPr/XuadPt4byIAIBQZoF19YYs5+9jHAntJAKV7Glr4+Ys/LfIUGCq4/+IXv+gWi3q0BaCPdp P0+8ev+/cQJcCQOn9nDQ4OTQJYqrfSvquyANQPQN+rr+tnLfjXNbLzzjvnRx11VBQSoFsWQHE3MMuzxgd+ZSLAAniN bdmYGxp3NQ20TABfADRn138wEdApEKyTQRBS4F+UADrtRdlePsX53xcAkgQmAfT1T3/60+FmBHR4v1eP8fAkwFAFgH /MloL+bueA60xv+566wcMjjzzSdhSYXs/vBK7XKysFKP77RlsA1AnGBxUAvTQCI2CApuALAGUD1JUAt99+e5sACNb8 9jkHhHYiBCAC1MHf54wzziiVAFrsFbHFXxV+/ajhjos69oIGLAizcSSs3hEmAZTdIQngB4R6Lm677bb8rbfeajURNA mg5xpjCQBlgJgECL0nQGVKeGVKcBjj74sAywawUgBr+FgUPxprCYBuwX8Y414e0HWSAJ0EQMjBvwkAodNeVO5lFOd/ awL4iU98wgkCXwLoGtH32j0limMBs84CoPq9n42tACgL/sWMGTNceoc/GHquHXs/A0CNQnoRAArwJQ7KhIK9+f2sg2 7/ztHe/R8LAVAn2KdpIDSNzT850e3qK2W42/fqGEgtAkPd9e+1dGjQ7wVoWnmALwXOPPNMJwOWLFniznk2EeDjB/uL Fi3KTzvttDbKXnvnQ4/ON/3Xn9w6YN0/LmzAYrBznX7dvgH1fybM5pFqFKuNGwkA7fRaQKjgT/X/WvDbDrACv9/85j fu544++uiWBJAA+PnPf+7Kw/R5XUNBnAxQkQXSaaw7pwQ3+3rQmBSzAUwCqOGjSR+//4PG328AaD9rr/X2b57M//WG C/MLDp6aX3311UGMe+VRjzUEQPslkwWb8avgXzGc7gnq9WIU5/+bbrrJze+WIXDAAQe0BIDkn/WOESYBghABeVZ7/q 8vALLxFwCyOMXdfUvh9wVArxkAfifwolCwz0k8SEDU/bemIADGSwJwXjd0QuU6Cu7rCACb8GMTAKPxvSmUkjCvhId2 esoCd+3wCHV71j1dKZ9Cn7PFX5Gi+NdcssO+s10GgJAAaIYE6E8K9Brshzg/+BkAeq4FvJ4r2Neur7Dgz3aAFTCoHM QEwNNPP+2uq+uvv77VC0Lfq6aCKhcJYUe4VALUrPculgaEJAGK2QAadwX86vlgmR82/lYyYLv+9r5fduGXXPCv9/9B Bx3kCCb7oyK9O+sQHFb19Qhxk88EgI54LQpglX2Z/LX+Msr81PUgAeBnAUgCCOsTYzT+OuihxKNSGHX8+XESAHvuue eI3X1L4fdv3Hqz9yIA/O8vvp4vCSQgmi4A+rlp1/n5pgkAmXwd91Ls3lm3m6eCPxFyzfcw/uaxBoB1+oA0ucv/WIxr SsG/rgfRaa7QfKJ5JcZros58EXI2iOq8zz///Pzkk092z7VwLwvwi80FNdZq9Cu02CveO+z5ykvnOkwA6HmTrpPyps DdG4WFlOrdjwCwTu+G7fj7wd+Pf/zjVuA4ceJEJwCEZYK++eabLQGg60tBQLMzAfrp51B9fYQkAXSE49v/vtGNpRo7 CpMACu40v6vsw6/9t/Evvu+186/A/9FHHw0kA6BeNkB5wJf1FIuEJAFUxqXGsXY8rASAZXvZmN99990OBf8W/x1//P H5woUL3X1BsV8v8UVTxr/7e77cC+alonicMwD0B3/ttddKg/NhCoCyLIPi7x0PAdApOB8LAdCkCcLegBo7Q+P2wgsv uEeJIrFhwwb3sbq9C6WHq+5bFjiG3d9swP/YQYSY0SLA0C6wssV0g9ecIPz5I8bd/1TmAu3qzjzlUoeeSwBoLK0eVH O9pQFbzaf1/NCjBICeqxTQhEAnEdC0a6UyC7BLyu/Ipk/hywATABa0F/FrvovBn46CVban5ov//M//bH3+97//vesF IAGgRzWMVHZAM+eLfoL/6kAg71gy0KwMAL3vDZM6muf93gD+dWDjrxTvj3/8420nQCggVPD4wAMPuOyfxXc92Pj7Q1 EA1g8E3/m4ZB4J8d5gAsAfcwkAa/RqAkDzvN0HfCzoF7om1q5dm69atSpfunRpizgEQNVc3z2TbNQEgAXWxaB6ypQp rr5PNV077bRT603vZwUMQwD4r6ffo9+n36vfX+ffOVo7NlULttEUAN0WieM9QfhvWpVxCC3i7Lmhs9513Ju/G5DyYp /gH1LZ+d9qq61GzAc2R8Se9p/KHKCg/4X/+O98x/3muOfbbrut2w30x1cSQLuAVvOp51rk+4u+Aw880N3PTQLYTm9R BDQ546fyXt01iOsv5bPJAkAUz3j3a74t+BMKGoqBgO38qYO4egfYrvJ9993njqTUYwjlIPV3/steKy8NBJomATQOCu iXLVuWf//733cZPiYCbNw0hiYDFCCa/NH4v+9978tff/311thr118CQI8K/q0PSGjzfXHsyuVP/AJAqHynKABM9n7m M59ppf1/+MMfdiXfwkTAz372s4DWC70LgHplA2OQAdCJSZMmte3QK5Ar27G39PBuE0bx+ywDwFLD7WP93iamcg56TF +doL5JQT5BDQD0mvqf6ryTkuybvMv0/P0fPcA9Ttt2MycA9OiPpUkA1XsKEwC2+NPndMSgJIA+ZxIgjOZvda7pvMc0 7/BEQFEAWNDviwC/5ls7vwr+1qxZ41L/9Tnb3fe7iBflgAX/IQqAquCvdSJMjfKQrJHXd+aygL6yaKlL4bZMIP/4Tk kANXy0ng+WKeSPv18OpNdQB3mVBIhQ5oH2ub98R7dN8Iz4/nDvIb4AsPe85oRiBoCNswX+umb0XtfmgGWMCX1O5QD6 3o997GORCYC8h2yR7rFlNlYBYdWOv9WI1xEAxe8rywgIwfoNWwA0bVKvW/Pvs9lumzkkc5Tap06+SvexI+NSWciz+w +pMm/ePJf6Lwmw2267OerOHzH0BBjkvR/iXKHGbS+uuCY/78BdXPDvCwAt/EwCmAjwGz5p8adH1QebBNCCUT0FyrIB wiMbUduZ1VwwhiQBfAFgu/4+dtSbjaVSfLXz6wd/SvPXjrFJAM0Fepw7d25+3XXXuc9vvfXWwZYAZB3LOLOO10bW0H Wivc+VCXTeTfe0CQB/rH0ZoJ4PWhvqa/74K0C0EhJ97tLP/F2+4c5vuLnl2WWLg5gDSrOIO2QBlcmCkI8CtEaQJgA0 nnbUq1//r2xAZX5J/tp94LLLLnPv96IE+OEPf+h+5qyzzmr4vaDOfF4+X9TpG9PpvZ+N9Ru+LOW/zuCUfU+vJQShNP wKvTFcVc2/1fo/++yzDtXqPPnkk25S94kl9T8bwn8EhpBaBoAkgOH3BLB+AJpDYuwJkOI84e4Tt/5DSwL4AsAP4v2G T1bz6UsAIQmgtFERfjZAVlrvXXcHKKRz4asEQDH4L2b6WPAnJAFMABYlgI6W0+fVZEzlASIUAZD18LN1JEDT5guNi8 ozhLI7rBTI6vt1DVijR2FHi/vjr/IB//QHfU2nAmxcflX+yr9cm99/1bxGzwGdSoWru77HUwZk84BJgDIBYNeK5nXN 85K+mvMtG6AoAfTchLGEgT3aCXLhSYDOY15HFlWVqo+7AGjK6yEARq8cwIL5MvyAP7Zz3uuME0E/QDtz5sxxGQFV80 bx8zH3Awht3h8kS9D/3Kc//Wm3mPNTfK3mUws5Lfp8AVAmAcLOBui8AKwvALLgBIAF/7b7q6PeyoJ/BX9GUQKYALA+ UfPnz3dHA2655ZZBCIDOXb27CYMsCAHQKt19JxNI2Bjb+1bXgo569E97UNmHxtuugZ///OdtAkCvYzLh3278e/c81D VjWRZQlpgAsGvC5nRfApgIkDTyy4CEekzYz6ocIFYB0E0CNEIA9FLzP1avE7IEIFgEAIAopek7QYDOhvdrPtXsyXZ5 TAIcccQRDj3XYtIWhr4ECDMboM4CLwtaBGi8fAFQDP7f/s2TbkdXNd3qA2HHvNmur4I/BYHFTADVjWvX388C2GyzzY IoA6gK/qtqxXuRAE19r6+//fK2TA/b3dVzlQsVT3tQ2YfG2wTQPffc4wTACSec0PqeYnPR0I4HLGvsmEcuAaoEgJ8F oJ4vkgA2z9vc/0//9E/u634mwGOPPdbKNGmuAOgmAfKBJUBjBMAwajWH9ToIgLHb4dl8p81Lv6bdvL333jv6LADq/g G6o4BPN3Et3DUvFOd4nfaS0mkAqYpf6/htAkCNnXwBYAs87fxYWYCODbTAoYzmHgfXnwDoVQJkgQkAS+dWfbjOeVdA IPR5v3mggr+iANB1IwmgeUQ88cQTwfQBGHHkX+mcUF8ANHXsO/UL01ja+Nr71s/usBjAMgGECQBlegh9zYJE9QcJSw J2S/3P+xCAWZACwO8PoTHU+kA9X0wCSADomrj//vtHZAGYAAi5GWD7Pb//LIBx7QHQS83/WLwGjGGK14svuiMay9J5 dd63bvrW9C/mlF5KAAC6o/nCKM4XmkeKp8mkVAKQyjzhCwCdC+2neRYbPmnnR4u/m2++uY3LL7+8xfe+972AdwG7S4 A6ND0DwA/+7RrQzr+C/0cffdSd864MAAsI/GPDDAV91vVf146QAPjRj34UhAAoBv+dNwl6zwII6f2vsbT0/jfffLOj BBBlAkCBovUZEFdeeWXSEqDJ14He95oDJO4s+N/50KPzHfad3SaHJAEkdFTqJQmge4Pkr+Z8NRBX6v+DDz7oUK+xLb bYIpjxzirLv+qVAJXP+1lzBACkh45mXL9+ff7yyy+70o3nnnvOpXBpIb/DYTtE0fSv3wZfKS3qAeqiRb4W75oj1PxJ j6+99lq+ZMmSxhz1Ot7zRioSQAJAC34t5mzx7wsA7QjpUYs/NXmr6jcT5t+h/m5/p8VeHoAA8FP/bfwV8EsAuMD/2A vcOe866k3d3m1cFfQZCvq01tDnFfRv2LAhmAyAstT/Tk3i8i67/eWnSIT1/td72jIBfv/737v3t9/o0SSALwK0K6zg UI8K+n/wgx84/EyC0N///ns96yICmi4Bi1kAF1100d92/v/6ft/0X39yjysvnTsiC8D6vejnJAEkAKzRZ+uEsc02c6 cHhCkA8p4FQHXfAAQAjCMTp/ytHmvPPfdspXIqxTe5jAh2/AFqozlCc4Ut9qZMmZLsfJFi7xeNuQSAHletWpX/7Gc/ a5UD+DLAmj7Z4k9Nw7T4ty7QMR0L2L0cIA/mHmMCoLj7X8z2FAr+FRAoK0BHvak8wBrH2a6vgj4JAD8QeOihh9yGQ7 MaAHYK8IYrErrtBDb5va/3sZ/d8cYbb4w47cGuD2V+aOyF+j4ou1SELQKrsztGlIoElPnTrQzASoCELwD8LACTANYI UALAfkbXjc39IY11PQGQ53WPDO1aRg4AAADQZAGwdOnS1gJP5zzrqCdfACjl0xZ/hqX+ajEY3oJwpADIS3Z3O3V8b7 pwNgFQFvxXlX5KAKhzvI56s0ZvJgAUEFjTvzKJ0NQAb/AAPdx0/07jrUBP43ryySc7JHL0eWV1mABUyriyxWyMi1lA av5mc0FMAqBzt/h6JWVNlQAmANb948IWVRKgKABs7te4i3AlQH/XRt05HwEAAAAAjQ4EfAGgI53sc9r1t0DABICd+V xFqJkAZd3cu5353nQJoIW+n/5f93p4dtlid867dXv307/9Xd9QAjwEQPVYS+pIAmp8TQBcd911rQaPOu3BJIDKPiQA 7Gft/a5SIjFx4sQA/w7l5R11G0iGlhHkCwBfAlQJACEBoF4v1vEfAYAAAACAANHCLumgl/KgEYGAnwFw1llntXb01e lZqEeAaj5t4R+rACimeJY1fApJAPQS/PvXw/1XzXPnvOu5An9r+GYCwMZ66623bvCYD6t3Q3kgEMNcYsGextcaPApl ejz//PMtESABoJ4PxewPCQKdEiBJEE5DuE6iqHsWUMhlp34fEBtDP/gvXhdFAaD7gh37F+Z834vEQwBAoKiDZ2rH/u U91ukApIoCA80RzA9cC8Ud3bImf1rcW8OnqkaAcZ8elOUhNgHsRwDYGFsJgN/wzQ/+FfwZ1hcgZgGQddj5DXk+0Viq iZ/GWBLApI6JAJMAQj0f7H2u79PYz58/32URhNxA1m/oWJUFVFULHsP4l83dJgF8AWBZAKEL34HkEAIAmhbsF1mxYk W+aNGipBbzqXb0BuhnzjAJ4JOaAGC+KF8QaqdH5QBh1vYO9/oI9f+huNvX77WgY8F8AaAUYKV8a+dXwZ9QLXnzGgEO S9qE2weil3H2MwAssNdznfKg9H89WpmAnwFg4z9hwoTA573uWUBZ4BkA/WSHSAD4R736ZWAIAAQANGQxr86ta9asyZ cvX57Ugh4BAND/vGGklhHAfFGNn9afcoZI6teEBQESAHbUm55LACjtWzu/Cv5UHpJKEBDrWsPfCVY2h42rn+EjyeMH ff73pfH+z5KaJyw7xJc+aQmAztIHAQCNzAJIecHGQh6g93mDQI/rAaAsCLjyyivbAkE1fFNZiNK+Q9/5HTQIiHHuUG BfJ6Oj7vfFWiKWwr2jrEQsJQHQz7gjAAAAAAAgqiAAAJgP+FsgAAAAAAAAAAAQAAAA/bL99ts7kv0bvDujAgAAAAAg AAAgbgGgxo7JSoD2WRUAAAAAAAEAAPEKgDfeeCP/8Y9/nKYEGDmzAgAAAAAgAAAAAYAAAAAAAABAAABA4BLglltuQQ IgAQAAAAAAAQAAsQuAu+66K00JUD7DAgAAAAAgAAAg3jKAJCVA9SwLAAAAAIAAAAAkQPxZAEgAAAAAAEAAAEACAmD3 3XdHAHBtAAAAAAACAABiEwDPP/98uhKgcqZFAgAAAAAAAgAiQMFdUru8IyDAqxIAyUmAjrMt1wgAAAAAIAAgAgHw6q uvJiwBMhfbEeBVZwGI008/HQnANVLKjjvu6EAici0AAAAAAgACEAAK8NKVABkSoEYWQDISoOusyzVSJhDTFQDMHQAA AIAAAAQAAiACCfDb3/52RClAGpkA6UiArbfe2pGsAHj3booAAAAAAAQApCMAFPAhAFjE+wLglVdeydesWdOSACYA4p cAdWbfLBoB8NJLL/UtAkwAnH322WFKgJF31QEEAPMHAAAAIAAgAAFwxRVXJJwFkCEBSq4JsXHjxvz1119vEwBFCVCH YK+JWhKgDs0XAJdddll+66239iQBLPjX3BGNAOhJAhSDf+YOAAAAQABAwwO9L3zhCwkLgCx5AVAWsM+aNctlAUgAqA zAsgBMAFx55ZVtEsCeV9FsUVARtNeehYfJ+EqAxYsX9yQBTABo/pgzZ05+5JFHJiYBygQAEgAAAAAaJgAs1XOQus+g GSjds3mp2j6DCIAgJcAQ0ndTkQBVQbfGXxx33HEt9ttvvzYBoFKAdevWtQTAggUL8pNOOskF9zNnzmwF+hdeeGFP6J rT9TY211yPwfgYCYB3f934XnP9SABfAEgaBSsA+pYACAAAAAAIRABooWd1n0kLgMAlgII07c6qY7voVQZoAa+A79JL L41DAPSxg5eSALB0bcPEj9A1cMkllzg+97nPtQTAY489ll933XUOEwSnnnqqEwDHHHNMPnv27LYsAD+4r8KuM7vWxu Z6qwrWBhQA+TAC//G/3uy+8NOf/jS/5ppr8vvuu6/j/cG/njSmJ554Yn7YYYflp5xySjxZAB3nkW7XEwsUAAAAaFAJ gBZ2qvn0mz8lJQMGChqbJwGsRttEQFEGVAkBEwAK+r797W/HJwG6jm2WpAQQavJXFAG6BsT8+fNbPQC+9a1v5X/+85 /zP/7xj61r61Of+lR++OGHOwkgJAH22msvJwDsOmpO4D8yaBsZfHeWACM+PYAEaFrgXyYAlAHwjW98I1+7dm3lvcEX AJJHGvsoBUDl/IEAAAAAgMAEgBZ5Sve0bICkMgIG3jluZimA0rO1IPdlgAI9USYCohAAvUiAEeOblgAolgJYMF4mAh TQ7bvvvi74/8AHPtCGXVv6+uc//3n3vb4AKEoAe/3xC/zLx7yOCCgL+ktFQM3gv8kBokkA7f5LACgTQPeJpUuXtt0b /OBfY635Q2OvEoBgBUBPEqBONgkLFIBe2WPWCS34ewAADFkAFCWAdn3EIMdBxb/jE4YI8CVAJxFgzd5U762Ub+36lk mAfXbeOi4RkPUarMX7HugkAkwCmAD4j4UTWgLAnvsSwASA/Wxzdv27y4BOIqAtGcCfG94RAXWuq6bu+lfdF5577jl3 b7j88svzCy64IF+4cGF+7bXXuq/tsMMO8QqAHuYQBADA8IP/+XduyG9c9yf3iAQAABgFAeBLANvp0c6PFn9PP/20W+ ghAcKWAJ1EgBbxfomA1XFXSQBxxIxtIyoJ6C4GUjkVoEwEWACvAF/XTTELwNi0aZOTSJYJ4AuA4q7/BQdPbahQ6iwC sg7XVZ0MgpCCQt0TNP/rXuBLAHHjjTfm3/nOd9z32PxSFABnnHFG/AIgRwAAjAb7nf5NJwBMAuhj/i4AAEMWALbgs5 RPYSLAJED02QB91483XwIUswGEdXVXfXcRBXsWxPnB27ILv5Q/sOQM9xhERkDf76g0BUCZCLAAz0oBFOjr0Q/+TQ5I AHQL/v/PwhPya088sOHXT/XubpUEyGqVkoR1DWne1/x/5513tiTA+eefn59zzjmuwaMyAnRfsHIPXwAkkwWQp509BD AWEgABAAAwSgLAJIAaPikTQIs9Lfq0+NPnVq9ejQQIVAIo8CrLBtDJAa+//rqTAUKd3q3ZmzAR4Adx06dPzw866CBH FsTitmSXv8auXlZSJ+4evf9SEAF+NoBJgGeeecY9mgjQ41NPPZUfeuihbdkj9rO6TvRaj19/gUMSoLlZAPmIGu/Sa6 GGAGi/9MK8XiQBNP+bBJAcPuuss/LzzjsvnzdvXv7lL385/9CHPpS/973vbZ0AYQLgzDPPDFsADCgBEAAAgwkA7f5v eisnCwAAYDQFgF8OoFRPXwL85Cc/yX/xi18gAQIN/KokgIkAZQPoiDe/2ZvVdpsE0Bnwep1HH300v/rqqwMRAF4A1k PwX0cCRD+xvBO4F7MBlOavgF9p4Lo+brvttlbwbyUDJowy93fL8v2nbZf/+kfXueBfSASE0VeiPBvAbwBYmSkQQfCn +V7yV/O/Uv+/+93vuuBfKBNAEkDXw8EHH9ySAJ/97GfjKAPoNYsokmuAQAuaEvxr9x8BAAAwRgJA3Z6V3ulLAC3+br 755vyJJ55wu0JG2WscusvEFlloC6Ced4nDkgAWzBclgIJ7CQAd8+Y3eLOUb18APPDAA/n0Yy/IF9/1YHQSoLW7WxLc +QIghYlFAfr8fd7vgnWNu8ZfmARQ0K/r46233mqr/df1pO8/6qij3PUhWSQBIFQ+8uTSSwISAN2zAapEUSy7v7onSP 5q/hc67s8kgATAsccemx9zzDEtCSABIJYsWRK+ABhAAoQoACzwItgCBAAADPM9bfD3aKgAsAWfuj1LAKjmU2mf2vmx xZ8WfVrgaWeoKAEU9K+8dG4LJEAzJYD1BvDRUYDFRm+W8q0AT4Hfiy++6F5Dwf+m//pTeGOb1RQAFendqaX1Kki3tH 3LBtA14PcGMPzgX9eFZIEeFSAKlY2ohER9JO742ufda1uGQDDXTla33v/dSy3Lwy8d0T1B8lfzvwkA3QdMAKgUQLv+ H/nIR1oSQPeQKARAnxKADACAdup29LdAgUaAAHGg97CBCGiwALAFn3b9leZpNZ+2+LOFX1EC2GL+//3fW1y67+9W/X 9IgAZLgKIIKBMAfo23SQDLBFAdtwgriOssAeo0eUtJApgA0K69du813n42gK4XkwE6PtRP+xcK+JUBoKwRlY5IAuh1 dJKErjc1k1PPgNCun7IykarroloAZEFlCmiet7nfD/5NAHzhC1/IDzvsMHfvkAjQ/eGb3/wmEoA+AACt4/26SQDb/S 8GC0gAgPCzeorvbf42DRQAWuypxlcLdEv3LKZ9Cl8C+Gy48xv5s8sWOwGw55575ocffnhYgWIP31waNJYEAE2VAFde eWW+YMGC/NRTT80/9alPuaDOP+9dAkDXglK+fQGgMX5xxTVunCV9opIAhTFNWQBot1679tYAUu97ywYQul5+85vfuC BQH/9p3f/J//3Bpfmln/m7fPpHPuayRVQyIhGgn1dZgV5XAkDXny8BmnwNtQfxI8sAul0XnQVAFoQA0Hzvz/8W/HcT APrZ8EThyJi+HwHQVlYEQABQKQH877Hu/2QBAMQ3B3DCR0MFgC3stZBTLwAt+JQJUEz79CWAygO0yNMuoCgKASEJYC IghFTffiRA1RniTWwe50uAk046yaHxqcoCUL23vldf18/+6w0X5huXX5W/8i/X5vdfNS+acoBuWQCp7eppt1679gre tYuv3XwF8xICfqNAMXHixPy8A3dx14YEkTIGVCpi/SKEgn+/dEACwCRAk7MB6u3kZ73NMQGdHa85XLJX831RACj4nz 179ggBcNVVV7UEgPoEiFBFQNaLBKhoFpkFvHBjsQXDuI6qgn/NCcXafwsSCBQA4usFYIKP93YDBIDf8du6fmsxpwVe Wdqn0MJP7LPPPvkuu+zizn7++te/3hIBhn8WeHMXfyU7en2uEsvW9U1c4PsSQItzSQA7190Cf+v0rmZv1kTQJIACf5 V4/NuNfx/o7l49CVA33TvWLADt2ksAuMD/nQaQ2t3XLr92+7Xrb4GdrgeJIWWH+CUi4r777svXr1/fCvaFCQCTAMpI aeK1NAyB10kQtl9bYUgAm/99AfCe97ynJQBUWiQBoJNk7BpQk1nhXxehSIHa94Vi49DSayCsXRst1Fhwwei8r7L83B uW57/83f+07fpLAggCBIC4hQB/i3EQAP7unR/4G1qQ65xn1X9XpX0qNVwCYNddd833339/t/CTBPBfx86S90VAo3b7 sw679/2sECsW9k0TATYWM2fOdAt4CQCNte34K9C3M96t07vGUinfxXrvYAVAxThnHQK2FJsB2hhbA0gF99rl126/dv 3/94VH3NfffOhWlxWi0hB9/Pzzz7vGcHqdLbbYwn1OEkDNJR9++GHHD37wA8f1118ffKp4aep46/8n6zZNBFEKYBLA 5n+h4L8oAHSCjASA5hNfAvgiwBcC0WQClDSMzLrcKkLYsWHBBaMtALb76AEtCYAAAIgz6LdHynvGWACUBf1+4O/vzg kt3nXEk3aILfC34L9KAEgS2M6yvU6VCBh7GdCpfnfAVXnWnfLfN/4ZAHouCaDnCvb3228/h53xbp3eldFh9d763Mkn n9xK7Q1aAGT1xrL6eklnsSYkALTLr91+a/QplA2izBDrC+ELAAWHRtkOcBbh37HtZIA8DnkkCaCyL837Pn7wr3uGLw A0j5gE8EsBQgr+/R4xlRKg8khIXwJkhesDIF0U9BcFAN3CAeLtA1CUALzPx0AAaDFWDPoV1Bnq8n/JJZe0oSDPJICO evJTPi3tsygATjzxxLagsYzxyQroIejvRwL08HpNKA/wBYDYa6+9WtiOvz+Gdsyb1XtHlQFQc8xSDPqrRIB2+bXbr1 3/smBemUAbNmxwzw888MB88eLFLb72ta+5xpP6fKzBvx/0ZR3+C1EACJV9ad43/OBfWBPAT3ziE+4e4UuAYIP/Trv/ XeeLkeUALGIAAXCAY9pxC5wIMAnA3wYgvuDfl3vW64P3+xgJAOPss892zJkzJ581a1Zb0F6GJIAWeJbq6ePv/Ahr+F Rs9OWjXeSLLrrIBZa+CGhSwNeTBBjgdet0ER9NAaDxKBtzjY2yN4pnvKvmW2nf2vlV8Bd0D4Ceg38mHRMA2uXXbn9x /PVc58b/6Ec/chLgoYce+lv5wF8D/xtuuME9Si5KAJx55pn50Ucf3SYCYhAC/nu6jgQISQRYw1f1fJH0NfzgX9x000 3uXmMZAgcccEBLAKxatSrcMc6zWgK5kwAg+Ad4936h4N8eTQLEK4YBwk7f7/dn/ZR/dv/HsQeAiQDt6gsL5u1jHwvs JQHUGNCwdF5/50dHySm4/+IXv+gyBfToLwoNlQno9/ulAGNbDjBECZANh7FeFPoCwO/Ebjv+9tzkjN2Q1fit7BSAIE 8CIPgfuBygbNzt8xIByvbxswCUGm4C4Nxzz20TAFOnTm09j6UEoBcBEIIMMAEguWP3BkPzv+b3RYsWtUTzxRdf7Hb/ JQD8LIAf/vCHYc4bNQRAVsg4QwIAlN9DLAPA5gKTAAIBANDM9P2mvBYCYABMBGg3x+eMM84olQAK9osUd37Kgv0i+p 3NmNyzcWR8/9+LAsCCfl8EWPB/1FFH5evWrXNjpu7vagCnGnClgVu9t4K9sG7YvaX910kCYVIaKQE233zzEQJAjwr8 df0poCwKgJgkQN6HAAhJAmg+VwaZ9YnRnH/aaae15nhx9913OxT8P/LI3xpGauxNBoRb3lFPGpZ75Iw5A7hHeJgIkA Sw5/ydAMLPAIAGCoCy8gBfCihFVzJgyZIl+bXXXjtix6cY/GvnR4s/n7LXVgCwYMGCBk3wnev06/YNqPszTVjk+wKg U58G/wat8991BJyawPnHvCkQUMp3WDt6w8zKYDFfBwX2CxcudNeLBICJAR0RaMG/Pq+ypCibAlYF/RVfa7oA0BzhHy VqGV8276s3gMa1uNDX5/UzenzssceCzB6qJwCqZO/4ZX4BNL0fAME/AMAYCYC6UkCNncRVV13lznnWbp7Q56zms4hK C6ZNm5Yffvjh+SGHHOKkgdUEf/WrX23wRF8vwO+vseD4p/t2EgDF4F9nwGunT492FJx1eRdq9qagLqwsgN6C/7Lxyi rqvaGzBPjKV77ign67vixIVPBvWUdqNBnrpP3uiQDeRB6QBCgTAEJlX74AOP744/PLLrvMoWBfJwL43x+7AKhzb2DO ABiZFcDfAgBgnARAXSlQbC5oOzxa/O28886uo7wEgJ0gIAmg71Hwr+ZQ+p5wJv2s885+zQViE9J9qwSABf/Wl2H/ad s5JAAeeOCBfPqxFzgJoPFSXwih52r2pp9VynfoAqDsdIbysfLGkzKAgRZ5lkmi4FGp5FtssUWSE3poAsDKhTSXFDMA NLcbEsW6L2j+lwiw0wPWrl0b4Fj3mgGQdblnEPCQZgoAANBQAWCLP6H6TS3khB31pIZPtqOnXR8TAEUJYFkA4qyzzm qlAgchAd550vmYpzqdokfu/o2HBPAFQDH4f/z6C/Jf/+g6JwAOOuig/NFHH3VZAMUArtjFPeQ+AFVHM3YKzEI8zq1p qLGoBMD8+fNdOvmkSZOSDv6bLgDsKFkTAJpH/Aavyvyyuf+II45w94L777+/FfgvW7Ysf/DBB/PNNtssnzx5clQCoG 5PkfE8BrZfcTear9+pMRTnwgMAAIyjANAiQAt0PUoCqLOzHfWk52r2pK+ZANDizxaACiq1A+SXAvhpwKFIgPZOzuUS oN4CMe+ywzx+AuD/LDzBCQA9LrvwS67+XxJAaIyUwq2dO50EYee7WwO3OARA3lEAtNJ88/DPdm9KcCG5JAFw3HHH5R MmTCADoMH/Vs0RJgHKBICErzABoKB/7ty5+R133NE6QSbsVN/BJQDv+3eDe/+IqKqvIwAAAAAaIAB8CaBjnoQJAC34 lPapwF/P/WwAXwKYCAhRAJQF+llfC8TxFwB+8K8Gf9eeeKAL/sWTSy/JH1hyhhMB8/d5f77Pzlvn69evd2NlAsDOeD cREKIA6CUd1xc9SIDhoGvp0ksvdbvCqU7ooVw/3QSAer4o20sSwMoA9t9///zmm2+OpMZ3EAEAZQG+BfkW6NtziQEE AAAAwDgKAJMAS5cubZMAJgLsaCer81Tap3Z+tPjza0J9rr/++rDKAEokwMhGcFntRWI2TqnkvgDwU/8V4AuJAGUBiD u+9vn8iBnbus+r3lepv5IAfgaANYVUp/cwJEC/O3PtP9PpaDfoTQBsueWWSU/oIV03JgHKBIAEr5V86fskfjXXxyMA +pMACIDOEsB/3PRW3nrOudEA9OgAgAYJgGI2gH/OsxaBkgBK+9TCz7j88stbfO9732v9fJgCICsRASODy86nB4yvAP B3//2vmwgwlJotTAA888wzbry+9rWv5ZdccolDIkC13Or03vyx7HX3v1rcIAAgNToJAGV2mQTQIwIgXgEw7dAThhZc +Dv+BP8AzQr+x/q9yKkQzbsGmIsTFwBlWQCrVq0acc6zZQFYvWcnrH48pDd7VvG8W71/U3b/TACUBf9l463vtSO8JA Aefvhh9/lTTz21hY5yE3bMWwgCoH7qfw8CgAkKEpEAEog6ucGCf0lAm9dNBAgJAEnfuBZ0IyVA+zyehgAY5pjaItOH 9xpAMwRAp14dg7xf7Z6x3UcPcNhzJEC6AggCEAD2+MMf/nDEOc/q9iwB0Ol1FPgraJw1a1aQAqB7U8CskbW/Wrz76f /dxltBvySAYQJA43fmmWfm5557rhv3kI51HA0BwOQEqWUBXHTRRS741/t+wYIFTgLoqFdfAqQhAMrm8zgFgAJ/Hxbp AGkIgGIg6GfuqHSn1yBRc8e5NyxvocB/2nELEACByB9IVABY8G+fUxmAHfUkdNRTtzevGgAaQQ3AiJ3/vENTwGYKgD rBf5UE+MEPftCanG3nX0eEhZPJ0c853OVjiwSA1MsAbB7Re1/Bv06G8TMBUhEA5RldcQkAjaGCfqvZRwAApBkIlomB XjMBNHf88nf/00LBf5hHS8c95jRjRQCMyAAopvA89thjjrVr10bd0TvrIgZ6Dy7zRguAogTwBYCVcAil/4chc7I+x6 iLABiHfg4ATZpHNCco4D/rrLPaBIDf8yVOCVBV1hWfACim6bNQB0gjGCwGgmUlO0UJUCYF/J+x1H+hLACTAH5JAGMw vmPe6bhWSEwAVL0h7Ws6J37y5MkJD1LWeAHQS/DvCwBhpzf4Y25HOtrzrbfeusETd7/j03kx7wf/iABIUQAU5wRh84 UJw9AyvgYViVk2vj1fRmsNwC4d9Nvjgb9HmOPnC4CyYzv1uMesE9oyAsoyBKoyB8okAHNMMzIAiuPF3yhBAQAJX3h/ nYivvPLKEdkfVsZhPR10GoC4+uqrXR+ITr0gYsj+yGr8x/UDsUqAMgFggb4vBW1+iEcA5JVCsOy9z3wA7Cb+iXTiSC RA2bGd+h4TAH7QWBbw27VQDC59CYAAaKYEqJMNYBkc/B0RABCRBCgKACsB0OL+yCOPzE877bR8/vz5jksvvTT6M94R AAB5qQQoooavcQmA/uYFrhFIMYhAAsSTydFpLH0JYIGjH/AbkgeGBZXWGJDgv1nvXxM9dUoC1M+B8UMAQCJCwBb3Eg A6GuyYY47JjzvuuKh7QbDYB6ifKk7KOECawUPZEY8IgLhLOnwJ4Af6JgyKX/MFAPeKZgo8fwztc2U7/8reEHXLxwEB ABEs9idOnOh6QEyaNCmfMGFCkm9Ogn8AACB4KG8AR1Ox9LIF/NTxYkYAR82FVQpgEqdsvPQ5K+Gwz9mRsTSNRQAAAA AAQOK15Pw90soWKJMBBP9hyZxiBkcxA0ACoC0j4J3gHwGAAAAAAACABAOJYuM4SLd0gHKQcPs/6H1cluFjzf9s51/Y +x0BgAAAAAAAgER3/wn8AOLp/2Cd//0SAAX8lAAgAAAAAAAg4Vpi/5G/C0BkQepfg3z/FAAaOyIAAAAAACDRnX8aAA IAIAAAAAAAIJG0YYJ/AAAEAAAAAAAAAAAgAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAAAABAAAAAAAAAAAIAAAAAAA AAAAAAEAkcHRPAAAAAAAAAgASCD4n3/nhnyPWSfw9wAAAAAAAEAAQMwo+C8KAIkBMgMAAAAAAAAQABB5VsCN6/6Ub3 qL8gAAAAAAAAAEAERfFiAJYJkAlAgAAAAAAAAgACBSCWBIBlifAEQAAAAAAAAAAgAilgEqB1BGgEQAZQEAAAAAAAAI AIi8LMBAAgAAAAAAACAAIGIJoCwAMgEAAAAAAAAQAJBABoDKARAAAAAAAAAACACIWADY8YAIAAAAAAAAAAQARC4AKA MAAAAAAABAAEAiAoDgHwAAAAAgbaZNm9ZGigG6/x8CAIJg/2nb1Qr+rQmgHv3P8TcEAAAAAEgv8H/11VfbSEUCZB3+ QwBAsBIgy7IRO/+q/7cMAAQAAAAAAEBa7L777m0Bf2pZAFmX/xAAEIwAMCz4P/eG5fkvf/c/LQmg4N+gDAAAACDunT 2tBUSqKb1cCwDlKPCXBEgx5b8oAOgBAEHz5kO3OiQBfAGw3UcPaBMABP8AAADxBv9+Ou+qVauSEgGjvZsHANBYAWB1 3vzh0+GCg6fmxx57bP7AAw84CeALAL8UIOZrg5v9KP1dM/6mAAAh7f77SAJcfPHFbseP1N507tuD3LtTzR4BCF4AWL CHFEgHEwCL73rQSYBpxy1wIsCyAGIffwTA8Jm/z/sdLAYAAMKVAgr+JQFI90Xe1/3ZTZs2JX3fT+F62XvvvfMZM2bk u+66a77nnnu68Z4yZUqSc4ONdyN6APQbtJd1eafze/xMnfq3LAC7boQvAWKfyBEAw2PZhV9qcfMZs1yGiYkA/j4AAM 1k4pSJbp62xXzKfQDI3htMAGzcuBEBEPH/3+zZs/MXX3wxX716tXt8/vnn89deey1fsmRJPmnSJLKFxloA+MGb3629 18C9GPwXa78RAfFKABtv1fz7EkCkkAXAdTBY9pCC/seuPc/xrzdcmE+fPj0/6KCDHCk3lOLaAoAmo0W7Fu9axGsx7y /uJ2w/IekFPddHfxLgqaeeQgJEGPhb8O9LQuOkk05qfS3FNd24CgAL/I1BG7fp56wBHOfAx4/S/22ctXNrjQHLSkMA yrKEXlr5LXfdHHzwwS7wf/TRR/Orr746uYUAi0gACCVY06Jdi/eyRb2+9sEjPuiErkgtC9BP7011Lu90/y7LFEEAxC cArrjiCjcXCKX/l43tTjvtFG3mUJ013biWAPgSwM5w989v77cnABkAaUmAsvQ/xh3qSEJdM7qG7r777lZvienHXuD6 S9j1pLISdv/Hb7zo6wIAxQBu8502L/2aFvsPPfSQ6wMwc+bMfK+99kpa5sYU2NUN1roJgGLNf1EAxF5OUnZNxCYAFP irH0gKDUGbsqbLBlng+TJAi/RBBIClhRMQxs2hhx6an3baaW3XUVpjnb0D10InjjrqKHednH322a1rxG4OutFr118C QI8K/jf915/c5xX8W2+JOK6TrPTaabIA4EhPAOgFzev33nuvkwApNgSMUQCo7GMY6dplNf+WOWKyyD5uUn34MMeySg D4nw/92pk3b14LjWtZtpAofi21OWBcSgDqZAT0KwHsdUwC+CnhLCLjlAD+EYDppf/HKwCG8Z7VpL5u3TonASQAxD33 3JOffvrpbRLAULCvkhJhnwtdAmQjJEBWIQXivAYAIN5sgCJbbrllC3b/wvx/sKMd9VwNH9XzQWUfZZkfg9b861G9JO xj/Q79rvXr17vf3enfNlYB/6jUa3f5eKxqx0cj8JfAeemll9q45ZZb8ocffjh/5JFHWs0A9ahrwQhdBGQD/jduAsCX ACYA+ikFKL6OvRZ14fHXdds1w1jHV6/fT0CoI1+Epf1ZJoCQADjhhBNaAsAaSFqw/+KKa/Jnly3O/9//vaUlBkLOEO ksAbjWACC8NF8t5n/961/nv/rVr1oLfZUAWBmAiYAU6nxjaQ6o4PrVV19tBdkaOzV8LNu1Hw0BYJ97+eWXS6+b4r9v LATOsNP2uwmATq/f9OtKc4AkwG677eaoEoVlKDsk9GMhB3nvDzKuQxUAwwriaAoXf7qf3rBFCZDOeGfvBHfpCIC642 tNIcWuBx/dkgDf/va3WwLguOOOc1//5e/+p4VOlNDPvvIv1+b3XzUvYAFQNxMgnGwQ5nGAdHb4+8kE2Gy3zRySACYE KAXIghUAOuqxLECX/BmWAHj22WdHvL6CQf3usn+fvjZWAqBq/MZCAHT6fIxNJlM+UnRcSwDKygD4o0LdMgArBbBGb6 lJgFh3csuC/7qNPveYdUJbDbllAghJAOELBQX5VvdvEuDfbvz7uGrDRoiAMIJ+P5OLOQ8grRR//h5pjXsxA6BY/6/n yvzo59qw19Nx0p0EwHPPPecyCMsEwJo1a0a1DGAsMgDqvH7IAkDja0yePLn1PJV5ZayzgbJhL/gBepEASu3WDm+aWR /xp3QX5U6nbAAF/34vkIO+eK7bRSg2jPSPIPVFgC8BYgr+Qxprew8Xj4rttzQMANJiu+22y7fZZpt8wicnODb/5MQk swBCEwCrVq1qEwCrV68eEaCr7KNfAfDCCy+0CYC1a9eOeH31DpoxY0apAFi+fDkCIJDrao899oi25n/QUqHGCQCAfr DUbjsVAAEQpwCoe9TnySefPCIDwA8m7XN+zxGTC8KXAOFeD3FkfxSlzSD9YQAgLc455xyHSgFWrFiRT58+PelSgBAC N18C+BkAftq+yjsGyQDQrrB9/OSTT444BtDOkC8G/7qGRrsJYDEAb4oACDX9P+aa/6YIQgQAjGsGgO3+p9kMMP4ygD pHfdqjrgWTAH5fEf+53yTUsGsm/O7/8V0P/hgjAdJGTZ6Sr7fkOuhZBOgUmAl7THC7gikv9pt+/ej+q74Ndo77hO0n tAXkgwoA7Qb7GQArV65sHQOoR3WL3+GwHUb8rL62aNGiMRcAdYP2Ybx2nRMAYpl/KDMiAwAiTRWnnCSeXf9OEsAfb3 u0Sf3D+1/QJgGKwb5lApSdFMKNoVnXQTHzg34AaQsABQD9/rx+VkGg0GuFFhAOuggPdVeY+TgdFPz7zRs/eMQHXRaH Pq+THfRczR4HFQB6DV8ASDLcddddrY+b9B4f1nu2jgBAMgICAAj+oRE7v/7HxRNDyrIC7GYvAVBWAlAsA0ircWTY1w ECID2uuOIKtwto5zwPkgUgAbDVVlu5wF/nQ4cgAIYZtId+VBykh0o3JATuvffegQSA2LBhQ6UA0KN+z3gLgLF4/yMA AAEAUQeMEO84+13iq8bddo6eeOKJ0iaAxZMFop2gI8sKkfDhfZAGs2fPdkG/dv9s919nPOtrtpCvi4J9/bz9nEkA/3 eFEPz3m87d7ZgxFv7QVAEwc+ZMF5xLAOhREqCf1/JPAVCgXyYAmpZtMsxGbp0CfoJ/QAAAQDTSxyTA5ptv3nZj53z5 5gmdfkpDIJ60Xx0BNtoCQAG//ZxeRx/PmTPHfXzIIYe439Wk1P6xEAAEANB0LDjXc0kAKwPSaQ+9vM7jjz/e+hk/+L ff0dRSk6r3ab9zAAIQGiMA9KYLt+kWAAAMo8Z/mLIAwkCNtRT8W+OvYvBvDcC0QPcbgCmQ7yWFXz+nJl9FAWAlBXPn znW/r9gtXp8fqx2+XnfshxEAdBMABAbQJKwMQM911KOaPPYiAPQzen7HHXc0Lt1/0CB+NH8WYNQyAEwCCD2fv8/7Hf yBAQAQABC3APA7bCvo73YEmI7zsu+pu8Z45JFH2rqA6/X8JmB6vbJSgOK/b7QFQJ1gfFAB0EsNMMECNKekLWtlA0z4 5ISeBICO8rP3exPr/XsKuvoQdAgAaGwJQNl5jcsu/FILCQG6wQIAxBP8F3sxIAPSDv7FjBkz8tWrV7fd7/VcO/Z+Bo C6evciAIrngPtCods54KMhAbrt/o+FAKgT7NMgDJqELwCUDVBXAtx+++1tAiDUeKLfeSCkIyEhwR4AekNOO/SEVq1n UQjwBwcAiEsAWF3/sDMCxuLc5maTBSkAdt111xG7+5bC7wuAXjMA/CZgRaFgn5N4kICo+29NQQCMpwRg/QdVbP7JiW 5X/+yzz+76vRP2mJDfdtttwe76131PD+t7Y88iYU5pqAAoduxmkAAA4pQA/pGOw27yd+guE/k7BygA9txzzxG7+5bC 7+/YP/XUUz0JAP/7i6/nSwIJiKYLgH528er8fBMFwKZNm/KNGzeWZonWWcwr+BMhp3wP4+8eY/Cnnh0a2zoC4M4774 wunui1BCD2e4r6wohO84TmEs0pMcaWdeaKYc7j2WhM+BgaAIA0sgBMABSzAcq+36jTOHbx3APJAmjwPbQqqNZ9/7XX XisNzocpAMqyDIq/dzwEQKfgfCwEQK//1rHasdP4GRq7F154wT1KFgmd866P1exNaHdYad/a+Y0h+MsG/C/moK/b9z S5y/9YSIDYg3+VcxnK7FK2mASv5gPhzx0xxpbjNQ9wDCAAAAxNAvh9AYqYIFDX+G438bgFQBa8ALDAujhGU6ZMyZcs WZKfdNJJ+U477dQKAv2sgGEIAP/19Hv0+/R79fvr/DtHa8emasE2mgKg2yKxCUGkvzGkUg6hng723NBRb+r2rqDPSH nBT9o3pLDzv9VWW42YC2x+iH1Tebze/wgAAAAYSABseitvlQOUyQC/RMBu5GtuWkAGQOACoIpJkya17dAriCvbsbfU 8G6BY/H7LAPA0sLtY/3eJqZyDnpMX52gvmlBPvMjAPSS+p/qnDNu2VlcfAAAMIgAMAngiwC/R4DfJNCC/+8tOC0//P DDK4N/9QCIXQB0v+kHvKgpHANY3PG3+vA6AqD4fWUZAU1fAI6GAGjimNet+ffZbLfNHBI6K1eudOe8q9O7dYxPZTHP 7j+kyLx581zqvyTAbrvt5qg7d8TQE2CQ9/2g8w0XIAAA9C0BfBHgf6zg38SAfd0XANbVPcXgv3sQF8/ivyrlv07gXv Y9vZYQhFLrO56vN9o1/1br/+yzzzrWrl2bP/nkky7g94kl9T8bwn/cXyClDABJAMPvCWD9ADR/xNgTYLzmCAQAAAAM XQRY8G9N/ywjQM8V4FcJgNGq1w4nKMyiCv5HI2BHAOSNDxD9XToL5svwA/7YjnmrM1YE/QDvMmfOHJcRUDVnFD8fcz +A0Z73EQAAADAqZQH+aQAK/IUkgASAUSwDMEmQyt8rlUV/3Zr/sXqdkMeaQBEAABAAAADQuGyAsq+ZCFDwryBuwoSs 9Ov8HeMTAMOo1RzW6yAAxjYTYPOdNi/9mnb09t577+izAKj7B+jM7Nmz80MOOSSfO3eumxOKc7xOe0npNIAxySIDAA AAGItgcLxfA8Z2zFW3q2May1J6deb3XXfd1Wr6F3NaLyUAAJ3RXGEU5wrNIcXTZFIqARj2HIEAAAAAAIBRQcczrl+/ Pn/55Zdd+cZzzz2Xr1u3zi3mdzhshyia/vW6y+8v5gn+Ad5l+vTpLhtA88Pq1avd42uvvZYvWbKkMUe9jvecgQAAAA AAgEYzccrfSn723HPPfNddd81nzJjh0nxTrLtlxx+gO5ofNE9ovtDcMWXKlGTnCkoAAAAAAAAAAAABAAAAAAAAAAAI AAAAAAAAAGggOgUg+cAcAQAAAAAAsTFt2rTkjv0rq/HlWgBo59VXX3XzA3MDAgAAAAAAAg32i6xYsSJftGhRUgv60e zqDRDTfGESwCc1ATCacwUCAAAAAABGfUGvYwDXrFmTL1++PKlFPQIAoL85w0gtIwABAAAAAABRZQGkmtZL4A/Q+5yR cinAaMwXCAAAAAAAAACAROQCfwgAAAAAAAAABAAAAAAAAAAAIAAAAAAAACBJtt9+e0eyf4N3oyoABAAAAAAAAMQtAH S6Q7ISoD2yAkAAAAAAAABAvALgjTfeyH/84x+nKQFGRlcACAAAgNqTUpY5+FsAAAAgABAAAAgAAIhcAGzatClpCcAZ 0QAAEKIEuOWWW5AA3MMBAQAA0JsA2LhxIwKAawEAAAITAHfddVeaEqD8Zg6AAAAAqCsBnnrqKSQA1wIAAARWBpCkBK i+mQMgAAAAutX8IwAQAAAAgAQIPwuAezkgAAAg8uB9GDX/RQEQe2PAsmAfAQAAAKELgN133x0BwLUBCAAIlWnTpjlS 7dKevfMf18LfmDRpUv7iiy8ORQAUa/71XK+91157tX2s3xnj9VAlAPzPp3L92TxjpDrPMN8AQIgC4Pnnn09XAlQvdL g+AAEAYS7KX3311RarVq1KSgRkJf+lKoD0fOrUKfmSJUvyk046Kd95552GXvOvRy0i7GP9Dv2u9evXu9/d6d82FgF/ 9r/elfD26EiAtuD/be/3/W82qjJivK8vf54RqUiArMN/3IMAIEQBkJwE6LzQ4RoBBACEvSsnJAEuvvjiJCb1rMt/qQ ggC8YUmL/22mulu/ajIQDscy+//HKpdCr++0Zz/Ecrbb+TAOj2+qFfi5pD/IA/tSyA1OcXCBe9d5NK8R4BgV2dLABx +umnIwG4VgABADEEhZrMJQFSffOkKgD23HPP0gD9kUceGZoAePbZZ0e8vkoF9LvL/n362lgJgKpxHwsB0OnzoV6Lur Y0l6SY8p/aXALxCQB7/6YqALKWCOB66JQFkIwE6L7gYd5AHI77dYAAgFoo7VoBmIIvS/1PqQ+ApV2nukDXWBczAIr1 /3r+61//uq/rwl5v6tSpHQXAc889l++6666lAmDNmjWjGkCORQZAndePUQAAQLgLeQV26UqADAnQQQL89re/HVEKkE YmABKgjjjccccdEYcIAGgqarymem+lfGtCV6C2evVq95jC8S4dk3P/kiUjAFTy4QsAXQPFAP1Xv/pV3wLghRdeaBMA a9euHfH669aty2fMmFEqAJYvX44AQAAAAAIAAdAQAfDKK684OW8SwARA/BKg1sIn+P/Prbfe2tGvANDcEbQEeHcRNo AAyBAA0MzAT4G+GrD5O/+Gvnb0l7+UT58+3RGzAKj62h/+8Ickgi9fAvgZAH7a/ksvvTRQBsDkyZNbHz/55JMjjgHU 9+y9994jgv8VK1aMSfp4sQygCQIgpuBfYyvBoywPyzaaMmVKkqUAna4zgKYJAAV7CADeq8UUb5Xmvf76620CoCgB6h BsinctCVCH5goArft6FQHRCYCeRQACAAII+kRZp3d9Xgv2hx56yPUBmDlzZuvYtuj+Dm9ntbMDYr4W/KaPMvx+QD6o ANAC0s8AWLlyZet60uPDDz+cf/Yzs0b8rL62aNGisRcAf6nXGHAQAVDsOSDZFOvu/+zZs9uyi3Q9KOtI2UdNOv5xvL KNuB9BUwO9K664IuEsgCx5CVAWsM+aNcutESQAVAZgWQAmAK688so2CWDPq2i2KKgI2usvgIbI+AiAyy67LL/11ltr SwBfAGj+CFYClN/I+xAAGQIAwpz87733XhccptgQMKWFerHpo7I/JID0+S233NI932233QYWAHoNXwBIMuhGMd6CqT jGfvaH/feXv/xl4NfWa5QJgBivLwX+FvyXZRkp+6jYbyLWeaTXDKTxTvvsJ/UzCvra8YnzfvCFL3whYQGQJSUAqoJu XQPiuOOOa7Hffvu1CQCVAqiEzwTAggUL3Nyu4F6bRxboX3jhhT2ha89OkBn9a6/HYHyMBMC7vy4bt/uBJMDixYtrS4 BoBEDfEgABAAFmAxRR4Gck+XdJeJdOZR8SAhJAgwgAsWHDhkoBoEf9nqZlmJTt1CIA6qMbv4J7yyQpC/J32mmnaJuO 1pGHTRxzW/BZ6mfSAiDg96QCNJ9BBECQEmDgccySkgB+0GbY2ItLL700v+SSSxyf+9znWgLgsccey6+77jqHCYJTTz 3VCYBjjjnGCWA/C8AP7quwa82ut7G55sqCtiEIgHwYgX/WiHtCXQlg19K3v/1tN57KGElLAlRdSwgAaCBapOuYN3V6 V7M3WwAq6LMyABMBKSzWSdf9mwCQvbex16OuhX6vLxMACvTLBEDTrqthjn+ngD/W60pjnvJxQCHPGVrgKe3Tr/9MSg ZUD2pQAkCp2TquTfQqA/S+VTCnwC8KAdBHGm+KWQAWeCtrrygCFNCJ+fPnt3oAfOtb38r//Oc/53/84x9b19qnPvWp /PDDD3cSQEgC6D4vAWBBYXMC/5GB28jgu7MEGPHpASRAkwL/ogD46U9/ml9zzTX5fffd1/F+UBQAJ554YnwCoOM8gg CACDIBtFsrFPiZEPBrxWNHu7X+ju27C/o0RIAF53ouCaBrQM+32267nl7n8ccfb/2MH/zb72iqVKoK1HsN6joF/LFK pXnz5rWwMS6j+LWUSgCanAWgnR7t+JgMTiojYODgsTkSwBq0WXBWlAFVQsAEgHZ8bSEflQToOqZZshLAsGC8TAQomN 93331d8P+BD3ygDbvO9PXPf/7z7nt9AVCUAPb64xf4V/d96CYCyoL+UhFQM/hvYmNAXwDovvCNb3zDneRUJYZ9ASCB qHE/7LDD4uoF0HH+6JRNggAAgMCwMgA932abbfJzzjmnJwGgn9HzO+64I8iGkoPs2qew418M/JUB4AePQvWhaviobC NrBqjHp556qkUsIiDr878mSgAt/EQ/HaGjlAABvX8tyNd7T0GWLwP0/hNlIiAKAdCLBBgxpmkKgDIZUCYCTAKYAPjt 4g+2BIA99yWACQD72ebs+neXAZ1EQFsygH8dvSMC6giAJu76V0kA7f5LACgTQPeHpUuXtt0P/FISjbPmD437kUceGW cWwIi5o1spCQIAAkQ7uAriJnxyguOTn/xkkim9fnZAatkhlg2g8e9FAOgoPwv6m1jv389OLgKgGi0UJAEsg6hq978M pZVu2rQpaAkwzBMjmiABbLGnxd9zzz2XP/300/kOO+yABAgsG8CXAJ1EgHV6V7M31Xsr5btMAuyz89ZxiYAe0rRTOh GgTARYAK8AX9dQMQvA0Fyu68gyAXwBUNz1v+DgqQ29pjqLgKzD9VUng6DpxwH69wPN/7oXXH755fkFF1yQL1y4ML/2 2mvd13RP6CQATjnllLglQJ7V7CWBAIAAUdAntBOsoE514qnW9abYHNAXALoG6kqA22+/vU0AhBrcVR3l16sAYC6pV4 bE36MZiz7b9REmAkwCRJ8N0HcKebMlQCcRoEW8XyJgTdyqJIA4Ysa2EZUEdBcDKR4L6IsAu4asFECBvh794N/kgARA t+D//yw8Ib/2xAMbLpWqA7wqCZDVyibJgrkXaN7X/O9LAHHjjTfm3/nOd9z3+MG/LwDOOOOM+AVAjgCABETA2WefnU /YY0K+xx57pBekJB7QKftDAkjXQLfv1TVy2223BbvrX9Ubol8BkBJq/GhMnjy59TyVID+WRqJa1KnmU5kAWvRp8Xfn nXe6z61evRoJEKAEKGYDCDvSTVk4RRTMWRDnB2/LLvxS/sCSM9xjEBkB/ZvJ5AVAMc3bRIBJgGeeecY9mgjQo8q6Dj 300DaBZD+r+V+v9fj1FzgkAZqbBTCyxjsr6RlQJxhs7yEY1jUk6SsJoPnfJMD555/vYgKd7qCMAN0PrHTIFwDBlwH0 KhERAAAQI8r+UHBfRwDoZhFbsNdrCUDK14okYew1//32AwhJAmjBp90eXwL85Cc/yX/xi18gAQKTAAq8yrIBdHLA66 +/7mSA0DFv1uldmAjwJYDuBQcddJAjjPdyyS5/jV290oAvSy8j0AL3YjaA0vw1p2snWNeJxL8F/1YyYNeMzfv7T9su //WPrnPBv5AICKO0pDwbwG8AWJkpEPj9ThJA8tckgDLDzjrrrPy8885zpX9f/vKX8w996EP5e9/73tbxjyYAzjzzzK QlwFiNPwIAAEY9sOv2PU3u8j8WEoCU/5Gp/bHV/A+zt0iTBYAaPmmHx5cASv28+eab8yeeeMItDI2y1zh0l4ktghvv ngPFMHZyyySAiQBlA+h8d7/TuzV2Mwmwbt069zqPPvpofvXVVwc2rr2NaR0JkMKcpQB9/j7vd8G6xl7XgDAJoKBfc/ pbb73VVvuv60rff9RRR7nrRNeLBIBQBsmTSy8JSAB0zwaoulZCFwC6FyjzS/JX8/93v/tdF/wLZQJIAmjcDz744JYE +OxnPxtHGUCvWUQIAAAAAGr+Q1/4qeGTBIDSPrXzo8WfBICOe9LCTws9LQ6LEkBB/8pL57ZAAjRHAlgwX5QACuokAH TGu9/d3eq9fQHwwAMP5NOPvSBffNeD0UmAVmp3yc6uLwBSmgsUpFvavmUDKLvL7w1g+MG/rg1dM3o89thjHcocURaJ Sknu+NrnAxMAnXsDlAV+WUVmWGj3AmV+ae63+d8kgO4DGtdjjjmmJQF0XxBLliwJXwAMIAEQAAAAABCkBNCuj3Z6LO 1Tiz8TAGUSwATP//u/t7h039+t+v+QAA2UANYbwEdHARa7vFu9t3b5FOwp8NNrKPjf9F9/ClDm1RQAFbXdKfYDMAGg XXvt3qt2388G0DVjMkCnwvhp/0IBvzIAJI6UPSIJoNdRM0ldc2FK4aw0U6Tq+qgWAFkw9wJlftn8b8G/CQCVAmjX/y Mf+UhLAkggRyEA+pQACAAAAAAIsv5TNb5q+GQ7PsWdH+FLAJ8Nd34jf3bZYicA9txzz/zwww8Pa7HfY914pz4BTdr5 MwlQFAFlAsBv8GYSwDIBFAiK8AK4HscxcQkgAaDdeu3aWw8Ive8tG0DouvnNb37jAkF9/Kd1/yf/9weX5pd+5u/y6R /5mBNGyhqRCNDPq6xAr6trTteh5pgQrqH2IH5kGUC3a6NcAIRRKqA53YJ+P/g3AfCFL3whP+yww5wskAjQfeGb3/wm EmCUx3ZUBIAGl0UQAABAWtjCXos59QLQekCZAMWdH18CKD1Ui0TtAoqiEBCSACYCQkj17UcCVJ0h3qT6cV8CXHnllf mCBQvyU089Nf/Upz7lgjkrATABIBGkem9fAEjwvLjiGid5lPERlQQoLPhTzwLQbr127RW8axdfu/kK5iUE/EaBYuLE ifl5B+6S/+sNF7prRJJI2SJWMiIU/PulAxIAIUiAzjv5vQbzWT4eXeMHEQCa54tzv4L/bgJAPxt6+V/WiwQoaRQZnA DQTbzfn9fPqnGY0GuFeITcIDfq4iRBgzAAAGhKcN8J/+gvLei0wCvb+RFa+Il99tkn32WXXfJTTjkl//rXv94SAYZ/ FrjPuAX3HWjb0etnpZhlpS/dpEW/LwFOOukkh+RMVRaA+gHoe/V1/awCvI3Lr8pf+Zdr8/uvmhdNOUC3LIBUywC0ay 8B4AL/d3pAaHdfu/za7deuvwV5KvnRtSFB5GeJCJ0tv379end0nGECoOkSYBgCr/NckDVaACjTS4F9UQBo/p89e/YI AXDVVVe1BID6BIhQRUBP94OKkyKyJgsANfBQjZdu8PY4iADYaqutXOCv9LIQBMAwA/amHANF4y0AAPADPwvwq7CaXj vfWUc9KQW8audHu8MSALvuumu+//77u8WfJIC9jlH2u8ZeCmRdHUDJJ3pfKXYRC02QAr4E0OJcEkDBvkkAO+tdx7yp 07s1ETQJoMBfwd6/3fj3ga4x6kmAurXesUsAW0taDwgF99rllwzSrv//vvCI+/qbD93qxJCyQ/SxjoVVbbheZ4sttn CfkwRQf4mHH37Y4QuB6I4SbrtestJpIkQJYPLXFwDvec97WgJAsZ8EgB0PLXTCjCg7KSgaCVBsHFoqgBokADR41uDF dv93220397WpU6f29FoK9vXz9nMmAfzfFZIA6DV4L9v9H08BIHOvI7iqjufq9ubT+e5Cx7wFOfkO6e9PFgcAxIAWZc Xg3F+AGwr+9ajFu7o8K0i0wN+C/yoBoAWiBZf2esXfWSYFxiYrIOudIQiAOlJgrAWAmDlzpluXSQBI9NiOvwJ91f9r fO2YN42Z6r2Lzd6CFQAV49tJ0qQoAMo2liQAtMuv3X5r9CkkhCSHrDTEFwAKEA3/2vnBD37Q4vrrr49KArSdDJCXXz +DOMfxkgA29wsF/0UBoONjda/RfOJLAF8E+EIgmkyAktMisi63iTERAGb/R1sAKOC3n9Pr6OM5c+a4jw855BD3u5oW DI6WACh7vbEMJu0Npxu5ob//Cy+84B41OYsNGza4jx9//HHHihUr8ttvv93Zf3vzBj0JD/gfgQMAxCQBhDL/fNTlWY G/jwI/kwDq9uzv+tjOT1EAnHjiiW3Hg9VhbEsCRkkCZIMyPmUAeq6x1HMF+/vtt59Di3t/HLU2tGZv+tzJJ5/cSu0N WgBk9caxOnMjTRGgXX7t9mvXv2xjSZlAWlvq+YEHHpgvXry4xde+9jXXe0KfD3FHuJeMo25r0JD+nyQB1PNFc76PH/ zrXuELAM0jFkf4pQAhBf+51x+kUgJk5QKgXQJkBTk0BgJg2rRppYbdgv+9997bfaydXk3yNigK5HtJ4dfPKaWnKACs pGDu3Lnu96mBiP9z+vxYBYDdgv9BA/Z+BMBoTwL+xKqxEZMnT249N7bbbrt8m222cdeBEV1KFsE/AOVI0BIBs2bNag vay5AE0ALPdnt8/MWfsJrPYqMvHwWSF1100Tj2A8iHKwECCv6LAkD493zb8fcFjp3xbs3eosoAqJmtkXrQX5zTtcuv 3f5iGYie6+i4H/3oR04CPPTQQ38rH/hr4H/DDTe4R8lFCYAzzzwzP/roo6NM/c8ilADW1FU9XyR9DT/4F9YE8BOf+I QTBL4ECDb477T733W+GFkOkI+1ANCjfU5Bv4JxfwLXoy8AFCTa99SdFB555JGWALDXsxRy+51lpQDFf99oC4A6wfiw BECdkoBBJwIW2QAw1ljD104lRipDUlpxjHNTnXm76Ys8EwEK5rXLX8QCe0kANXoyLJ3XX/ypm7yC+y9+8YsuU0CPti j0UZlAc46JGlACBBT4FwWAZEyZ8FHQr9INP/jX+1cN31TzrbRv7fwG3QOg5+Cf+b7umtM+LxGg0hE/C0C7wyYAzj33 3JYAiPL+4E0boQsAvefttBc1fFXGl+EH/+Kmm25y87tlCBxwwAEtAbBq1apwxzrPujRy7C4AsiGuPfoK/sWMGTNcPU fR3GnH3s8AUIp4LwJAAb7EQZlQsDe5n3XQ7d85Wrv/YykA6iwIB50Meqn591GWhpCkWblyZX7HHXfkF198sSOFmv+/ /OUvDnb/Aerjd3nXPUOZX5K/mtuFX3YU4+IuxiwiEwFa3J1xxhmlEkDBfpHi4q8s2C+i39O86yIbY/JGCABhvRpsx9 +eW+aojZW6vpedAhDkSQAE/2MiCDbffPMRAkCPCvx1DVoZgOKNmDexut0jmnyvUPC/8tK5LQGgzA67JxiSv5rvFy1a 5Ob3s88+28UR2v2XAPCzAH74wx+GOdY1BICf+VFVCpCNtwBQ2kZxd99S+H0B0GsGgL7fzwDwhYJ9TuJBAqLuvzUFAT AsCVBW82+1/s8++6xj7dq1+ZNPPukCfp9YUv+zIfzHDRyg886/TnsplhFZaVHsGUkxzx8mAoRSdCUDlixZkl977bUj Fn3F4F+Lv9NOO60N//UMBQA6g167Q8X1wfhfMyPrvrsf4VX+/VU/M97XSlEAWNDviwAL/o866qh83bp1blx09Ju6v6 sBnGrArdmbdnrDeq/3lvZfpwKE+0J3FOwvXLjQBZASALpX+ALAnkcrRboIgKbeO0wA/PpH17VJAMlclY9Zk1jdA2zO t7n87rvvdij41yaBPqe5J9z+Yp0lQFZS6z8yiSwbmx4AVUH1nnvuOWJ331L4/R1728GpG4D63198PV8SSEA0XQD0Y+ Xq/PxoCYCy1CwL5svwA/5QO/33Oh6dJmNu0AC9pf6nWq6UypxRDNxV2yl0zrPkvnbzhD5naZ9FVFqge7rOmlcjYEkD qwnWwtFvBNa8AKB7gN+LIPB3/7s1DR4rAVDWlNFOafDfq+rdpPPf1QHeP+NdgYDqvcN6T9cVAL01e4N6EuArX/lKft 9997W9500AJCMBCu/5Jq9FTQD8btX/1xIAmiP8o0St3MsEgGK84maA0Of1M3p87LHHgsweqicAqjK9+pljhiwA9Ed/ 7bXXSoPzYQqAsiyD4u8dDwHQKTgfCwHQ678VAKApqLGrAkBJACsjqlt2FEtPgH7n6pDn+LIA30dpn7bIO/744/Odd9 7ZNZXTPd1OEJAE0Pd89atfdRkA1hk6jB3ArPPOfs1FYtn9fiyvi04CoBj8X3311W6nT492Drwd8WanCEkChJUF0Fvw X7qJVBA/SIDeJbDe7xIB9t5XVoCakqbSy8pEQNM3ozQexTIAXwAIze2+AND8f9lllzl0P9CJAP73xy4A6ojhMTkGUD ffYlA9ZcoUl9an81932mmn1iD7WQHDEAD+6+n36Pfp9+r31/l3jtZCreoNN5oCoNubfNhvfptkd955p9KvaddfvRii zwJ4u7twQbwA9J4BIAlg+D0BrB+A5v8YewKkXF5knaCVwqlFnbBuz6r5tGBeCz8TAEUJYFkA+hkL+vU8iMX/O086d3 qu0ywqb5wAsODfOv7vP207hwTAAw88kE8/9gInATRGagop9Fyd3vWzqvcOXQC0j1untZk3jpQB9L1GtV1iBf/Wc0Qn TSTzNyjJAGiyBPAFgJULaS4pZgBo7jeUJaaAX/JX9ws7PUDlyFtssUXkGQBZF2Gcja4AqGLSpEltO/QKAMt27K2xXL eLo/h9lgFggaV9rN/bxB2cQY/pqxPUj+Wb2/7eki5lO3Hq96A3sTX9S61LN8E/wODMmTPHZQRUlRsVPx/7Qq7f+0dI i3bbtZcEUHMn6/as56r31NdMABxxxBEOPVdQqUWgXwpgBCMAvGCve7fn7qUA45UZorHwBUAx+H/8+gtcza8EwEEHHZ Q/+uijLgug+D4unuUech+AsuC/n0xS6H1OURaJgkfVkocXFA5fKjd1nCQANE/4AkDziH+6i77PxK/N/ffff38r8F+2 bFn+4IMP5ptttlmraXwsAuDduaNzT5GquWbMBECx6U7Zjr91l68jAIrfV5YR0PQbxGgIgPH8/5FsWb9+ff7yyy87Qf Pcc8+5hj4SA5/9zKwomv71u1P3hz/8geAfAKBPAeBLAHV6FiYAtNDTzo8Wf3ruZwP4EsBEQEhNwEae6dxvFkB5NsB4 C4D/s/AEJwD0uOzCL7n6f0kAofFR2raCNB0DqV4Owuq34xAAncszW2m+ZBEOBR0rKgEwf/58N7c0ZZNwPNepTZ7/NU eYBKgSAMr4MgGg+X/u3LnulDE7PjbsmKN7iVcvgnHcBECnFP4ySVBHJHR7vRB3cZryev0wdeoUNwZq/Kg3ok5gKB7D GPXk+r9hpFgBhMbs2bNdIKebu+aU4lyvsq8Udv5T2x3UeC5durRNApgIsO7OluqpnR9dHzov2k8L9bn++usb2gSwvg QYWQue1ZYA2ThcL74A8IN/Nfi79sQDXfAvnlx6Sf7AkjOcCJi/z/vzfXbe2m0qaJxMANxwww1tIiBEAdBLOq6f5YEE GM58ouwSCYAtt9wynzBhAhkAgQsAlXpJAtgcr/n/5ptvjmQtMIgAGGJsORYCoCmvhwAAAGgWyiYyiun/Kj/q5SjZGA VAjPcAXwAUswH8o54khyQBtPOjxZ9x+eWXt/je977XVgYQngDISkTAyKyAzqcHjK8A8FP/FeALiQBlAYg7vvb5/IgZ 27rPa1yV+isJ4GcA2IkQOuYtDAnQ785c+89wlPDg6DqSAFDwn6QACey66SYANO9bvxd9rzIBJAHSEQBZeAKgl5r/sX qdkCUANwEASAGlCCsbQMH+6tWr3aNOe1HD15TSOVMKBopZAKtWrRpx1JNlAVjKZxVK/zfC+huUP+9W79+EAMAEgL/7 73/dRIBx3HHHOUwAPPPMM27svva1r+WXXHKJQyJAqdw65q35a79ed/+rszYQAIMLgFSD/xBFcTcBoLIukwB6RAAEJA CGcUTTsF4HAQAAEAYqA1CJkYI+zf1lp72ktJMT8z3AFwD2+MMf/nDEUU9q+KQFfpx/g7LH/lPLx3oRr4V7WfBfNd42 rhIAaiKsz5166qkt1Mld2BnvIQiA3sanpgDgXgARUxQAatxowb8koIldEwFCAkAZX7ELgPZ7fmACoG7N/1i8Boweqs 2J9di/GI0rAEATBYAF//Y5lQFYt2ehbs/RNpkdsfOfd2gK2LxFvJ/+X2e8JQwMEwBK9z/zzDPzc88918kBO9at+f0c Rk8AsAEEqUgAzSEXXXRRq/Z/wYIFTgJ89atfbZMAcQmAKglQls0VmACA+IL9IitWrMgXLVqUdFouN2gAgMEzAIri/7 HHHnPonGcd9RTv36CzGGjq7r+/gK8T/JdJAGUB/OAHP2id4S7sJAChLIBml3T0m51RPwuANQakIABsDrE+LuoLY0fD mgSIXwCUzwUjZSMCAMZYAOiNqp4Ma9asyZcvX94SAQgArg+AQVGX96SD4QTnkk5ZfvY1HRUX3jnPo1FnHocA8CWALw Cq+jrYcx3zZqcGNKccZJDyjO4Len9O8LMCWHdArALA5gcJQEkAywIyAWANX2MWAJ2yABAA0IgsgFRT/rkBA4wOWgyk OLdQVgShLuB7Df79Rb4vAOxzfjNHLf6VFaCmgEJd3pvV6X1QOTNyQZ/V/I/rD2IRAGVzSJkQtKNeQ2v0OiyBOOyjXh EAAADQqEyjVGUji31ILQPEFvXF3T8L/o888sj8tNNOc+e72xnvsZeAEPxD6gLRAn0rA/CzgWISAJ2C/6r3PQIAAACi lQBGahkBLPgh5TIQ+1gCYNasWU4AqEO40oFTOuaN4B9SnhNMAmoOEPaxyYCUy44RAAAAEH25UcqlACz4IXUxMHHiRN cHYtKkSfmECRMoPeTagETe+1XwN6IHAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAACAAAAAAAAAAAAABAAAAAAAAAAA IAAAAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAEAAAAAAAAAAAAACAAAAAAAAAAAQAAAAAAAAAAAIAAAAAAAAAABAAA AAAAAAAAAAAgAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAADSU/U7/pqPq82KPWSc4+HsBACAAAAAAACBg AXDjuj+NkAD6eP6dGxz6uh4RAQAACAAAAAAACFwCbHorHyEBFOwr8NfXTAKYCODvBgCAAAAAAACAiEoBbNffMgV8CX DpMYcl/TfbbrvtuHYAAAEAAAAAAPGVCQjLBiALAAAAAQAAAAAAEUsACQAkAAAAAgAAAAAAIhYA1hDQ0Mf6/CVHHZL0 32bLLbfkGgEABAAAAAAAxCUATAJYFoD1DbjkqIOT/dtsttlm+eabb851AgAIAAAAAABoPvtP265r8F92NGBZ48AUBQ DXEAAgAAAAAAAgeAngB/7+c44EBABAAABARGy//faOZP8G7864AABJCACjKAD8IwBNBBD8AwAgAAAgMgGwZs2adCVA +6wLXdhxxx0d6f4NsncY/1rtkF4XmsWbD93qMAmQ/fWa9hsAWu2/wXUBAIAAAICIBMAbb7yR//jHP05TAoyceaGC3X ffPX/11VcTFgCZi/3HWwD4tdohvC40jwsOnpofe+yx+QMPPOAkwLk3LC9tAFhsAhjbIjtjzgcABABA+aJfsOOHAEAA hM3WW2/tSFYADDzGzRAAo7VTjwBICxMAi+960EmAX/7uf/LtPnpA6zqw4D/WawIBMIp/24y/K0BjBIAt/gZZAJLqm+ 6uX7oSoDmL/tGWALfccgsSIOL5QXP/Sy+91Pd9wOaCs88+O0wJMPA4+3NBnNeJAj0EQBpMnfq3LABh5QC+APD7AMS6 yEYCDJ/5+7zfkbn5kr8tQCMEgBZ/tgBkkc9FVnfRf9dddyUsAbLoJYAJAI1zkhKgfAaOVgBcdtll+a233trTfcCCf1 0j0QiAnsa5GPxn0QTxZd+LBEjj3m4SQCUBRQkQvwxCAAxzvll24Zda3HzGLHdNmQjg7wQwziUAWvBp8efvAiUlA6r/ 2oAASF4AqAwgSQmQ0LxgEmDx4sU9SQATAFdccUU+Z86c/Mgjj0xMApQJgKyRC/Fed26LNd6UAqR1f7cTATTeCtr03H Zv4w/eWP8NOuf4ZSKPXXte/q83XJhPnz49P+iggxwpCgCyS6CRAkCLPi3+LBsgqYyAzn9x6CAAnn/+eQRAIr0AkACt QkYkQIkAmDVrVrgCoG8J0GwB4HdwN0wE9JoFUFzUcx+MF+32n3baaa0x16MCNjUFFGkEb1lSAftoCAA9vrTyW04eHX zwwS7wf/TRR/Orr746OQGQFf5jnoFGCICiBPjpT3/qGKQuNCoJwJu1dOGvRX+6WQBZslkASY11ggJAc/8111yT33ff fR3nfj/9X3PBiSeemB922GH5KaecEk8WQMe5vyr4b8414qdsFzu515UA/mtVNYBLIzU8LQ499ND829/+dmtMFbBNO2 6BkwPpCIAsieB/2FLPMkcsa0SPd999d6vB5PRjL3BNJu060jXF7n88AggCEwC+BNDiT49aAD733HP5008/ne+www5I AC7A1sL/C1/4QsICIEtKACjLI1kJUDkXZFELAM3/3/jGN/K1a9dWSmBfAFx66aX56aefHqcAqJz/my8Ayhb6vgQYJK OA7ID4URaAJEC6kid+CTAsAXDUUUe560W9YH7+85+3TooSCvS16y8BoEcF/5v+60/u8wr+lVUSvgTIOt4L2P2HRgsA WwQq8NfiT5gIMAkQfTZAvVEIPqjzGUQABCkBBh7PLBkJUBQAyUmAjvNAvBLA7gEmg5cuXdo29/vBvwKESy65xAkAlQ AEKwB6kgDdgv+s0Yt9EwB6HCS91989okdAnFkAVgrgXzfpjHE6WQD9jqn97Lp165wEkAAQ99xzj7sn+BLAULCvvhLC Phe6BAjtfkDGFgKgchGonR8t/i6//HK3ALzzzjvd51avXo0ECFwCKKhbs2aNC+pErzJAk/lxxx3ndv2iEAA9j2s6Aq AqC0DYzR0JEJ8EUOaX5n3N/xdccEG+cOHC/Nprr3VfkwiOVgDUnv/DFwBGP4tAXwLYowkFFpXxS4C0RE+c8/wwTvko NhfdtGlTKxNA6J5wwgkntASA9ZCwYP/FFdfkzy5bnP+//3tLSwwEHaAFkhHWT1NYSEQA+OUAWvz5EuAnP/lJ/otf/A IJEIEEsB1dEwFFGVAlBEwAaNGvxX90EqDrGGdkAaQkAerc9SMTAMr4UhaALwHEjTfemH/nO99x32PXQFEAnHHGGU4A 7LLLLvHO/XmYAqC4+BvWAnAQmQBhlAIouCsKpJQkQBZZ8D+MUz72mHVCW1aILwGsf4ShAP+Xv/ufFuonoc+98i/X5v dfNS8KATBSAjQ/68PP4CIrAAHQWgQq7VM7P74E0ALw5ptvzp944gm3E2QkKQDeWQRmAQd2QuncWsj7MkABnygTAd0E QDANgnp75yUrAHwJ8Nvf/nZEKUAamQBpSQDN6ZIAkr4mAc4///z8nHPOyS+88EJ3X9A9Qu//ogDwswAOP/zwfL/99n PEOP93mwuaWPfpNwVksQd1Mv4sqFM2gF076WR8ZMEEdYMKgF6zOyQA/KwQe82yxqP2ugryre7fJMC/3fj3SR4L2NTS MP4miQsAkwBK+5QA0OJPNaHf/e53nQBQ+ve8efPyz372s64sAAkQdnDnS4BOIkCLAR33pQX95z73uXz+/PkdJUAQZw YPsNBPLQvglVdeceUjdp2YAIhfAtS9RuKSACr7Mgmg+f+ss87KzzvvPDf3f/nLX84/9KEP5e9973tb14AJgDPPPNMJ AN03Zp5yaf7Cf/x3PnmX6clIAF8AsHCBGMoAhCSASK/pYxjZPYOUAHQ65aOqZlzXgi8BikeNVkkAEwG+BAj3uohPAj DnIQBaEkC7/tr5scWfgn8TAEiA+CRAJxGgIM8vEdDHWviXSYBDd5mYT58+3b1O40VAb/ldtRb/9oaNIQiwRj4bN27M X3/99TYBUJQAdQh2ATgkURRKKYDmdZV96R4g+av5X+h+oLn/85//vDvf2SSA7gV+GcDJJ5/sBMCO+83J3//XBV9QZQ G95n0iACCRXgDKAC3bRU6lF0AW6f9j3VM+7Gua300AWFaILxF8CVD2eV8CIACQANAwAaCgXjWfSvu0xZ+hBaCO9RC+ BIiqNKCHb87Kvj9ACVDMBhBK/dburwLAIvvuu69b/BcFwNv/vtEJgGXLlrV2AaOQADUX/6EKgLKAXVkfuj403roWLA vArpcrr7yyTQLY8yqaLQoqgvYB08L7Y/wlgHq+KOvLMr+K8/8xxxzTkgC6D4glS5aMKAFQBoCaPgW129PnPNDkEgCA fvB3/tNs+pjGe7jTKR9FQaBrQvO5nwVg14Uf7PtfEyYAwu/+n0U5/vQCQAC0FuFaBKrmUws+7fzY4s8XACYBtEhU4K +jpERRCIQlBXpXvSYBshHNQMLY/bNd/bJsAAV92v1VACgee+yx/Fvf+lb+5z//2WEiwJcAEgDf//73868sWpqfd9M9 LpBsdgDQ35gXx7oYALS9gRsc6NsRj0J9HgwFcL4AkAzSsT8mABYsWJCfdNJJbvxnzpzZCvQlDntBEknXztg0lOwxGB 8jAdB+PTUjE0A7fpb5VZz/VQqgXf+PfOQjLQmg0jEJAL3/xbbbbptP23az/LwDd8mfuvUfopcACACIMQPA7x2RXtPH dN7D3U758J9rLn/mmWecBLCmgL4I8K+X4uf8owGDDswivg6Y+xITABYI2EJcAZ0WgVro2cKvGPxb0LDPPvu4NE81gf r617/eEgGGLeybnQbcvhDP+tkdLnmNkYFis3eByySAiQAFgNddd50L/D/wgQ84VCrgSwAFiHodnQl7/PHHOyQAwtgF 7C34ryMBmhYI+Ee5GQrADQV7au4m1O/BBIDEj8ZemCA49dRTnQDQbvDs2bPbsgD84L4Kk0ZjOz/U6eSe9SWFBg/8m/ X+kLj1535//td9QXP/YYcd5u4TEgGSAN/85jedBNB7XeVAwiRAcAu+ASQACxeIMU2Y4CD+ca469aG4Q6z5fPMt/i3/ 0Y9+NKIxoC8AYu8bkQU+1mVlH7wXEhAA/g6gH/j7Rz2p4ZNqPv3AX4s/WwDKEEsA7Lrrrvn+++/vFoGSAP7rjM9Cv7 fdwMrd+yEFAKGIAAviyiSAgnsFgH/84x9d8P8fCye4R3ULlgTwBYDtAoqPf/zjLgBYf/vlUUiAlhzyMj9CEQC+BBDq 8VAUAdblXc0erQeAZX1o7K1HxKc+9SmX7i0JICQB9tprr7b+EM0J/EdKgM4ZOyPngBGfHkAChDAfSABoPi+KX3/+rx IA+lm91xX8G0Eu7PqUv6GVggHU2R22o9/4m6QhArqNte3kW3+IVI+ZywIcXz+jozhmvAciFQBlQb8f+Nvi31B6p2o9 tctnCz9b/FUJAC0SbSfQXqdKBIzH4r90t3+M0oDLf18zJYClevto51fBn2UACAX/SgeTKNIYv/jii61TAWwn0HYAw9 gF7L3vQ5kECKXmvzgH+CJA14HG18/68LM/LANEY6/v9QVAUQL4c8D4i8Aa8i+rCOyKZSB9zAEhZAQpiFePF5vTi7v/ Ej5FAXDVVVe1CYDQF3W1JUDDBYCTMYeewLFbMLQ6cQBfAkzcYlI+YcJmyf89Nttss+Dey8WyD67rCAWAFmbFoL8q/d fQYt4kgGo+LfDX4s8WgEUBcOKJJ7YEQBPTf2vv/PUqAfpI/W1qMOCnc3cTACYBnnrqqZYEsEyAcOu9ehMAIUqATuU/ NjeYBDABYFkf/nNfApgAsJ9tzq5//fKfzuIu92fmkddDBFlAnSSAzf++AHjPe97TEgCaI3Sf0TGC/ns/1MCztgQoZg A1cJEuAWA7PXrO4gqoD4ZhcslRByf9/7/55psH+V4uHt3I+zxSAWCoRlvMmTPH1Wj7QXsZkgBa5GnBV8RfAAplC4hO TcG0i3TRRRc1uwFYLxIgogZgZRJAHd/V9E1130r9VtDnB4MKAHVyhDJCigJA54mHGQh0kQAlO8JVpwKEKgIsgNf4lo kfQ2UgahpomQC+AGjOrv9gIqBTIFgngyDU86R9CWBZX6Js/td7XfcXXS8mASSPRdQSoGScsxH3nfGXAOq8LfR8/j7v d5AVAAAQf0nHMMo+IIIeACYCtKsvbDFnH/tYYC8JoHRPQws/f/GnRZ6CQwX3X/ziF91iUY+2APTRbpJ+//gdATZECT Ck47+yhgaFJgGs1lt131VZAAoE9b36un7Wgn9dHzvvvHPrCJnQJUC3LIDiTmCWZ8EEgL4IsGwAKwWwfg/Fcdd4SwB0 C/7DEEFlQXtnCdBJAIQc/PsSQKe9KNvLpzj/+wJAksAkgL7+6U9/OtyMgA7v+eqxbqYEKLLswi+1QAgAAMQV/NPAEw HQUQSog7/PGWecUSoBtNgrYou/Kvz6UcMdF3XsBQ1YEGbjSBgXoC8BlNkhCeDvCOu5uO222/K33nqr1UTQJICea3wl AJT9YRIg9J4AlTXhlenA4Yy9xqWYDWASQP0ebMz98g8FfH4DQPtZe623f/Nk/q83XJhfcPDU/Oqrrw6iIWTlSQ81BE C7M8xGTuqBCQCh015U7mUU539rAviJT3zCCQJfAug60ffaPSWKYwGzzgKg+v2fjet728oBlO4ZQ6kGAADQuwMBMGB5 gC8FzjzzTCcDlixZ4s55NhHg4wf7ixYtyk877bQ2yl5750OPzjf9198WH+v+cWEDFh6d6/Tr9g2o/zN5UAJA6Kx31f 1KACjV23aEFehbAGgp4AoYf/Ob37ifO/roo1sSQALg5z//eX7HHXe4z+v6CeJkgIoMkE7j3DkduPnXggXuxWwAjbHG WyUfJn4s+LeSAdv193cZFfzrVIiDDjrIEYz8qdjZzfyd4cqxHzmZh3hGvIJ/Hemqe4J6vRjF+f+mm25y87tlCBxwwA EtASABaL1jhEmAIK6DPKs9/9cXANm4va+LHbsJ/AEA4tz9H62jGKdNm5b43ziLQwAU0U5PWeCuHR6hbs9q+KSUT6HP 2eKviC0ubLGnIGCHfWe7DAAhAdAMCdCfFOg12A9t8e9nAOi5Fu96rkBQad/CAkALAhUsqBTEBMDTTz/trqnrr7++1Q dC36umgioVaXYg0KEMpGbDt2JpQCgSQCc4vP3vG904qq+DMAmgMZcAUtaHX/uvIyP94N/e+9r5V+D/6KOPBpIBUC8b oDztO6uczEMWADritSiAVfZl8tf6y1x88cXu+pAA8LMAJAGE9YkxGr8D3UOfh+prIm9MNhi7/gAAaQkAkwDFBoD9ig GtD/k7RygAhGq9zz///Pzkk092zxW4lwX4xeaCWlAccsghDi32igsNe77y0rkOEwB63qTFSJaXnefevVt4aOnevQgA O+rNsMDP3/21AFBMnDjRCQChAELj++abb7YEgK4tBQAKJCQHmrkY7aeXQ/W10f3aaU4GgN7zho2pjnn0ewP4429jr9 3dj3/8420NIO+++25X/vPAAw848bf4rgcbH3wU3/udJU5JpoAX6Ica/JdJAI2jGsfa8bASAJbt5Y+3UPD/yCOPuM8d f/zx+cKFC919QSUE9r1Lly51NL03RL2xL3eDeakoLn4eAABg9CSALwL8j30hoGax3V578dwDyQIY5TXLuAkA7ezOPO VSh54rCNACzepBtbCzWmCr+dTOj75HjxIAej558uSWEOgkApq2G1G2ePfrQeule4YvA0wAWNBexG/6Vtz9Xblypesg rsDhP//zP1uf//3vf+96AUgA6FHNInUaxX333RdEJsggQUAoEkDjoPFctmxZ/v3vf9/JPRMBlg2g8g+TARpjG3sJgP e9733566+/3hpz7forcNSjgn8rAQpFAJRJwOqjH+MVAL74kQCwRq8mADTP233Ax4J+ITG0du3afNWqVa3AP5SeEPXF X/U80s8pswAAAP0IgE1v5U4CGFUSwPoF1GnKHrcAyBAAL/zHf+c77jfHPd92221dyoe/qJMEUIqn1XzquXZ9/EXfgQ f+7SIxCWB130UR0MjUizIB0CWQy2oFj2EKAKFg3z/j3W/6Zru/QgFDMQiwXT91D1fwaIGkAn8L/kMVAOXBQdVkkfV8 0uR4SQAJwK8sWup2b00C+id3aBzV78FKPkwSrlmzxmV+2DzglwCpeZxKAkQoKcjtc0B5MNc2viO+v/NcEqIAECrhKQ oAk72f+cxnWmn/H/7wh/MZM2Y4TAT87Gc/c9/3sY99LEoBUK9sIA9WCgEAQBgZAJIAvgiwwN8XAnr+sSO/lu80+yQy AFIWAGLyLtPz93/0APc4bdvNnADQox+4mwRQvacwAWCLP31ORwzqQtHnTAKE0QCuTpCU95TqHZoIKAoAC/p9EeA3fV Pqt3Z//QDQ0vv9DuLh1KH2uvOfjQgAQy0N0bhIAp530z1tAsDQTq4vA1TyoawPfc0P/hUcWgaJPnfpZ/4u33DnN/IX V1yTP7tscRDzQFng3kkAlsmC0I8CNAFg73uNZzEDwGSPBf66bvR+nzp1aitjTOhzKgcwAdD8+0Gvxz3WLRkJVwoBAE AYEsCC/WLAb7v+9n2Td/tEvuamBV2DfxcPIgDiFQBCzdu0UD/vwF1c8O8LAC38TAKYCPAbPmnxp0fVipsE0IJRPQXK sgFCHXx/BzCruWAM6Vx4EwC26+9jZ737QaFSv/0AUGn+2uk3CbBx40b3OHfu3Py6665rCyq33nrrhl0PdQVAVap31v G6yDpknjRFAqg8Q0juWBaQ1fdr/K3Pg1DJh58BpMBQ5QN+80d9TacCbFx+Vf7Kv1yb33/VvEbPAWXp++1yJ94MIF8A 2GkQJgA0nnbUq1//r7IvZX5J/tp94LLLLnPv+aIE+OEPf+h+5qyzzgpaALSPa5Z3axZJFgAAAIyVBLAA3577WQHCJI EJgO8tOI3gfxyD/0YIAAsCnrr1H1oSwBcAfhDvN3yymk9fAghdNEobFeFnA2R5dTOnrAcJkAUpAIrBv58Z4geAQhJA XePLJIDOltfn1WDMUJmAaLoAyHr42W4SoLzmvBnvf5OAwsbX3re6DnTSg9/sUVkfGnMTADr+0RcAeh2TCf92498H2V HWlwBFAZhFJgBsLjAJUCYA7FrRvK55XtJXc75lAxQlgJ6bMA6jFCCrOa71y4SyBss/AACItyTAb/pnUkDPtR4rEwCW 9p928D9267isMYvdkp16ffzpT3/aLeb8Ol+r+VTapxZ9vgAokwBhZwN0XgDWFwBZUALAgn9L/9ZZ72XBv4I/oygBTA A8//zz7nP6/vnz5zt0ROCWW27ZaAGQdZwMugmDLBgBYO/19bdf3iZ6LLDTc2UKFZs9KutDY27jf88997hr6YQTTmh9 j99XJOwbQVa72WPIDUE7CQAbR5vTfQlgIkCZI34pkJpMmkz60pe+5O4ZTT4SdBABUHpSRIcsEwAAgNHIBige/6fAX0 gC/N3nTy7dlNG92SQBf8uEBECnwECLN50P79d8qtmT7fKYBDjiiCMceq7FpC0MfQkQZjZAnV2eLFgRoLHyBUAx+H/7 N0+6lG41dVMPCDvn3dK+tfurALCYCaDGcdrt97MA1Flcwf9mm23W6DKAquC/qllcPxKgie91XwBoLG2Mrc+DL3f0XG NtmQDCBIDGWOhrmgPCFgBVqf958BlAVRKgSgD4WQDq+SIJYPO8zf3/9E//5L5u94fHHnvM/YwF/yof0PPwJEA+sASg JwAAAIwXJgK22WJCx6/zt0IAtI79MgGgxk6+ALBFnnZ+rCxAxwba7mEZzT0Tvj8B0KsEyAISAFbPrQZxBx10kAsGhD 7vNw/U7m9RAOiakQSQABBPPPGE+/yECRManOVRHM/y3fteBUCI9cAmASy9/8033+woAUSZAFBfEJMA4cu/uCVAJwHg N4mUyFWQr7E1CSABoGvi/vvvb8sC8AWAgn+VkoQoANrft4NlASAAAAAAEABBCADt3vppnsWGT9r50eLv5ptvbuPyyy 9v8b3vfS/AQCCrLQHq0OQMAD/4t/HXzr+C/0cffTR/4IEHXAaABQP+kWGGgj479k/XjZAA+NGPftTQce8c/HdO3+89 CyCoCeqv/+g77rijJXp+//vfu94Nfp8HkwC+CFDwL/mjtG81BTViygDyr5MsIhGg977mAY2fBf87H3p0vsO+s9uyAD SWGlOVekkC6N4g+as5X9eM0v8ffPDBfO3atfkWW2zhgn+hhpPNFQBVEqB++VD5nJ8hAAAAACAMAeBLAAkALfi1oLPd HV8AaEdIj1r8KUgoHgUX/okA9Xb7ywLIpi/4TQD4qf829gr4JQBc4H/sBfniux50Z73ruDcbU+36GgoA169f7z7/z/ /8z64HwIYNG9qyAMIY2+q0/ZEL+Ird/mIQEKAA0I6tL3feeOONEc0e7TqQ+NHYa0dYgaEe7ZQB48orr4xAAOblmSI1 REAWwHygeeCiiy76287/X9/zm/7rT+5x5aVzR2QBWL8X/ZwkgASANfnU96ncRycHhHMP6Nb/o04fkPb+EXlGwA8AAA ABCQALBCQA9Lhq1ar8Zz/7WascwJcB1vhJiz/t9qjzsx0BpUBCn4vlWMBu5QDFwLGpOz8mAIq7/8XacKHgX8GAsgJ0 1rvKA6xzvKV9CwV+CgT9QOChhx5yjeOa0fyvmwAYdqZI8ZoJ532vQE9jevLJJzvsyEcJHXvva7dYmR52nWjs1ffh4Y cfdvzgBz9w+L0EYhAAVbv7IWUAdSoDsDIg4QsA/9owCWCNACUArNbf7gFhZX7UFQB53u3oP3b8AQAAIAoBsHTp0tai UOc866gnBf0WDCjt0xaAJgAs8Lc60HCbguUjOoEXZUCnBWATF4MmAMqC/7LrwMoCdHScznq3Tu8W/CsYVEBgjf/KRE ITA7zBg/Owdnp7ee9rPPX+VwaACYDrrruu1d9BzR5NAijro1MGUCwNAbv3Awl3zE0CmABY948LW1RJgKIA0Nxv879J 4JDGu/44IgAAAAAgQgFgiz0L/m1x5y/q1exJqERAaZ/+7n8cAiAfsbjLO8iAYuDfZAHgp//XvRaeXbY4f+Vfrm0d92 b136r7VjCgnd8wxhkBUDcTQE3frL+DkORRiYeJAAkAfSwB4P+sNX9TCUDoZUBlArCXHhIhCgBfAlQJACEBoF4v+rwf +Ns9I8wsgMEEQHXZEAAAACAAAhIAtvCzBZ6leAo1fFLNZ9nXYxEAxQVeWYfokARAL8G/fz3cf9W8/N9u/Hv3XEG/Ak Q1BlOgZwLAZ+utt25kBsBwdm27C4BQgwCNmdL3Na4SAMWMDokAkwDq91DM/FDwrz4iYuLEiQG/9yvGtUIQ5AHvBvu9 QGwc/eC/KIeKAsAvA9DXJQbtKMCwJEB/GSJl444EAAAAgOAEQFlKt3Z2bHHnB/jdvh7TIHZa5DV9EdivALBrwEoATA KYAFDNt7/7qzRxw3oDxCUA8lqpwKEGA9bkz9/91Vjq+Ec9V4NHnfQgCaB+D2XfpzIBCcJwMyHK3/vFbIAsAgFQ5x5Q lAC+ANB73r8PWPCv+aDZpwAMJ0Ok7D7Q5F4wAAAAgADoaVHoL+6KAX63r0czkB0Wd03PAOgn+K+6FooCwHZ/FQDOnz /foV4BzWkGmA25ZjtOAVAMAJXNocBe42n9QUwEWJ+Asu+bNGlSlOJvZFlAOrvAvgCwo14t0PcxGZiKAIjpvQ8AAAAI gBELwE51vvHUAdcLCPr5ekyBgMbYOr7ruQSAdn8VACr4V4+IeN/Y9QKBGMbaAnuN6YQJE1qfl9wpZgAUvy9mCdCpB0 Cs738rE/HH3YSvj+aDOAVA3jXzAwEAAAAAWUz/M/5OTz9fRwDEEwjYWe+G6r6V+q3d35gCwH4DgVj+P1XGUUfo1P2+ 2N7zKb73q07+CPsUCAAAAAAEAEDPtcIQFwrs65Ry1P2+UAXAsL4PAAAAABAAAAAAAAAAAIAAAAAAAAAAAAAEAAAAAA AAAAAgAAAAAAAAAOjhBIAAAAAAAACARATApk2bkpYANO0FBAAAAAAAACQhADZu3IgA4FoABAAAAAAAAKQgAZ566ikk ANcCIAAAAAAAACDmmn8EAAIAEAAAAAAAANDw4H0YNf9FARB7Y8CyYB8BAAgAAAAAAABoBJMmTcpffPHFoQiAYs2/nu u199prr7aP9TubFEANK0ivEgD+54f5+5rGtGnT2kgxGPf/QwAAAAAAQCMW6Kke0RZz8NXrNaDnU6dOyZcsWZKfdNJJ +c477zT0mn89Pv/8862P9Tv0u9avX+9+d6d/21hcA9n/euHa26MjAdqC/7e93/e/WTTXp43bq6++2kYqEiDr8B8CAA AAAADGbZHuL85XrVqVlAgYj8V5U68BC8w09q+99lrprv1oCAD73Msvv1x63RX/faN5DYxW2n4nAdDt9UO8Nnffffe2 gD+1LICsy38IAAAAAABoRHqukAS4+OKL3SKehXp6AmDPPfcsDdAfeeSRoQmAZ599dsTrq1RAv7vs36evjZUAqBr7sR AAnT4f0vWo60nzR4op/00YMwQAAAAAAPQUEGrxLgnA4j2B/9+/Bt/FDIBi/b+e//rXv+4rM8Reb+rUqR0FwHPPPZfv uuuupdfjmjVrRjWYHIsMgDqvH4sAgPGfw/hDAAAAAMAIVHOt4Es7r5b6n1IfAKu5Tjm40ngr68MXAKtXrx4RoP/qV7 /qWwC88MILbQJg7dq1I15/3bp1+YwZM0oFwPLlyxEACABAAAAAAABAv6jrupq9qd5bKd/apVXgp8ftt98+7fT/v2TJ SgA/A8BP23/ppZcGygCYPHly6+Mnn3xyxDGA+p699957RPC/YsWKMUklL5YBNEEAxBL8a1wld5ThYbJxypQpSWYVdb rGEAAAAAAAMGoBnwIudV/3d/79YOzoL38pnz59uiPmRXnV1/7whz8ks/OqMff7PkgA+QH5oAJAgsnPAFi5cmXrGEA9 Pvzww/lnPzNrxM/qa4sWLRp7AfCXeo0BBxEAxZ4Dut5i3P2fPXt2m1zUtSDpKPnYpKMfx0s2IgAAAAAAYEwCPlF2zJ s+r8DvoYceckHhzJkzW8FadH+Ht7PaC/bYr4li3wcJIF0D+vyWW27pnu+2224DCwC9hi8AdK3ddddd436NFcfZF0D2 31/+8peBX1uvUSYAYrvGFPhb8F8mGSUfi70mok3H71FAIgAAAAAAYFwCwnvvvdcFhSk2BEz9eEBlfmjcdQ0MIgDEhg 0bKgWAHvV7miaZyiQQAqAeV1xxhQvuLYukLMjfaaedou05UmfuoAQAAAAAAMY1G6CIgj4jyb9LnnbzNQkAZX8oONc1 oEdJgH5eyz8FQIF+mQBoWiA4zJTtTgF/jNeYxlsCMYWjRJs4dyAAAAAAAKDjYl1nvOuYN3V6V623ULBnZQAmAlLYrR vret0mY8G5nmv8dV3o+XbbbdfT6zz++OOtn/GDf/sdTb2uqgL1Xq+FTgF/jNfVvHnzWtj4llH8WkolAKM59ggAAAAA AOg5E0Cp2kISwIRASuUAStX207VTzwiwMgA932abbfJzzjmnJwGgn9HzO+64I8ieEoPs2se+4++XDSnol1Q0kWjccs strtmjZKM1A9TjU0891SJ8EZD1LBVHY15BAEBU7DHrhBb8PQAAAADGThCZ/JnwyQk9CQAd5WdBfxPr/fvZzUUAlKNg XxLABGLV7n8ZGzduzDdt2hS0BBjmaREIACDw/yvz79zQYr/Tv8nfBiAi9J7mfQ3QTJS+rR1cBX7ik5/8ZJI1vX52QI rXgS8AlA1QVwLcfvvtbQIg1ACv6ii/XgUAc0r3LCT+HggAIChoBf43rvsTAgAgwvc5cg+g2SjYEwr8tKOrJnEpSoDU SwGEBJCugbPPPrvr907YY0J+2223RXWUZLGT/1jt7IaEmj4akydPbj1PJcgfzz4iCACIIihQ0G9seitHAgBELAB4bw M0XwQo8FNgt8ceeyS5u8Zu7t9OCdA1UEcA3HnnndEFfL2WACSbxfvXOSLemv/+RQDHAALUDAx8CUCQABBntg+lAAAA 4QR33b6nyV3+x0ICkPKfR13zP8zSIgQAQAcJIAFgnyNQAIj3fc/fAQAAgJp/QABAwruDlgWAAACI+/1u73P+HgAAAA AIAEhUAPg1wggAgLgFABIAAAAAoGECgMUZjGUJgC8CCA4A0ugJwN+jGey+++6J/w1IUwUAgMQFgB+Y8QeH0aoNqjoN gAwAgHiDf97jzWPevHn5Sy+91PfP62fVNEzotULsID9Iw6Zi92eagwEAQFACoHhsk4Iy/ugwzOD/3BuW57/83f+0CQ AFBXYUIIEBQPwSgPf62Ozsv/rqq6Vfu+KKK9zRTQrY7XEQAbDVVlu5wP+WW25pEwCHHHKIe/3xOFu+UyfmYQbsnY6B Sv1ceQAACEgAkAUAYyUAhAkAdgYB4kz5L36MABhdpk2b5oL/svT+2bNnu6BcX7Pd/9122819berUqT39HgX7+nn7OZ MAdQTA3LlzRz3471UA9Bqsl+3+1xUAwxYDdN4GAEAADFz/z+IMhs12Hz2gJQD0vJhxwjUHEBfF97XfA4D3++gLAD2O tgBQwG8/p9fRx3PmzGkF+Z0yAKr+jaEKgLLX6/Saw8wQUOCvs7d1BnfV+dzdBMGEPSY4dMZ7qAvkYfw9ydoAgOQEAM BoCgAx7bgFTgSYBCAYAIgXZff4YtkyfnjPj1/wv/fee7uPFehJAFhQqEC+lxp+/dzDDz88QgBYSYF+j36ffm+v/9ax Cv4HTdkfhgAYpgQQTz31VAv9/V944QX3+Pzzzzs2bNjgPn788ccdK1asyG+//fb8tttuy++8887gswiyAf9jHgEgGw kBADDESUHBvz2aBGCiAIi/FKCqLADGRgBYMO7Pt3r0BcDkyZNb31N3Tn/kkUdaAsBez3aQ7Xf50mG0JUBVIFcV3I2G AKj7u0dDAhQX4BobobG158Z2222Xb7PNNm68jNjuxQT/AMPDGr52yjBSFpKykWJc19eZJ0ZrLkEAQLDBv2UA2CRhEk AgAADi7wVA4D9+AmDGjBn56tWr2+ZaPdeOvZ8BoB3iXgSAgnsFl2VCwT6n36vfn4oA6GVB2G/wyS4bAIwVmtcN3TOU +SX5q/lf+FlHMc5LTZCICAAIPiXIZIBJAHvO3wkAYHQEwK677jpid99S+H0B0GsGgL7fzwDwhYL/Pfr9CIDhCoC6Nf 8+KtMQ2u1fuXJlfscdd+QXX3yxI4Wa/7/85S8Odv8Betv512kvxSwiyyyKXUg2IXMIAQDBSwC/HwDBPwDA8CVAMaDe c889R+zuWwq/XxJgOzh153T/+4uvZ5977bXXKl+z7N86GoFhHQFQFcB3XZR1+fnRagRYVfNvtf7PPvusY+3atfmTTz 7pAn6fWFL/syH8x7wB0D31P9WeAE2YJ5ISAKSL0iQEAACGM+cWA3HbnR+mAPBfb6eddspPOumkfMmSJfmUKVMasYgb SwEwZqmh3v3Ugvky/IA/1E7//YzxWI8HQGyosauyuyQBLIuobtZRLD0B+p03hno6SexBv46O4pxoAACA4aAAXIG4An IF5hY4+lkBwxAAxdeTEJg0aVLjdonHKgOAYBMAYskAkAQw/J4A1g9A83+MPQGakF2UhACwo6IQAAAAAMNBgbi/Q69d 4LK+AFZX3i34L36fBfz+7nKTFn51j/2ru2jrtd5/rDLrdt55p9KvaVx0GkP0WQBvZ7UX8cwLAL0xZ84clxFQlW1U/H y0WXV51nMWUtICQLv7dQJ7ukYDAACMXi+Wsh1/ay5XRwAUv68sIyDERdygAmA8x1YCRlkeZQtzNXy86667Wk3/Ujum i+AfAIIWDuNxUxn2Dn/Zc/oAAISXrcN7NJ2x5m8RnwwoS/mvs3NT9j29lhA0vWa8Ca/XT5bH+vXr85dfftllaDz33H P5unXrnBj47GdmRdH0r99U3T/84Q8E/wB9csghhzjmzp3rMomKc4hKy0KSv8MqIxuruT+LaUGpOn+r9beU/2JQwaIT oHkBn/XqMHifxn0tMM5pCYCmvB4CoD+mTp3ixkAnP+j4xRkzZrgFezLX9f9m7PgDDBlJRJ9ihpEyj3o5RjZGATCqzV 6b9MeYdugJA5kekwC2wPQlAD0AAJod8I1Ww05OhyD4h7GVAHVq/sfqdUKWAASZABAr06dPbzF79mwX7K9evdo96oQZ NZltQsPX8c42SkYADLpY93f8yzICeNORQgzNCPr0cdmYDvJetflju48e4LDnSIDmXQtIgHgFwDCOaBrW6yAAAACaj7 KKlF2kLCPN+0046nW8BEAyJQAK/H2GdcMvKwEAdhFh/MZsGA07qz6veePcG5a3UOA/7bgFCIAGXgcSs7x/45YAwxAA vGcBAAAiFAC6wSvotx37YQoAYBcRmpm10W/Dzk4iQfPGL3/3Py0U/KdwdEyoAgAJABAu06ZNi/bYv15267gWAAAB0K cAKO7Us1gHsjviHrt+GnbuMetdUVgMHIs/r11/ZQGYBPBLAhiDZsg7JABAOMF+kRUrVuSLFi1KujYXAQAACIAhpPqx UweDBBb8HcKTAL007JQA8NPHLXAsZoTY58skAPNLswSAxroXCaAx5O8IMPYC4NVXX3VNGdesWZMvX768JQIQAFwfAP 2iIwCTD8JTFgAAwwom+XuEmcXRrWGnBf9lO8dlaeVlEgAB0DwJYALAxo2/D0AYWQCppvwT+AMMF8nFFOeU8S4nQgBA sFjAUAwg+dvEV9Lh7/77QaMvAuxrwj5njQEJ/sPIAqgjASwLgIwxAACAODKMUpWM45VdhACA6AJI/h7xUcwAsEC/jg AgUGzu+9XP3Ojl/WsnxtAzBgAAIA4JYKSWEYAAAOgzmPCDPv4m8QeNfvq/30eApnJhZgP4MqCuAKBpLAAAQHxlRimX AoxVOQACAIIMGqokAGUA6YmA4rnyjH+YEsAyODqNn+38C3uvIwAAAAAAEACQwI5h2TFwCIB0+wYw7mmU8CjgpwQAAA AAAAEACQmAbufA87cCiOhGVQjy6e0AAAAAgACAhNOFrQSgWwoxAAAAAAAAAgAg0NTv4uf5GwEAAAAAACAAIOHaYQAA AAAAAAQAAAAAAAAAACAAAAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAABAAAAAAAAAAAAAAgAAAAAAAAAAEAAAAAAAAA AAgAAAAAAAAAAAAAQAAAAAAAAAAAIAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAA AQAAAAAAAAAACAAAAAAAAAAAQAAAAAAAAAAAIAAAAAAAAAAAAAEAAAAwZkybNq2NFG/S/n9cEwAAAIAAAACAKAP/V1 99tY1UJEDW4T+uDwAAAEAAAABAFOy+++5tAX9qWQBZl/+4RgAgJLbffntHsn+Ddyd36MCOO+7oSPdvkL0DAgAi3dXL /nqBZ1l6kyELeIDuKPCXBEgx5b8oALgeACAGAbBmzZp0JUD7BA8dxH+6AiBzsT8CAKIM/v1U3lWrViUlAtjJe+fvMO CYpyqPAABiDwAEu39xCoA33ngj//GPf5ymBBi5IIySrbfe2pGsBBh4fMdOAiAAYMx3/30kAS6++OIkbvqk9bYH8YP8 7KZNm5KWAOwMQ5MXf4MsANnlYwcwXQkwtjuACAAEwGjcA1566aW+7wM2B5x99tlhSoCBx9mfAzIEAMQtBfSGlwQg1R cBUPdnN27ciABI4P9z7733zmfMmJHvuuuu+Z577unGfMqUKUnODzbmTR57W/zZApBFPvf4Xhb+d911V8ICIItaAPgS 4JZbbkECRDo/2D3gsssuy2+99dae7gMW/GseiEYA9DTOxeAfAQCRMHHKRLeAt4V8yn0AuB4GFwhPPfUUEiDi/7/Zs2 fnL774Yr569Wr3+Pzzz+evvfZavmTJknzSpElkDDV4AajFn78LlJQMqB5QQAAgAN54w41zkhIgkXnBJMDixYt7kgAm AK644op8zpw5+ZFHHpmYBCgTABkCAMJGC3Yt3LWA10LeX9hP2H5C0ot5ro/OGQFloggBEK8AUOBvwb8vCo2TTjqp9b UUs4JCEABa9GnxZ9kASWUEdB5c6CIAtD5AAMTfByBJCZDQvNCPBPAFwKxZs8IVAH1LAAQARBjcacGuhXvZgl5f++AR H8ynT5/uiHlR3ymQi1EI1M3y6CYAijX/RQEQezZJ2XURowDQjV/zgVD6f9mY7rTTTtGOdx05GMK4+xLgpz/9qWOQut CoJAAioHLxr/d/ulkAGRIg2SyALFoBoLn/mmuuye+7776Oc7+f/q954MQTT8wPO+yw/JRTToknC6Dj3F8V/I/e9YEA gDELAjffafPSr2mh/9BDD7k+ADNnzsz32muvZPsAxCQBlPUxjJ3aspp/E0d2rdjHTUoNH+ZYVgkA//MxXDsaw5Q7gc c0B5gE0OJPj1oAPvfcc/nTTz+d77DDDkgA1gZti/8vfOELCQuALGkBkNRYJygANP9/4xvfyNeuXVspgX0BcOmll+an n356nAKgcv5HAEDCC4B7773XSYAUGwLGIADsZAfr96CSD2V9lImfQWv+9ahUUftYv0O/a/369e53d/q3jVXAP+yxLL 5W2cehpo0b8+bNayG5U5YxJIpfS20eCGWO0EJPgb8Wf8JEgEmA6LMB6g16FEGdzyACIEgJMPCYZslIAF0funcnKwGq FznRSgC7B5gMXrp0advc7wf/3/72t/NLLrnECQCVAAQrAHqSAN2CfwQARJQNUGTLLbdswc5fmMG/JnALsjWm6vdQtm s/GgLAPvfyyy+XBoTFf99YjN+w0/a7CYBOr9/068uCfl0fft240OLw4Ycfzh955JFWM0A96nowQhcB2YD/NX0RqJ0f Lf4uv/xytwC888473efUBwYJkEUR1K1Zs8YFdaJXGaAA4LjjjnM7f1EIgJ7HNl0BkJwE6LzQiVICKPNL877m/wsuuC BfuHBhfu2117qvSQRHKwBqz/8IAEgALdy1kP/1r3+d/+pXv2ot8lUCYGUAJgJSqPGNpTlgMcDWSQ9lAbrGflgC4Nln nx3x+ioV0O8u+/fpa2MlAKrGcCwEQKfPN/m60jwgCbDbbrs5qmRhGRrbYp+IlLKAQmkMqMWfLwF+8pOf5L/4xS+QAJ FIAAvoTAQUZUCVEDABoIW/AoDoJEDXcc6SzwIQCvqQAFl0AkAZX8oC8CWAuPHGG/PvfOc77nvsGigKgDPOOCN+AZAj ACCSHf5+MgE2220zhySACQFKAbKgxr2YAVCs/9dziZ9+gjR7valTp3YUADLNOjO+TABoh2o0ywDGIgOgzuuHKgCGlV nEPNzMRaDSPrXz40sALQBvvvnm/IknnnA7QUaSAuCdRWAWQSmAdnO1mPdlgAI+USYCugmAYN7XvU3oCIBCFkAyEqDG jnBM/7+a0yUBJH1NApx//vn5Oeeck1944YXuvqB7hN77RQHgZwHssssuUc//Yz0PIACAhTgMZdxXrVrVJgCU3lsM0J X10a8AeOGFF9oEgFKIi6+/bt26fMaMGaUCYPny5QiAAASAxtiYPHly63kqc0usx4Vqgae0TwkALf5UE/rd737XCQCl fiv747Of/aybN5AA4Qd4vgToJAIU7OnIr/322y//3Oc+l8+fP7+jBAhiDhhgsZ+aBPjtb387ohQgjUyA9CSA1mwmAT T/n3XWWfl5553n5v4vf/nL+Yc+9KH8ve99rxt/XwCceeaZTgAcfvjhDs0VIhUJYHPAsNcECABoHNttt12+zTbb5BM+ OcGx+ScnJpkFELIE8DMA/IWbsjsGyQBQQGgfP/nkkyMWhXZ8XDH4X7Fixag3ASyOXVMEQKhB5B577BFtzf+g5UIhSw Dt+mvnxxZ/Cv5NACAB4pQAnUSAAj2/REAfa/FfJgEO3WWiOypYr9P4OaCXBX/NACDk9UGVAHjllVdcdp5dHyYA4pcA dYPBeLLANK+r7Ev3AMlfzf9C9wPN/Z///Ofzgw8+uCUBdC/wywAU/Esezzzl0vyF//jvsCRAbwvejgJgGOtJBAA0Fk 0IQqUACt5000+5FCCEG74WYyrbsJv2hO0ntAXkgwoALRb8DICVK1e2jgHUoxrF7XDYyKBBX1u0aNGYC4C6QfswXrvO CQChSqVYa/5TlIQK6lXzqbRPW/wZWgAee+yxDl8CRFUa0MM3Z2XfH6gEKGYDCO38KvjTe7nIvvvu6wKAogB4+983ur XAsmXLWkFAFBKgZgAQkwCw41413q+//nqbAChKgDoEKQCy3q+FsawRHw0JoJ4vyvqyzK/i/H/MMce0JIDuA0InSkkA nHzyye59v+N+c/LJu0yPNwsgrxYAw9pQGhcBoEFOOlU6zwjwexQBZ599dj5hjwluRzDlhX4I145uxH7vhg8e8UEncf R5NXbUc/V6GFQA6DV8ASDJoIWifdykwGxYIqeOAEhlfqHUKNwFvxaBqvnUWkDzuy3+fAFgEkCLRAX+1iy2KATCkgK9 b+ubBHj3R8Nb+Nuuflk2gHZ+FfxJBojHHnss/9a3vpX/+c9/dpgI8CWABMD3v//9/CuLlubn3XSPKx9o9jzQ37gXx3 u0dgHH8r3vo3HTtSEBoLG3LAATAFdeeWWbBLDnVTRbDlQE7QPWhocoBzT/q+eLZX4V53+VAmjX/yMf+UhLAqh0zDIA LP3//R89IMyeAH1IgLISgCB7AGiQdSPv9+f1swoEhV4rtKBwWEFAKAt+Fulpo8WahMC99947kAAQGzZsqBQAetTvGW 8BMJrvVwQAhBz4K4Czo560CNRCzxZ+xeBfZ8KLffbZxy3y1ATq61//+ogjIi0obPYO4LuLuNa6v88d4fIYIgwRUCUB TAQoG+C6665zgf8HPvABh0oFfAmgHi96HW0KHH/88Q4Fki+uuCaAdUZvwX8dCdDUOb8YgNv7WY0eDQVxvgDQ+Gt8TQ AsWLAgP+mkk9zYz5w5sxXoK3uoF5RFMvYyoGZgPmYCoFkyQOLWn/v9+V/3BV0rhx12mLtPSARIAnzzm990EkBrym23 3dZlAITxvh8dCRCMANAbUKnAds7zIFkAuulvtdVWLvDXJBGCABiNIIAFP4QiAHTztuMd9SgJ0M9r+acAKNAvEwBNux kMs4a7U8DPXABNWPSXBQB+4O8f9aSGT6r59AN/Lf5sAXjooYc6AaBTPfbff3+3CJQE8F/HdoabIQKy0gCgcvc+H04A EJIIsJ3cMgmg4E8C4I9//KML/n+7+IPuUaU+kgC+ANB9xfj4xz+en3fgLvn62y+PQgK0BJGX/RGKALD3oP/+1Prf0I 6vOrwLNXw0AaDMD429MEFw6qmnOgGglPDZs2e3ZQH4wX0V/tzgzxGNCPyHPAd0mxva54hmCADN50Xx68//VQJAP6te INO23cy975+69R+CkwA9SeDiPD/E9/uoCwC9cbVw1xvPdv91xrO+Zov5XppC6eft50wC+L8rlEZO/aRudVv0EwBAE7 HgXM8lASwDSM0ee3mdxx9/vPUzfvBvv6OpN4Gq9+wgZ73z3ocmoYWZH4T7i24/6PdReqdqPbXAt4WfLf6qBIAWiRYE 2OtUiYCx3fUbGah1Ttsf/g5gKGUCFsjZTq+PAj/t+lsGgFDw/8wzzzhZpHG29aRlFyoYUCAQTrZh770fyiRAUwWP/9 5X2V5RBNj7Vqc9WA8AK/uQ/LEmkZ/61KdcyrckgND6Xvd5v0Fkt8B/vOaB2u//rEPmxwASoPp3N6cXjHq82Jxe3P3X WBcFwFVXXdUSAPa+NwkQogCoLQFCEAD2xh9tAaCbhP2cXkcfz5kzx318yCGHuN/VpNT+sRAA7AJCKFgZgJ7rpAfVAP ciAPQzen7HHXc0Lt1/0CB+NH8WYLQFgEkAC/qrdv4MLeRNAqjm0wJ/rRlsAVgUACeeeGJLADRx56/2or9XCTDArl8T A0Z/N7ebADAJoNM/TAJYJkC4vUB6EwChSYBOGUC+CND4a2z9sg+//MNKQDTu+l5fABQlgC8CxzcbqBcxVxLcFftA9C ECQ8gGKkoAm/99AfCe97ynJQA0P+geo2MEi02Bw+xjVFMCFLN/hrweHfhF1F277CZrwb91Adeb1+8CrkC+lxR+/Zw6 fRcFgJUUzJ071/2+Ysd4fX6sdvl73bEfxi5gt6CAQAGa1BPCsgF0xGMvAkCnQVjQ38R6/54m3T7emwgACEEEqD5bSM yrPtsP2suQBNAiTwu+Iv4CUChbQHSqB9Yu0kUXXdTs2t9eJMAQ6n6zhgaKNo5q+Kaab6V9a+dXgZ+VAJgA0OkRygop CgCdKR5mMNBFApQEhFWnAoTWA8REgEkAEwD+mNtzXwKYALCf7bTr39QeIJ137HP/hj9SCEVSClQmASzrS5TN/3qf6/ 6ia8EkgOSxiFoClIidbMT9pgECwD9mS0F/t3PAdaa3fU/d4OGRRx5pOwpMr+d3AtfrlZUCFP99oy0A6gTjgwqAXhqB ETBAU/AFgLIB6kqA22+/vU0ABDvp9zkHhHYiBKSdDaBdfWGLOfvYxwJ7SQClexpa+PmLPy3yFBgquP/iF7/oFot6tA Wgj3aT9PubsgM4kASIqPt3Nwlgqd5K+67KAlA/AH2vvq6fteBf18jOO++cH3XUUVFIgG5ZAMXdwCxv/piXiQAL4DW2 ZWNuaNzVNNAyAXwB0Ixd/8FFQKdAsE4GQUiBf1EC6LQXZXv5FOd/XwBIEpgE0Nc//elPh5sR0OH9Xj3Gw5EA2WgE/2 LGjBnO7PiDoefasfczAFQj1IsAUIAvcVAmFGzw/ayDbv/O0d79HwsBUCfYp2kgNI3NPznR7eprt7Db9+oYyNtuuy3Y Xf9eS4cG/V6ApogAdfD3OeOMM0olgBZ7RWzxV4VfP2rodzZjEZiNI2E1jzQJoOwOSQA/INRzofn/rbfeajURNAmg5x pvCQBlgJgECL0nQGVKeGVKcBjj74sAywawUgBr+FgUPxprCYBuwX8YY14e0HWSAJ0EQMjBvwkAodNeVO5lFOd/awL4 iU98wgkCXwLoGtH32j0lKAlQM/Or8noZoNfDqAkADWBxd99S+H0B0GsGgN8JvCgU7HMSDxIQdf+tKQiA8ZIAnNcNnV C5joL7OgLAJvvYBMBofG8KpSTMK2GJAB+JgDPPPNPJgCVLlrhznk0E+PjB/qJFi/LTTjutjbLXlgSYfuwFDbo2eqnT 76e2v/B9eXgCQOi0GGVvSgBop9cCQgV/qv/Xgt92gBX4/eY3v3E/d/TRR7ckgATAz3/+c9cjRp/XNRRKQFgmAjqNde eU4GbLAI1JMRvAJIAaPpr08fs/aPz9BoD2s/Za/3rDhfkFB0/Nr7766mDET+VRjzUEQPslkwW7TlDwr41c3RPU68Uo zv833XSTm98tQ+CAAw5orQkl/6x3jDAJEMR1UCPDo3cBkI2vANhzzz1H7O5bCr+/Y683di8CwP/+4uv5kkACoukCoJ 83a52fb5oA0E1cnV6LjTvqNvJQ8CdCrvkext881gCwTh+QJnf5H4txTSn41/UgOs0Vmk80r8R4TdSZL0LPBikL3LXD I9TtWWJfKZ9Cn7PFXxEbf6WNSyaefPLJ+c6HHp1v+q8/NXwBWC/A7y4Iws/w8zMA9FwLeD1XsK9dX2HBn+0AK2BQOY gJgKefftrtIF5//fWtXhD6XjUVVLlIUNdCjRKQztkAYUmAYjaAxl3rfPV8sMwPG38rGbBdfxtXBf96/x900EGOcO4L 1endWYfgsKwJZKhzgAkAHfFaFMAq+zL5a/1lVP6p68EXAMr6kQQQ1ifGaPxmQQ8lHuXv+24CeRwEgP7Yr732WmlwPk wBUJZlUPy94yEAOgXnYyEAev23jsVuncbO0Li98MIL7lGiSGzYsMF9rG7vQunhqvvWDSCG3d9swP/YTYSY0SLAUACo bDEJXs0Jwp8/Ytz9T2kuULCmoF0oaNdjWYDvo8Wfxlyn/Qgt9opiSEHADvvObmUArPvHhY0/HvTdMe3eKKxbqnfoAs A6vRu24+8Hfz/+8Y9bgePEiROdABBWDvrmm2+2BICuLQUBCiYkB5p5LfRW3tHt+uh+/TQHHeX29r9vdGOpxo7CJICC PElelX34tf82/nqv2/teO/8K/B999NGAMgDqZQOU135n0QiAogRQBpcax9rxsBIAlu1l43333Xc7/DKA448/Pl+4cK G7L2gD2L536dKljmZfE3XLPArNAwvv+7Jro2OLmWH84xVQF4PqKVOmuNQ+pXPttNNOrUDQzwoYhgDwX0+/R79Pv1e/ v86/c7R2bKoWbKMpALotEsd7cvAXairjEOrnYM8NnfWu4978hUDKi32Cf0hl53+rrbYaMR/YHBF72n9qc4CC/vPPPz +fecqlbpfXBe/v1INqUWdpwFbzaY0/9SgBoOe6NkwI+NfHykvnOgkgAdBUCVB6qkeXlN+RTZ/CrPsvEwAWtBfxa74t +GuN88qVruRTwcN//ud/tj7/+9//3u0KSgDoUQ0jdSLFfffd18BroZ/gvzxBIA9IApiwM0zqSPb6vQH868DGXyneH/ /4x1tNIBUMKnB84IEH3Pt+8V0PBnGfKArA+oFge7lP6PcJEwD+mEsAWKNXEwCa5+0+IHSfsCxw6x2ga2Lt2rX5qlWr WoF/CGVAvYx7eXBfnkk2qhkAnZg0aVLbDr0CubIde0sP7zZZFL/PMgAsNdw+1u9tYirnoMf01QnqmxTkE9QAQK+p/6 nOO6nJPgX9Cv533G+Oe77tttu6HUF/cacdHqv51HMt9O3r2uk58MADndQ3CWA13yYBTADoedOujW737c4SoL+Uz6YL AFE8492v+bbgTyhoKGaA2M6fOoird4DtKivwt+A/VAGQ1Wr2lY3YUa4bDIzHWlEB/bJly/Lvf//7LsPHRICNm8bQZI ACRJM/Gv/3ve99+euvv+4+1q6/BIAeFfxbCVCI0rc4duXyJ34BIFS+UxQAJns/85nPtN7PH/7wh13fN2Ei4Gc/+5n7 2sc+9rEoBUC3e0FWI77MxiogrNrxtxrxOgKg+H1lGQFNH+jREABNm9Tr1vz7bLbbZg7JHFl9NfGR6bMj41JZyLP7D6 kyb948l/ovCbDbbrs56s4fMfQEGOS9H+JcoaD/hf/473zyLtPz93/0APc4bdvNSiWA6j2FCQAt/iQA9DkdMSgJoM/5 EkBBvwX+TVwb1Or9UZr+m9doGhWuALCg3xcBFvwrQNTOr4K/NWvWuNR/jaul9/tdxHvpM9R0AVAqg/5/9t49WK6qzN /fgRCMAcoRdIDETAgTzIyGAqWguJsY5SZyi0IQCBkS7hKELwF+JqQEL9wlwJDvpJIACTOiJYRBIJExIZhKlBRJBCRo GWDGP8apkSrrq+U/arF/fha8zep99u7efTnn7LX2U/Gp7tPnnD7Ya/fq9T7rfd/lZ5CUKA+pah8AScAvLFjsUrgtrd +yAYQkgBo+Ws8HfV8Boz/+fgmQuserJECE9HnQPIfn9wZpEjwd9B4LSQDYe15zQjYDwMq+rN5f14ze68oQtIwxocdU DmACoPrNQDs96aFstkjrayIZ6jd7Xsp/mck572c6LSEI5UM/9MZwRTX/Vuv/4osvOpSm8/zzz7uA3yeW1P+kD/8IDK FuGQCSAIbfE8D6AWgOibEnQB3nCWvypp4AL6+8Jb3syP2dBNBYauFnEsDI1nxqEaj6YJMAWjCqtMAvCbDFn7IFqigB iscvGZDm3Z0ESCrdH8AXALbr72NHvdl4KsVXO78W/OkaUJq/doxNAkgI6nbGjBnpbbfd5h4fPXp0IztAhCcAimq9B5 aI5DYKy5abVGStKAl42d0PNwkAf6x9GaCeD1oj6nv++CtA1PWjr6/99N+nW5Z+1c0nLy5bGMznQqdZQHmyINTPAQkA awRpAkDjaUe9+vX/KvvSXC75axLguuuuc+/3rAR45JFH3O/MmTMnaAEwcD5v3SeibBZAJQRAVZ4PATB45QAWzOfhB/ yxnfNeZpwI+gGamT59ussIKJo3so/H3A8gtHm/p8/z+/6PkwAmAPyU/ryaT18CCEkApY0KywYwwrtWchp9ZXZ7k5IB ZJWDg1YCIBv8Z7HgT0gCWBZQVgLoaDk9riZjOhlg9913D0YAJB38bhkJULV1hsZF/RmEsjssA8jq+3UNWKNHoZ4P2f FX+YBlkNipAFuX35S+9p1b08dvmhVEZnBRv7CiLKDiayfcXiAmAfIEgF0rmtc1z0v6as63bICsBNB9k8VhlAIkJbv5 d5AlVCaDfKjf7GVq/ofqeUKWAASLAAAQkwTwS/o+9alPucWc7fL6NZ9K+9SizxcAeRLA7w8Qxrnw+Qv8vIV/ZwKgmg FCkQCw4N92f+2cd5WBWKd3C/6MrAQwAWDNomfPnp3usssuwZQA5Hb1LkgVb3VaRJl04OF+31sGkAlAP3tH14KOevRP e1DZh8bbroEf//jHDQGg5zCR8KM7v+zuh7xx1FkGUJwCQJld/ikwvgQwESBp5JcBibVr17rfO/XUUxvNhIMsA2jxni 8jAYpKRoalRrwfAiDUms+6CQCbzHfdd9fc72k375BDDok+C4C6f4D26BxwfcBr4a55ITvH67SXOp0GUGfxa0GArgm/ 5lPNnmyXxyTASSed5NB9LSZtYWhHBhrVPQ6urARov+jrfkd5+Bb/vgDIC/7tnHcFBEJjaLu+Cv4UBGYzAVQ3rl1/Pw ugegIgLRX8588LSVcSoKrv9c0PXN8kAO09q/sqE8qe9qCyD423CaCHH37YyST7vt9PJMyMsea677KnPYQuAfIEgF8e ojldPV8kAWyet7n/X/7lX9z37fPBBIAF/yof0P3QJEDz+7a8BGhVApQMZ0A43M8BQ2h3X37ZHdGYNxnrvG994FvTv5 hTeikBAGiP5gsjO19oHsmeJlOnEoA6zRPW8dsEgBo7+QLAFnna+bHzn3VsoB/wi+uvv95x1113BRwEtDsDvvWisIqd 4MsIgOw57zrqTRkAFhCYBFDwlxUAum4U/IvnnnsuqEaAA478K9wo6EwAhJQBpLG08TVx52d32EagZQIICYCzzz7blX oIfc+CRO0ih5UF1C71P40iC6iMANCRnvae1xgqyFfPF5MAEgC6Jh5//PHcDAAF/Qr+lUUSqgDoJgsgaRFnJCw2YSjQ 0YybN29OX331VVe6sW3bNmdvtZDf57h9omj6122Dr7ot6gHKoA97LeA1R6juU7evv/56umjRosoc9Trc80adBIDOhf bTPLMNn7Tzo8XfPffc04QC/3B3AMvv+Lda74ew82cCwA/+7RpQwC8B4AL/d895V7d3NXyzMfWPD1PQZ8f+mQR49NFH gxEArYL/4kyg1hIgCfT9r7G09P5f//rXLSWA8AWAMkCU+q3AX1ivgRtvvLHWEiCp+FygOUBjZ8G/bvc79vR0n09May oP0Ziq1EsSQJ8Nkr+a83WKmI6XfOKJJ1yz8d12280F/0LjX10BkC8B8j/vk9KfA75AQADAsDBy7DvpWJMnT27s4ijF t3YZEez4A5RGc4Sd76v5Y+zYsbWdL+rY+8UkgASArgEt6Gzx7wsA7QjpVos/dXn3A34t+IwwX4fOdvsHNA+s+OeNLw D81P/szrCwc96VFaBu7yoPsLpxBX5CgaA2HPTYli1bgsoAyKv77yVYzNaOh/j+13vaMgF++9vfuve33+jRJIAvArQr rOBQtxb4P/jgg02ZBKG///33elJCBIQgBC0L4Kqrrmp0/5f003tet/7Rrprzrd+Lfk8SQALATvqwkh+dHBCOAO5kDi jTN6T4eRAAAAAAUOkgQAJAt2vWrEl/+MMfNsoBfBmgW+38VOuYt34GAWnOueDtBUAoGQDZ3f9WaeISAGocp27vVutt ad8K+iQALAh48sknXcZhtbr/twvw+vc8A8+RD+u9r7RtP7vjzTffHHDag10XyvzQ2Av1fVCJqVDwH27pcHF2x4BskY AzgbJlAH4WkGESwESASQBrBCgBEHYmcacSsPvsDgQAAAAABCEAFi9e3FgM6pxnHfXkiwClfcZZSuan+6aFu34h7vSa AGgX/GevCZ3zrqPerOGbpX0rILCmf9kAosoBXu9BetjXQdE4K91bY6s6cCGZo8eV2WHve427yj1snLNZQNYUUungMQ mA1sfFhdc/xgRAdh5wTR//eX4DEwDWDyBOAZAiAAAAoF5ocVfroJfyoAELQAv+daazness1OjJUIlANTu99+M1yF/I J7mZAWEJAD/9v5NrQue866g3qxdXzbeCAe366rHRo0cHkfY7WAIghnlE4yepIwmoMTYBcNtttzWaPNppD5IAKvuwMd f463s6AlK/H27/mOLyjnbnv4dUdlokALISwIJ/EwB22ov1fKmHAEgQABAuat5Rt2P/QjOyAMOFFgKaI5gfuBayu/9a +M2ZM2fALp92+FTzGbMAaH1tJGmIqd6tFv7trgsrAbBO76r3NgGg4E8p5FYXHM/OX3kBEEPPIXvPq/O7NXgUyvTYvn 17QwQYKvuwn9H4SwAoi2DEiBGBZwElbbOA2kmAEOaConlA4+n3ATAB4Af/4fZ6yc4Fgyv9EAAwpMF+lpUrV6YLFiyo 1WK+rh29AbqZM0wC+NRNADBfpANSuO1rZQJo19ea/KnTc52OCI7l+uhWAPjXgy8ArOZbgZ8Ff9XtAYAAKDO+auCnsT UBYNkdJgLU6FGnPejWsgT0uxI/Gv/QM4OyDR1bZQEVCYCYPgtsrpcEiEsAdJoliACAQBbzatqyfv36dPny5bVa0CMA ALqfN4y6ZQQwX7RfDGrBZwvCugkAf8EXugDoNvi36yAb/KvmW2nfYQR//cjciDP498fYgn/72tL7s5lAkj2+AKi2/O kuC6h9JlDcmWR+FoAEwF133VUrAdDqfY8AgMpnAdQ1pZeFPEB380adSwGYM4oXggr8leqrALBuAoBr5L0UcY2/HfWm chDVfIed9t0fARBjJpC/sx9r3w/Wk+WzQ8I95aH/YggBAAAAANFjJQD12/1BAPiBwI033ljbIKDbQCBUYtrZ7+U9z/ yf1jr47ylzDAAAAACAQAAAAAEAANCSvffe21Hb1+C9GRUAAAAAAAEAAHELADV2rK0EaJ5VAQAAAAAQAAAQrwB48803 0+9+97v1lAADZ1YAAAAAAAQAACAAEAAAAAAAAAgAAAhcAtx7771IACQAAAAAACAAACB2AbBixYp6SoD8GRYAAAAAAA EAAPGWAdRSAhTPsgAAAAAACAAAQALEnwWABAAAAAAABAAA1EAAHHjggQgArg0AAAAAQAAAQGwCYPv27fWVAIUzLRIA AAAAABAAEAEK7mq1yzsAArwiAVA7CdBytuUaAQAAAAAEAEQgAHbu3FljCZC42I4ArzgLQFxwwQVIAK6RXD784Q87kI hcCwAAAIAAgAAEgAK8+kqABAlQIgugNhKg7azLNZInEOsrAJg7AAAAAAEACAAEQAQS4Fe/+tWAUoB6ZALURwKMHj3a UVsB8N6nKQIAAAAAEABQHwGggA8BwCLeFwCvvfZaun79+oYEMAEQvwQoM/sm0QiAV155pWsRYAJg7ty5YUqAgZ+qPQ gA5g8AAABAAEAAAuCGG26ocRZAggTIuSbE1q1b0zfeeKNJAGQlQBmCvSZKSYAyVF8AXHfddel9993XkQSw4F9zRzQC oCMJkA3+mTsAAAAAAQAVD/ROPvnkGguApPYCIC9gnzp1qssCkABQGYBlAZgAuPHGG5skgN0votqioCBoLz0L95PhlQ ALFy7sSAKYAND8MX369PSUU06pmQTIEwBIAAAAAKiYALBUz17qPoOmp3TP6qVq+/QiAIKUAH1I362LBCgKujX+4qyz zmpw2GGHNQkAlQJs2rSpIQDmzZuXzpw50wX3U6ZMaQT6V155ZUfomtP1NjTXXIfB+BAJgPf+3PBec91IAF8ASBoFKw C6lgAIAAAAAAhEAGihZ3WftRYAgUsABWnanVXHdtGpDNACXgHftddeG4cA6GIHr04CwNK1DRM/QtfANddc4/jsZz/b EABr165Nb7vtNocJgvPOO88JgDPOOCOdNm1aUxaAH9wXYdeZXWtDc70VBWs9CoC0H4H/8F9v9rnwgx/8IL3lllvSxx 57rOXng389aUzPOeec9Ljjjku/9KUvxZMF0HIeaXc9sUABAACACpUAaGGnmk+/+VOtZEBPQWP1JIDVaJsIyMqAIiFg AkBB3ze+8Y34JEDbsU1qKQGEmvxlRYCuATF79uxGD4Cvf/3r6Z/+9Kf097//fePaOv7449MTTjjBSQAhCXDwwQc7AW DXUXUC/4FB28Dgu7UEGPBwDxKgaoF/ngBQBsBXv/rVdMOGDYWfDb4AkDzS2EcpAArnDwQAAAAABCYAtMhTuqdlA9Qq I6DnneNqlgIoPVsLcl8GKNATeSIgCgHQiQQYML71EgDZUgALxvNEgAK6T3ziEy74/9CHPtSEXVv6/oknnuh+1hcAWQ lgzz98gX/+mJcRAXlBf64IKBn8VzlANAmg3X8JAGUC6HNi8eLFTZ8NfvCvsdb8obFXCUCwAqAjCVAmm4QFCgAAAFRI AGQlgHZ9RC/HQcW/4xOGCPAlQCsRYM3eVO+tlG/t+uZJgEP3Gx2XCEg6DdbifQ+0EgEmAUwA/Pf8EQ0BYPd9CWACwH 63Orv+7WVAKxHQlAzgzw3vioAy11VVd/2LPhe2bdvmPhuuv/769Iorrkjnz5+f3nrrre57++yzT7wCoIM5BAEAAAAA wQkAXwLYTo92frT4++lPf+oWekiAsCVAKxGgRbxfImB13EUSQJw0ac+ISgLai4G6nAqQJwIsgFeAr+smmwVg7Nixw0 kkywTwBUB21/+Ko8dVVCi1FgFJi+uqTAZBSEGhPhM0/+uzwJcA4s4770y/+c1vup+x+SUrAC688ML4BUCKAAAYTA6a enYTvCYAAH0UALbgs5RPYSLAJED02QBd149XXwJkswGEdXVXfXcWBXsWxPnB27IrT01XL7rQ3QaREdD1O6qeAiBPBF iAZ6UACvR16wf/JgckANoF//82/+z01nOOrPj1U7y7WyQBklKlJGFdQ5r3Nf8vXbq0IQEuv/zy9OKLL3YNHpURoM8F K/fwBUBtsgDSemcPAQwmh13wtXT20i0NkAAAAH0WACYB1PBJmQBa7GnRp8WfHlu3bh0SIFAJoMArLxtAJwe88cYbTg YIdXq3Zm/CRIAfxE2cODE96qijHEkQi9ucXf4Su3pJTp24u/X+1UEE+NkAJgFeeOEFd2siQLcbN25Mjz322KbsEftd XSd6rmdvv8IhCVDdLIB0QI137rVQQgA0X3phXi+SAJr/TQJIDs+ZMye97LLL0lmzZqWf//zn04985CPpBz7wgcYJEC YALrroorAFQI8SAAEA0B8BcOemP7pbfc3rAgDQZwHglwMo1dOXAN///vfTn/zkJ0iAQAO/IglgIkDZADrizW/2ZrXd JgF0Brye55lnnklvvvnmQASAF4B1EPyXkQDRTyzvBu7ZbACl+SvgVxq4ro/777+/EfxbyYAJo8S9bkl6+Pi90l88ep sL/oVEQBh9JfKzAfwGgIWZAhEEf5rvJX81/yv1/1vf+pYL/oUyASQBdD0cffTRDQnwmc98Jo4ygE6ziBAAAIMiASQA BAIAAGAQBYC6PSu905cAWvzdc8896XPPPed2hYy85zh2/5ENktAWQB3vEoclASyYz0oABfcSADrmzW/wZinfvgBYvX p1OvHMK9KFK56ITgI0dndzgjtfANRhYlGAPvvQD7pgXeOu8RcmART06/p46623mmr/dT3p50877TR3fUgWSQAIlY88 v/iagARA+2yAIlEUS/CnzwTJX83/Qsf9mQSQADjzzDPTM844oyEBJADEokWLwhcAPUgABABA/0oAdryVkgUAADBYAs AWfOr2LAGgmk+lfWrnxxZ/WvRpgaedoawEUNC/6toZDZAA1ZQA1hvAR0cBZhu9Wcq3AjwFfi+//LJ7DgX/O/73j+GN bVJSABSkd9dtUa8g3dL2LRtA14DfG8Dwg39dF5IFulWAKFQ2ohIS9ZFYcsmJ7rktQyCYaycpW+//3qWWpOGXjugzQf JX878JAH0OmABQKYB2/T/60Y82JIA+Q6IQAF1KAAQAQP9KABAAAACDLABswaddf6V5Ws2nLf5s4ZeVALaY/69/v9el +/5mzf9FAlRYAmRFQJ4A8Gu8TQJYJoDquEVYQVxrCVCmyVudFvYmALRrr917jbefDaDrxWSAjg/10/6FAn5lAChrRK UjkgB6Hp0koetNzeTUMyC06yevTKTouigWAElQmQKa523u94N/EwAnn3xyetxxx7nPDokAfT587WtfQwIgAQAQAAAA IQgALfZU46sFuqV7ZtM+hS8BfLYs/Wr64rKFTgBMnjw5PeGEE8IKFDv44dygMScAqKoEuPHGG9N58+al5513Xnr88c e7oM4/710CQNeCUr59AaAxfnnlLW6cJX2ikgCZMa2zANBuvXbtrQGk3veWDSB0vfzyl790QaC+/uOmf0v/84nF6bWf /vt04kf/0WWLqGREIkC/r7ICPa8EgK4/XwJU+RpqDuIHlgG0uy5aC4AkCAGg+d6f/y34bycA9LvhicKBMX03AqCprA gAOhIAfg8ABABA2O9nXoeKCwBb2Gshp14AWvApEyCb9ulLAJUHaJGnXUCRFQJCEsBEQAipvt1IgKIzxKvYPM6XADNn znRofIqyAFTvrZ/V9/W7/3HHlenW5Telr33n1vTxm2ZFUw7QLgugbrt62q3Xrr2Cd+3iazdfwbyEgN8oUIwcOTK97M j93bUhQaSMAZWKWL8IoeDfLx2QADAJUOVsgHI7+Ulnc0xAZ8drDpfs1XyfFQAK/qdNmzZAANx0000NAaA+ASJUEZB0 IgEKmkUmLFgAOq7/94N/ggiA8KUer0XFBIDf8du6fmsxpwVeXtqn0MJPHHrooen+++/vzn7+yle+0hABhn8WeHUXfz k7el2uEvPW9VVc4PsSQItzSQA7190Cf+v0rmZv1kTQJIACf5V4/OjOLwe6u1dOApRN9441C0C79hIALvB/twGkdve1 y6/dfu36W2Cn60FiSNkhfomIeOyxx9LNmzc3gn1hAsAkgDJSqngt9UPgtRKEzddWGBLA5n9fALz//e9vCACVFkkA6C QZuwbUZFb410UoUqD050K2cWjuNcDuDcDAt04yIPhX+r9lApAFABAu9r5GBFRAAPi7d37gb2hBrnOeVf9dlPap1HAJ gAkTJqSHH364W/hJAvjPY2fJ+yKgUrv9SYvd+25WiAUL+6qJABuLKVOmuAW8BIDG2nb8FejbGe/W6V1jqZTvbL13sA KgYJyTFgFbHZsB2hhbA0gF99rl126/dv3//NLT7vu/fvI+lxWi0hB9vX37dtcYTs+z2267ucckAdRc8qmnnnI8+OCD jttvvz34VPHc1PHG/5+k3TQRRCmASQCb/4WC/6wA0AkyEgCaT3wJ4IsAXwhEkwmQ0zAyafNRUfUdGwvGWHTBYAb/l9 6xPP3Zb/7QuOYU/BsIAIDwBYAv+HgvD7EAyAv6/cDf350TWrzriCftEFvgb8F/kQCQJLCdZXueIhEw9DKgVf1uj6vy pD35f2/4MwB0XxJA9xXsH3bYYQ474906vSujw+q99di5557bSO0NWgAk5cay+HqpzyJNSABol1+7/dboUygbRJkh1h fCFwAKDo28HeAkwtex6WSANA55JAmgsi/N+z5+8K/PDF8AaB4xCeCXAoQU/Ps9YgolQOGRkL4ESDLXRxhp2AgAGCoB sNc/HNEkAHTtsWsIEEcJgP+Zwnt6iASAFmPZoF9BnaEu/9dcc00TCvJMAuioJz/l09I+swLgnHPOaQoa8xierIAOgv 5uJEAHz1eF8gBfAIiDDz64ge34+2Nox7xZvXdUGQAlx6yOQX/RYk27/Nrt165/XjCvTKAtW7a4+0ceeWS6cOHCBpdc colrPKnHYw3+/aAvafEvRAEgVPaled/wg39hTQA//vGPu88IXwIEG/y32v1vO18MLAcIYbFG4AVDgYJ+XwD4gQLXH0 BcWQB+k0/e30MkAIy5c+c6pk+fnk6dOrUpaM9DEkALPEv19PF3foQ1fMo2+vLRLvJVV13lAktfBFQp4OtIAvTwvGW6 iA+mANB45I25xkbZG9kz3lXzrbRv7fwq+Au6B0DHwT+TjgkA7fJrtz87/rqvc+MfffRRJwGefPLJd8oH/hr433HHHe 5WclEC4KKLLkpPP/30JhEQgxDw39NlJEBIIsAavqrni6Sv4Qf/4u6773afNZYhcMQRRzQEwJo1a8Id4zQpJZBbCQAa AgI0B/9i/FnznAQgTRigPhkBvMeHuAeAiQDt6gsL5u1rHwvsJQHUGNCwdF5/50dHySm4/9znPucyBXTrLwoNlQno7/ ulAENbDtBHCZD0h6FeFPoCwO/Ebjv+dt/kjAVmavyWdwpAkCcBEPz3XA6QN+72uESAsn38LAClhpsAuPTSS5sEwLhx 4xr3YykB6EQAhCADTABI7thng6H5X/P7ggULGqL56quvdrv/EgB+FsAjjzwS5rxRQgAkmYwzJABA688SBf92axkABA YAcQb+dqsSH0TfEAuArAjQbo7PhRdemCsBFOxnye785AX7WfQ3q7HwS4aR4f3/nhUAFvT7IsCC/9NOOy3dtGmTGzN1 f1cDONWAKw3c6r0V7IW1mO8s7b9MEgiT0kAJsOuuuw4QALpV4K/rTwFlVgDEJAHSLgRASBJA87kyyKxPjOb8888/vz HHi4ceesih4P/pp99pGKmxNxkQbnlHOWmY75ET5gzgc+KvbwLLALD5QlkA/te8TgDxlQGYBKAMYJgEQF55gC8FlKIr GbBo0aL01ltvHbDjkw3+tfOjxZ9P3nMrAJg3b16FJvfWdfpl+waU/Z0qLPJ9AdCqT4O/06vz33UEnJrA+ce8KRBQyn dYH9j9zMpgMV8GBfbz589314sEgIkBHRFowb8eV1lSlE0Bi4L+gu9VXQBojvCPErWML5v31RtA45ot79Dj+h3drl27 NsjsoXICoEj2Dl/mF0BVM8lMBlgpgEAAAMQNAmCYBUBZKaDGTuKmm25y5zxrN0/oMav5zKLSgvHjx6cnnHBCeswxxz hpYDXB//RP/1ThCb5cgN9dY8HhT/dtJQCywb/OgNdOn27tKDjr8i7U7E1BXVhZAJ0F/3njlRTUe0NrCfCFL3zBBf12 fVmQqODfso7UaDLWSfu9EwG8iTwgCZAnAITKvnwB8MUvfjG97rrrHAr2dSKA//OxC4Aynw3MGYAEeG/jwHb+rRQAAQ AAMMQCoKwUyDYXtB0eLf72228/11FeAsBOEJAE0M8o+FdzKP1MODvHSeud/ZILxCqk+xYJAAv+rS/D4eP3ckgArF69 Op145hVOAmi81BdC6L6avel3lfIdugDIO50hf6y88aQMoKsFn/+YJJKCR6WS77bbbrWc0EMTAFYupLkkmwGgud2QKN bnguZ/iQA7PWDDhg0BjnWnGQBJm88MghyAvJIAXhMAgAoIAFv8CdVvaiEn7KgnNXyyHT3t+pgAyEoAywIQc+bMaaQC BzHhv3un9TFPZTpFD9z9Gw4J4AuAbPD/7O1XpL949DYnAI466qj0mWeecVkA2QAu28U95D4ARUcztgrMQjzOrWqosa gEwOzZs106+ahRo2od/FddANhRsiYANI/4DV6V+WVz/0knneQ+Cx5//PFG4L9s2bL0iSeeSHfZZZd0zJgxUQmAsj1F hvMY2BCaREG9RQCvAwBAhQSAJmYt0HUrCaDOznbUk+6r2ZO+ZwJAiz9bACqo1A6QXwrgpwGHIgGaOznnS4ByC8S0zQ 7z8AmAf5t/thMAul125amu/l8SQGiMlMKtnTudBGHnu1sDtzgEQNpSADTSfNPwz3avyoJPckkC4KyzzkpHjBhBBkCF /1s1R5gEyBMAEr7CBICC/hkzZqRLlixpnCAT9iK/dwnA+751gyiEAAAAQAUFgC8BdMyTMAGgBZ/SPhX4676fDeBLAB MBIQqAvEA/6WqBOPwCwA/+1eDv1nOOdMG/eH7xNenqRRc6ETD70A+mh+43Ot28ebMbKxMAdsa7iYAQBUAn6bi+6EEC 9AddS9dee63bFa7rhB7K9dNOAKjni7K9JAGsDODwww9P77nnnkh293oRAOzM5u365539bo9zLBwAAMAwCgBbBCxevL hJApgIsKOdrM5TaZ/a+dHiz68J9bn99tvDKgPIkQADG8ElpReJyTClkvsCwE/9V4AvJAKUBSCWXHJietKkPd3jqvdV 6q8kgJ8BYE0h1ek9DAnQ7c5c8++0OtoNOhMAu+++e60n9JCuG5MAeQJAgtdKvvRzEr+a6+MRAN1JAPqEFAsAdYMuyg DIkwMAQHkOAAJgmARANhvAP+dZi0BJAKV9auFnXH/99Q3uuuuuxu+HKQCSHBEwMLhsfXrA8AoAf/ff/76JAEOp2cIE wAsvvODG65JLLkmvueYah0SAarnV6b36Y9np7n+xuEEAQN1oJQCU2WUSQLcIAARALwLAzwTg9QIYnvco70GAmguAvC yANWvWDDjn2bIArN6zFVY/HtLiMCm4367evyq7fyYA8oL/vPHWz9oRXhIATz31lHv8vPPOa6Cj3IQd8xaCACif+t+B AGCCgppIAAlEndxgwb8koM3rJgKEBICkb1wNvgZKgOZ5vB4CYPyxZ/dNAljAb+x4K2265X0HMHwCYKgkQHhNpet1LV CWhQBoun3kkUcGnPOsbs8SAK2eR4G/gsapU6cGKQDaNwVMKln7q8W7n/7fbrwV9EsCGCYANH4XXXRReumll7pxD+lY x8EQAExOULcsgKuuusoF/3rfz5s3z0kAHfXqS4B6CIC8+bweAqAf4+rv9ksGmBAg+AcIQwLYe/igqWc7Ogn2/SMg7R YJUG8RBBUWABb822MqA7CjnoSOemr3BlYDQCOoARiw85+2aApYTQFQJvgvkgAPPvhgY4K2nX8dERZOJkc353Dnjy0S AOpeBmDziN77Cv51MoyfCVAXAZCf0RWvAFDw79PvHSZ2mgCqVwZg97PvWUk7CTsF//b9Vu9ffR5cesfyBgr8x581Dw FQ8eAfAYAAaHpz2pt17dq1jg0bNkTd0TtpIwY6Dy7TSguArATwBYCVcAil/4chc5Iux6iNABiGfg4AVZpHNCco4J8z Z06TAPB7vsQpAYrKuuIUABpHBf228O+XAACAcHaA8wJDEwB2WxQsag752W/+0EDBv18ezGuOAIAKCoCiN6d9T+fEjx kzpsaDlFReAHQS/PsCQNjpDf6Y25GOdn/06NEVnsS7HZ/Wi3k/+EcEQB0FQHZOEDZfmDAMLeOrV5GYJMPb82Ww1gHZ nXoW7dBJdgevSZhBoJXnFNWFW+BftmTA0v+VBWASwC8J4LWv9vhDjQQA1PjC++tkfOONNw7I/rAyDuvpoNMAxM033+ z6QLTqBRFD9kdS4h/XD8QqAfIEgAX6vhS0+SEeAZAWCsG8935s80FW9PB+gHb9HbI9Hnh9whvLbMPObImACQA73cMv HSjKJjARkJUAzCvVG/uiU1v4bEAAQA0kQFYAWAmAFvennHJKev7556ezZ892XHvttdGf8Y4AAEhzJUAWNXyNSwB0Ny 9wjUAdU4d9kADhS4CikzokAXwBkA32fRHkf8+XAAiA6mYAtMvusPIO6+1g8DoiACBCIWCLewkAHQ12xhlnpGeddVbU vSBY7AOU3yFmNwCA1H9KAeLK6sjL6MhmAdjP+LvH1jRQ2GPWGJDgPxwJ4DeE9PH7O/gnPLQrJQcEAAS62B85cqTrAT Fq1Kh0xIgRtXxzEvwDAAC0DyaQAHHInaJA0YJ8USQA7PcRxWG8Z20sjezP6Wds11/ZHJbRYd+3BrKMMwIAAAAAAGqY Ss7rEX/vh2wJQFYI8JqFVdLjS51WYshKOux7Tgq8KwCQAAgAAAAAAIg8gEAA1DdLwO//kNccEMITO9nx8zM+LBNAEs Df/Rf23kcAIAAAAAAAIPKUf79xHAFgfftB8JrEIQLyHlfg7993pQB/DfwV8JsEQAAgAAAAAACghhKA1wYg7Pd0NsPH 0v39kx0aQSy9HhAAAAAAAFC/GmKCf4B4sgEKg9Z3TwAg4EcAAAAAAECN08B5PQAAEAAAAAAAAAAAgAAAAAAAAAAAQA AAAAAAAAAAAAIAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAAAAAEAEQGR/QAAAAAAAAgAKAmAmD20i1IAAAAAAAAAAQA xBLoFz1+56Y/5n6f7AAAAAAAAAAEAAQW/BcF+a0C/Xa/BwAAAAAAAAgACCQDoKw8OGjq2Q5eSwAAAAAAAAQARJw9oD 4BAgkAAAAAAACAAIBIBcCOt1KyAAAAAAAAABAAUAcJYBkAnBgAAAAAAACAAIDIywCsFAABAAAAAAAAgACASHf/Ffxb KQACAAAAAAAAAAEANRAAZAEAAAAAAAAgAAABAAAAAAAAAAgACFkAEPwDAAAAAAAgACAwDh+/V+ng35oAcgoAAAAAAE C9GT9+fBN1DND9fwgACFoCJEni8I/+s/R/C/7/v8svrPXrdvvtt3P9AAAAAEAtA/+dO3c2URcJkLT4hwCAYASAYcH/ pXcsT3/2mz8MqP2n/h8AAAAAoJ4ceOCBTQF/3bIAkjb/ghQACuoI7OrHr5+8zyEJ4AuAvf7hCBfsW/CPAAAAAKjPDp 9lBNY1tZdrAaAZBf6SAHVM+c8KgGh6AFidN8Fdvbji6HHpmWeema5evdpJAF8A+FkAMdf/82E/SK9rwmsKABBa8O+n 9a5Zs6ZWImCwd/UAAPoiAGzn3qcXCdDJ4xAHJgAWrnjCjfX4s+Y5EWBZAP24thAA9WL2oR901HUHCQAg5N1/H0mAq6 ++2u38keJbD3nfy+c2n/sAQyQA8nZp+yEDDNK+42bcuHeyAPwsEF8CxD72CID+ZREtu/LUBvdcONVlmJgI4DUCAAhT Cij4lwQg7ZcMvjK/u2PHjlp/7tfhWjnkkEPSSZMmpRMmTEgnT57sxnvs2LG1nBdsvPs57knZhbcvAHwh0G3w5gf+BP /1kgDWE0ASQF/v+N8/IgGgdAnR2lsvS//jjivTiRMnpkcddZSjznWkXFcAEAIjx450c7Ut5uvcA4ASvt4EwNatWxEA Ef//mzZtWvryyy+n69atc7fbt29PX3/99XTRokXpqFGjyBQayh4A/m69FuJGNxIgm1UQewo4vIOdCKBdW2GNATXu7O BCK7Tjr+vklVVfd9fN0Ucf7QL/Z555Jr355ptrd/1UMW2UORwAitCiXYt3LeK1mPcX9yP2HlHrBT3XR3cSYOPGjUiA CAN/C/59SWjMnDmz8b06buwMiwDIEwFZupUAsTeBg2YJUGfzD92LI7t2dPvQQw81ektMPPMK11/CrieVlbD7P7xZGl y3AOAHa1q0a/Get6jX9/72pL91WV2iblmAfnpvXYVAq/Vg3noRARCfALjhhhvcXCCU/p83tvvuu2+08UMZMTjkJQDt Angd4dapALDn0O/SC6A+HHvssen555+fm/VRj7FP3iXONP1+Pddpp53mrpO5c+emP/7xj119qKGJX7v+EgC6VfCvMh I9ruDfekvEcZ3kUd30f+ZvACgK4Hbdd9fc72mx/+STT7oeAFOmTEkPPvjgWmd0xRTYlQ3W2gmAbM1/VgDEvqmUd03E JgAU+Ns6r65CZyjf/z0LgH5IgKIdJBaT8UoAG2ur/6/X7mESZfDfr/GzshAhASAefvjh9IILLmiSAIaCfSsrscfikA BpSwlQNykEAPGief173/uekwB1bAYYowBQ2Uc/0rXzav4tc8RkkX1dpfrwvqdrt3n+0K+dWbNmNdC45mULiez36jYH DFsJQKsMgH7UgNrzkU4aN5YFkHfCRD1egzglQK9BoLq9+tlAlgkgJADOPvvshgBQkG8o2H955S3pi8sWpv/17/c2xE D410WYAoCsLgBotSOcZffdd2/A7l/4/3/U8FE9H1T2kZf50WvNv27VS8K+1t/Q39q8ebP727EJgLzAL+/rEK8fC/ol cF555ZUm7r333vSpp55Kn3766UYzQN3qWjBCFwFJj/+GXAD4u369NAQskgD9fD6onulXOpeCu2ygUJcMgCRSCVAkCs uOq+3+m/yz6+Qb3/hGQwCcddZZ7ud+9ps/NNCJEnrste/cmj5+06yABUD29UiDFQC+3GPeAwBL89Vi/he/+EX685// vLHQVwmAlQGYCKhDnW9MzQF1nKOwz3I1fMzbtR8MAWCPvfrqq7nXjf/fNlQBf7/T9tsJgFbPX/VrSnOAJMABBxzgKB KFeSg7JPRjIXt573c7tkk/Fnm20CNYh07KAISCOz+TpF5lAEnUEqCbHeD3v//9jSwA3Vrtn5AEMBFgskhBvtX9mwT4 0Z1fDviDwL8mkoYESAK7ZrKnxjDnAdRnh7+bTIBdDtjFIQlgQoBSgCSo4H/nzp2NIFtHPeYF6JI//RIAL7744oDnVz Cov93uv2+wMziKxm8oBECrx2NsMklj8WHIAPAX+byY0I0EyJYC1EsixScAsj091OOhbHaHnxEyY8YMhxYQH/jAB9zE /thjj7n0vuwpJCYCfAkQfllIMiBT5D0REI74oZQLoL4p/rwe9SEbYNtufzZAV+ZHN9eGPd+4ceNaCoBt27a5zYO8/z 7JgaESAIOVAVDm+UMWABpfY8yYMY37dZlXhjIbKGHiguHCUrt9CVBPAZBEE/xbU8e8YLBofC1QPPfcc9ODpp7d+DkT AP6JEUXNR4UvAeLoC5EEEfC3EkH0AQCATtlrr73SPfbYIx3xyRGOXT85sl4SJcCdWgVmWQGwbt26AQG6yj66FQAvvf RSkwDYsGHDgOfftGlTOmnSpFwBsH79+kEtA0AA9I+DDjoo2pr/XkuFEAAQRQaA7fr69cL1agQYbwZAXi14kQDQ93Ut SAD4jUCzu/32HPYzftlI+N3/4/tA88cPCQAAZbn44osdKgVYuXJlOnHixFqXAlQ9cNPn75o1a3IzAPy0fZV39JIBoF 1h+/r5558fcAygnSGfJwCWL1+OAAhILMVc818FQYgAgEoECdb40QI/Xpe4gr+iEg8/RVyTuWUAmDDwm4z6WPDvn0Di f2Dw+levH4CNHa9JfVGTp9rXXHIddCwCdBTsiINGuF3BOi/2Q5MAI/Ye0RSQ9yoAtBvsZwCsWrWqcQygbtUtfp/j9s kN/iWRBrsJYFGQ3i5o78dztwoKY6v/p8yIDACITADU5xSA+gV/hr+znyd+TABk0/z93X7/e5wWEliJyFu8DnUXAAoA uv19/a6CQKHnCi0g7MexTaE1iWOhXq/+D2rcqJOe7LG/PelvXRaHHtPJDrqvZo+9CgA9hy8AJBlWrFjR+NpHjy1YsG BYBEDe+3YwBUDdGgACAgAiSx2H+LM9/MDdH39JAF8EZI8a9XsKEPxXR/DwPoc8brjhBrcLaOc895IFIAHwvve9zwX+ Oh86BAHQ73ObQz8qDuJGgb5/eoNKN/T19773vZ4EgNiyZUuhANCt/k6eABhOyTcY7/9OBQAAAgAAKpcVUObn/GBf/H +XX1jrjJHbb7+9MjKnrITxf573QXyLfjUAyz4+bdo0F/Tr+7b7rzOe9T1byJdFwb5+337PJID/t6q2s9+qiVO3Zz0X pfyy8IcqIgEwZcoUF5xLAOhWEqCb5/JPAVCgnycAqpZt0s9Gbq0CfoJ/GHIBoDdbuE23ACAkacBrUa3+DkV9HYrGi3 GMDzv+y0/7HSwBoIDffk/Po6+nT5/uvj7mmGPc38r+nk4TGaoF/nAIgME8dxygH1hwrvuSAFYGpNMeOnmeZ599tvE7 fvBvf6OqpSZF79Nu5wAEIFQmA8AkgND92Yd+0MELDABQHwHQaVYAxCMAsvW1FvxbAzAt0P0GYArkO0nh1++pyVdWAF hJgQJ9/b28bvF5/32DLQDK7Nj3IwDopAkY1ysMN1YGoPs66lFNHjsRAPod3V+yZMmwp/v3UwYM9u8CDFoJQN5RDcuu PLWBhACNYAAA4gn+s6d20NCT4F8o6G93BJiO87KfKbvGePrpp5u6gOv5/CZger68UoCi/87BDv5b7cb3KgA6qQGmPh gqE3S82yhQ90d8ckRHAkCd/O39XoV6/54Cry527hEAUNkeAHpjjz/27MYiMCsEeMEBAOIQAK1KAPoVXNb7tU6CFQCT Jk1K161b1/S5r/vasfczANTVuxMBkD0H3BcKZc4B77cEqIIA6KYfAfMYDCe+AFA2QFkJ8MADDzQJgFDjim7ngZCOhI QaCoBsgy8CfwCA+CRA9jSHfu/6H7v/SF7rQAXAhAkTBuzuWwq/LwA6zQDwm4BlhYI9JvEgAYEAqIYAYBMIitj1kyPd rv7cuXPb/uyIg0ak999/f7C7/mXf0/362dizSJhTKiYA8koBeJEBAOItA7BsgOxJDXm/Y5RpHLtwxpFkAVT8M7QoqJ 48efKA3X1L4fd37Ddu3NiRAPB/Pvt8viSQgKi6AOhmF6/M71dRAOzYsSPdunVrbqlomfWigj8Rcsp3P173GIM/9ezQ 2JYRAEuXLo0urui0BCD2zzz1hRGt5gnNJZpTYowxy8wVfZ1PAAAAeikFsNuirAC/P4C6wrf78I5bACRRCAALrLPjpL F9/fXXc4PzfgqAvCyD7N9t9d85mAu24RQAVds9tIW7xs/Q2L300kvuVrJI6Jx3fa1mb0K7w0r71s5vDMFf0uO/mIO+ dj9T5S7/QyEBYg/+Vc5lKLNL2WISvJoPhD93xLjBPBzzAAIAAAB6kgBqBmhNAVtlBfi9YdbfPY8MgAgEQB5jx45NFy 1alM6cOTPdd999G0GgnxXQDwHgP5/+jv6e/q7+fpUWc0MhAEIIFv1dPJVyCPV0sPuGjnpTt3cFfUadF/ykfUMddv7f 9773DZgLbH6IPbN8ON7/CAAAAOg5C0DBf14WgH1tP2vB/13zzk9POOGEwuBfPQBiFwDtP9jDXeyMGjWqaYdeQVzejr 2lhrcLHLM/ZxkAlhZuX+vvVjGVs5NMgbLXSj+OFqQ+FwCqkvpf1zlnWMqzuPAAAKAXCWDBvX8rJAUMEwW+ALCGbnUM /tsHf+EHUNljALM7/lYfXkYAZH8uLyOg6gvAwRAAVRzzsjX/PrscsItDQmfVqlXunHd1ereO8XVZzLP7D3Vk1qxZLv VfEuCAAw5wlJ07YugJ0Mv7vtt5AgEAAAB9EwG262/lANb0zx7XfQX4RQJgsGq1wxEASRTBf7sU/jxJUEYktHu+0Gt9 h/P5Brvm32r9X3zxRceGDRvS559/3gX8PrGk/id9+MdnC9QpA0ASwPB7Alg/AM0fMfYEGI45AgEAAAB9LwmwTAD7ng J/IQkgAWBkywBMEtTlNavLIr/fATsCoPrXjr9LZ8F8Hn7AH9sxb2XGiqAf4D2mT5/uMgKK5ozs4zH3AxjMeR8BAAAA g5IJkPd9EwEK/vXhPWJEkvt9Xss4JUCZmv+hep6QJQCBIgAAIAAAAACg0gKgH7Wa/XoeBMDQZgLsuu+uud/Tjt4hhx wSfRYAdf8ArZk2bVp6zDHHpDNmzHBzQnaO12kvdToNYDDnfQQAAAAADGkwONzPAUM75qrb1TGNeSm9OvN7xYoVjaZ/ Maf1UgIA0BrNFUZ2rtAckj1Npk4lAP2cIxAAAAAAADBo6HjGzZs3p6+++qor39i2bVu6adMmt5jf57h9omj61+kuv7 +YJ/gHeI+JEye6bADND+vWrXO3r7/+erpo0aLKHPU63HMGAgAAAAAAKs3Ise/0/Zg8eXI6YcKEdNKkSS7Nt461t+z4 A7RH84PmCc0XmjvGjh1b27mCEgAAAAAAAAAAQAAAAAAAAAAAAAIAAAAAAAAAKoZOAKh9YI4AAAAAAIBYGT9+fO2O/s ur8+VaAHiHnTt3unmBOQEBAAAAAACBB/tZVq5cmS5YsKBWC/vB6uwNEMs8YRLAp24CYDDnCAQAAAAAAAzZwl5HAa5f vz5dvnx5rRb3CACAzuYKo24ZAQgAAAAAAIgyC6Cu6b0E/gDl54o6lwIMxjyBAAAAAAAAAACoiVzghQAAAAAAAABAAA AAAAAAADSz9957O2r7GrwXUQEgAAAAAAAAIG4BoIaOtZUAzVEVAAIAAAAAAADiFQBvvvlm+t3vfreeEmBgZAWAAAAA 6GhSShIHrwUAAAACAAEAgAAAgMgFwI4dO2otATgaCgAAQpMA9957LxKAz29AAAAAdC4Atm7digDgWgAAgIAEwIoVK+ opAfI/yAEQAAAAnUiAjRs3IgG4FgAAIKAygFpKgOIPcgAEAABAmZp/BAACAAAAkABhZwHwOQ4IAACoQfDej5r/rACI vTFgXrCPAAAAgJAFwIEHHogA4NoABACEzPjx4x117dKevPuPa+EdRo0alb788st9EQDZmn/d13MffPDBTV/rb8Z4PR QJAP/xulx/Ns8YdZ1nmG8AIDQBsH379vpKgOJFDtcHIAAg3EX5zp07G6xZs6ZWIiDJ+VdXAaT748aNTRctWpTOnDkz 3W+/ffte869bLSTsa/0N/a3Nmze7v93qv20oAv7kz96V8JfBkQBNwf9fvL/352RQZcRwX1/+PCPqIgGSFv/4DIIqos CuVju8AyC4ayUAaicBWi9yuEYAAQDh78oJSYCrr766FhN70uZfXQSQBWMKzF9//fXcXfvBEAD22KuvvpornbL/fYM5 /oOVtt9KALR7/tCvRc0hfsBftyyAus8vkAb9vq2vBEhcXEdw1zoLQFxwwQVIAK6TJj784Q87EIgIAAgwKNSELglQV3 tWVwEwefLk3AD96aef7psAePHFFwc8v0oF9Lfz/vv0vaESAEXjPhQCoNXjoV6LFkTUMeW/bnMJxCUAFNzVVwIkSICS WQC1kQDtFztcJ54A0NxRXwkwvHMHAgBKobRrBWAKviz1v059ACztuq4LdI11NgMgW/+v+7/4xS+6ui7s+caNG9dSAG zbti2dMGFCrgBYv379oAaQQ5EBUOb5YxQAAIAAQADEJQF+9atfDSgFqEcmQH0kwOjRox21FQDvLcIQABAfarymem+l fGtSV6C2bt06d1uHI15aJue+ndRGAKjkwxcAugayAfrPf/7zrgXASy+91CQANmzYMOD5N23alE6aNClXACxfvhwBgA AAgGGQAFobIAGYf30B8NprrzkxbxLABED8EqDUoicaAfDKK690JQJMAGj+CFYCDFyMdSkAEgQAVC/wU6CvBmz+zr+h 753++VPTiRMnOmIWAEXf+93vfleL4MuXAH4GgJ+2rw+CXjIAxowZ0/j6+eefH3AMoH7mkEMOGRD8r1y5ckjSx7NlAF UQADEF/xpbCR5leVi20dixY2tZCtDqOgOokgC44YYbapwJkCABcq4JobK8N954o0kAZCVAGdr9neo1o0w6kABlaH/t Ddd1ZwLguuuuS++7776OJID1ENHcMXfu3DAlQP4HeZcCIEEAQLWCPpHX6V2Pa8H+5JNPuj4AU6ZMaRzbFt3r8JekdH ZAzNeC3/RRlt8PyHsVANox8DMAVq1a1biedPvUU0+ln/n01AG/q+8tWLBg6AXA2+UaA/YiALI9BySbYt39nzZtWlN2 ka4HZR0p+6hKxz8OV7YRn0dQxUDv5JNPrrEASGojAIqC7byAferUqW59IAGgMgDLAjABcOONNzZJALtfRJEY0HVnzW MH/7orCrYLgvbyi5+eeO/PDd91ZxJg4cKFHUkAEwAax+nTp8eTBVD68xoBABF8MHzve99zwWEdGwLWaaGebfqo7A8J ID2+++67u/sHHHBAzwJAz+ELAEkGLTCHWzBlx9jP/rB/b7/9ds/PrefIEwAxXl8K/C34z8syUvZRtt9ErPNIpxlIw1 nz2W3dZ/B0ne5ZzVRtn14EQJASoKf03bQwIItRAvi7tcKCcI2/OOussxocdthhTQJApQAq3zMBMG/ePDevK7jXxpEF +ldeeWVH2LU2NNdbXrCWDKsAGM708X5IAF8ASBqdcsopNZMARdcUAgAqmg2QRYGfUcvXpca7dCr7kBCQAOpFAIgtW7 YUCgDd6u9ULcMkb6cWAVAeffAruLdMkrwgf99994226WgZeVi1MbeFntV91loABP5+VJCm3Vl1bBedygAt4BXwXXvt tXEIgC528OqWBWA77hprEz9C18A111zj+OxnP9sQAGvXrk1vu+02hwmC8847zwmAM844w8lfPwvAgnv/ubMM33WW3X HvgwBIew3+q/W58IMf/CC95ZZb0scee6zl54MvlDSm55xzTnrcccfFJQDSpEuhhACAiqFFuo55U6d3NXuzRaCCPisD MBFQh8U66brvCAAZfBt73epa6Pb6MgGgQD9PAFTtuurn+LcK+GO9rjTm1avfRB6WWeyp5tNv/lQrGdBT0Fg9CWA12i YCsjKgSAiYAFDQ941vfCM+CdB2bJNaSgChjD3LBrDAXNeAmD17dqMHwNe//vX0T3/6U/r73/++cW0df/zx6QknnOAk gJAE0Ge8BIBdR60C/+G9vpLy2QDv/tKAh3uQAFVI+W8nAJQB8NWvftU1ci76bPAFgOSRxl4C4Etf+lI8vQBazh/tri EEAASQCaDdWqHAz4SAXyseO9qt9Xds31vQ10MEWHCu+5IAugZ0f6+99uroeZ599tnG7/jBv/2NqkqlokC906CuVcAf q1SaNWtWAxvjPLLfq1MJQFWzALTIU7qnieBaZQT0vHNczVIApWdrQe7LAAV6Ik8EtBMAwbxXO3uj1loAFGUDZEWAAr pPfOITLvj/0Ic+1IRdW/r+iSee6H7WFwBZCWDPP7Qp//3JBsgL+nNFQGAp/60kgHb/JQCUCaDPicWLFzd9NvjBv8Za 84fGXiUAwQqAjiRAGYGEAACAgLAyAN3fY4890osvvrgjAaDf0f0lS5YE2VCyl137Ouz4ZwN/ZQD4AaRQEKKGj8o2sm aAut24cWODWERA0uW/qkkA7fqIbo+DinuxF5YI8CVAKxFgzd5U762Ub+365kmAQ/cbHc+YdrhTWwcJUCQCTAKYAPjV wr9tCAC770sAEwD2u0W7/lXs9t9KBDQlA/hzw7sioMx1NfD5q50dtm3bNvfZcP3116dXXHFFOn/+/PTWW29139tnn3 3iFQAdzCEIAIgO7eAqiBvxyRGOT37yk7VM6fWzA+qWHWLZABr/TgSAjvKzoL+K9f7d7OQiAIpRsCgJYBlERbv/eSi1 dMeOHUFLgH6eGDHcEsB2erTzo8XfT3/6U7fQQwKELQFaiQAt4v0SAavjLpIA4qRJe0ZUEtBeDNTlWMA8EWABvAJ8XT fZLABD87gkkmUC+AIgu+t/xdHjKiqUWouApMV1VSaDIITA3/9M0PyvzwJfAog777wz/eY3v+l+xuaXrAC48MIL4xcA KQIAIkVBn9BOsII61YnXta63js0BfQGga6CsBHjggQeaBECowV3RUX6dCgDmknJlSLwew7/gs5RPYSLAJED02QBd14 9XXwJkswGEdXWXhMuiYM+COD94W3blqenqRRe62yAyArqfmGopAPJEgAV4VgqgQF+3fvBvckACoF3w/2/zz05vPefI il8/xbu7RRIgKVVKEtY1pHlf8//SpUsbEuDyyy93a0E1eFRGgD4XrNzDFwC1yQJIhz97CAEAgyoC5s6dm444aER60E EH1S9IqXlAp+wPCSBdA+1+VtfI/fffH+yuf1FviG4FQJ1Q40djzJgxjft1CfJjaCSqxZwaPikTQIs9Lfq0+NNj69at QwIEKgEUeOVlA+jkgDfeeMPJAKFO79bsTZgI8IM4bQQcddRRjjDe0zm7/CV29bIBnX1dlw0BjW02G8AkwAsvvOBuTQ ToViVdxx57bFP2iP2uPdezt1/hkASobhZA+/4AeRKgSBYkTddheNeBJIDmf5MAksNz5sxJL7vsMpf59/nPfz79yEc+ kn7gAx9onABhAuCiiy4KWwD0KAEQAAAQPFr0KbgvIwD0QRFbsNdpCUCdrxVJwthr/rvtBxCKBNBCT6mevgT4/ve/n/ 7kJz9BAgT6/i6SACYClA2gI978Zm9W220SQGfA63meeeaZ9Oabbw7svdxZ8F9GAtQhQysvG0Bp/prPlQau60PS34J/ KxnwG0iKw8fvlf7i0dtc8C8kAsLoK5GfDeA3ACzMFIjgs07zveSv5n+l/n/rW99ywb/Q5qAkgK6Ho48+uiEBPvOZz8 RRBtBpFhECAABiDeza/UyVu/wPhQQg5X9gan9sNf/97C1S1QWfuj0rvdOXAFr83XPPPelzzz3ndoWMvOc4dv+RDYIb 6453icOSABbMZyWAgnsJAB3z5jd4s5RvXwCsXr06nXjmFenCFU9EJwEau7s5wZ0vAOowXylAn33oB12wrnHX+AuTAA r6dX289dZbTbX/up7086eddpq7PiSLJACEykeeX3xNQAKgfTZAkSiKpWxEnwmSv5r/hY77MwkgAXDmmWemZ5xxRkMC SACIRYsWhS8AepAACAAAAABq/oNa8KnbswSAaj6V9qmdH1v8adGnBZ52hrISQEH/qmtnNEACVFMCWG8AHx0FmG30Zi nfCvAU+CmrR8+h4H/H//4xwPdySQFQkN5dt34ACtItbd+yAXQN+L0BDD/413UhWaBbBYhCZSPKJlQfiSWXnOieOziB lJSt93/vUouhl5Q+EyR/Nf+bALBTgDS2KgXQrv9HP/rRhgTQZ0gUAqBLCYAAAAAAgOAWfNr1V5qn1Xza4s8WflkJYH Lnv/79Xpfu+5s1/xcJUGEJkBUBeQLAr/E2CWCZAKrjFuFJvc4EQJ0lgAkA7dpr917j7WcD6HoxGaATYfy0f6GAXxkA yhpR6YgkgJ5HJ0noelMzuRCvn7wykaLrolgAhJUloHne5n4/+DcBcPLJJ6fHHXec++yQCNDnw9e+9jUkwCCPMQIAAA AA+rbYU42vFuiW7plN+xS+BPDZsvSr6YvLFjoBMHny5PSEE04Ia6HfwQ/nBo0VL/3wJcCNN96Yzps3Lz3vvPPS448/ 3gV1/nnvEgC6FpTy7QsAjfHLK29x4yzpE5UEyIxpnQWAduu1a28NIPW+t2wAoevll7/8pQsC9fUfN/1b+p9PLE6v/f TfpxM/+o8uW0QlIxIB+n2VFeh5JQB0/WmOUePAql8/zUH8wDKAdtdFsQAIQwRoXtd878//Fvy3EwD63dCz/5JOPhdy ekUEJQA0yCyEAAAA6oMt7LWQUy8ArQWUCZBN+/QlgMoDtMjTLqDICgEhCWAiIIRU324kQNEZ4lVsHudLgJkzZzo0Pk VZAKr31s/q+/rd/7jjynTr8pvS175za/r4TbOiKQdolwVQtzIA7dZr117Bu3bxtZuvYF5CwG8UKEaOHJleduT+7tqQ IFLGgEpFrF+EUPDvlw5IAIQgAdrv5HcSyCfpcJ0b34sAkOzVfJ8VAAr+p02bNkAA3HTTTQ0BoD4BIlQRkHQiAQqaRS YhCQB9kHf7+/pdNQ4Teq4Qj5Dr5cM6O1HQIAwAAKoe+PtHf2kxpwVeXtqn0MJPHHrooen+++/vzn7+yle+0hABhn8W eHUXfzk7el2uEvPW9lVc5PsSQItzSQA7190Cf+v0rmZv1kTQJIACf5V4/OjOLwe6u1dOApRN9441C0C79hIALvB/tw Gkdve1y6/dfu36W2Cn60FiSNkhfomIeOyxx9LNmzc3zo4XJgCqLgH6IfBaCcIQJYDN/74AeP/7398QACotkgCw06GE msyKvEbB0UiAbOPQ3GugYgJATTzU4EMf8nbbiwB43/ve5wJ/XQQhCIB+BuxVOQaKxlsAACC0GPPxd+/8wN/QglznPK v+uyjtU6nhEgATJkxIDz/8cLfwkwTwn8fOkvdFgBi23f2CBl65i/NuVoiln78a0mfKlCluAS8BoLG2HX8F+nbGu3V6 11gq5Ttb7x2sACgY56RFwFbHZoA2xtYAUsG9dvm1269d/z+/9LT7/q+fvM9lhag0RF/rSFg1htPz7Lbbbu4xSQA1l3 zqqaccDz74oOP2228Pohyg49Txxv+fpN00EZQEsPlfKPjPCgCdIKPPGc0nvgTwRYAvBKLJBMhpGJm0+agYVgGgyd86 vNru/wEHHOC+N27cuI6eS8G+ft9+zySA/7dCEgCdBu95u//DKQD0Qa4juIqO52r34a3z3YWOeQtyAu7T608WBwCELg AsEM/iB/0+WrzriCftEFvgb8F/kQCQJLCdZXuerAjIyoChkQJJm4V34Td7FgDFNcPDtwPoZwDovtZmuq9g/7DDDnPY Ge/W6V1rO6v31mPnnntuI7U3aAGQlBvL4rGrxxxi60UJAO3ya7ffGn0KZYMoM8T6QvgCQMGhUbQOlQSIVQAkaXt5FE JTUUkAlX1p3vfxg399ZvgCQPOISQC/FCCk4N/vEVMoAQqPhPQlQNK38U46nfD1wTvYAkABv/2enkdfT58+3X19zDHH uL9VtWBwsARA3vMNZTBpbzSZfEOv/0svveRuNUGLLVu2uK+fffZZx8qVK9MHHnjApf/ZGzfoibjHfwQQABBLFoAF5A rqDHX5v+aaa5pQkGcSQEc9+SmflvaZFQDnnHNOU9BYRFZCDE1WQNIdfRIARTJgOHb/fAEgJPkN2/H3x9COebN676gy AEqOVx2D/qJ1pXb5tduvXf+8YF6ZQFpX6v6RRx6ZLly4sMEll1ziGk/qcf/6iStjNSk8DjDktaX1dVHZl+Z9ww/+hT UB/PjHP+4+I3wJEGzw32r3v+18MbAcYMhKAMaPH5/7IWvB/yGHHOK+1uQvAWADo0C+kxR+/Z7SerICwEoKZsyY4f6e moj4v6fHhyoAbBf89xqwdyMABnsi8CdmjY0YM2ZM476x1157pXvssUfTYiC2EgKCfwDKkeouAubOnevE/NSpU5uC9j wkAbTAs1RPH3/nR1jDp2yjLx/tIl911VUNhr4koM8SIOkHw9MDQOORN+YK+pW9kT3jXTXfSvvWzq+Cv6B7AHQc/DN3 2HyuXX7t9mfHX/d1bvyjjz7qJMCTTz75TvnAXwP/O+64w91KLkoAXHTRRenpp5/eEAEx7fwnHUiAUNaZes9bw1f1fJ H0NfzgX9x9993uc8YyBI444oiGAFizZk24450mJXo5tBYASR9jmY4EgG7tMQX9CsazBs4XAAoS7WfKTgxPP/10QwDY 81kKuf3NvFKA7H/fYAuAMsF4vwRAmZKAXicCFtkAMNRYw9dWJUYqQ1I5UoxzU5l5u4qLPMsG0M6+BfO6n8UCe0kANQ Y0LJ3X3/nRUXIK7j/3uc+5TAHd+otCn+H/vOqTBAgk4G8lAKwJmwX8fvBvG0c2Vmr8lncKQJAnARD8D8p60x6XCFCm kZ8FoNRwEwCXXnppkwCIbQ3rTxuhCwAF/zra1QSA5I59Nhia/zW3L1iwoCGZr776arf7LwHgZwE88sgjYY51CQGQZE rOBksCJN0G/2LSpEmuoUPW3mnH3s8AUIp4JwJAAb7EQZ5QsAH3sw7a/XcO1u7/UAqAMgvCXieDTmr+fZSlISRpVq1a lS5ZssS9aUUdav7ffvttB7v/AOXxO73rM0OZX5K/mtuFX3YUo5iMJYvIRIB2dIwLL7wwVwIo2M+S3fnJ4jcQFHpMf0 9ri2pcE8mwMNzXRVYAWNDviwAL/k877bR006ZNbrzU/V0N4FQDrjRwq/dWsBfWe7yztP8ySSB8LgyUALvuuusAAaBb Bf66/jQPmADw78cqilt9RlT588IEwC8eva1JAmhOVwaZ9YnR/H7++ee7Od6ugYceesih4F9rBD2msQ+3vLi1BEhyav 0HeuRkaHoAFAXWqtvI7u5bCr8vADrNANDP+xkAvlCwxyQeJCDK/rfWQQD0SwLk1fxbrf+LL77o2LBhQ/r888+7gN8n ltT/pA//+BAHaL3zr9NesmVEVloUe0ZSbPNH9pQAiQCl6EoGLFq0KL311lsH7Phkg3/t/Gjx55N9XqEAYN68eRVb7L eu0S+b9lnmd6pwnfgCIK9HgzVt9N/HKt3UEXBqAucf86ZAQCnfYb3fywqAzuq9oRi93+fPn++uFwkAC/izAqCOEqAf 6/+hEAC/WfN/GwJAc4R/lKhlfNm8rxgzuxYQely/o9u1a9cGmT1UTgAUZXt1M8f0WQBMnjx5wO6+pfD7O/a2g1M2AP V/Pvt8viTQ4FddAHRTn1/m9wdLAOSlZ1kwn4cf8Ifa6b/T8Wg1IfMhDdBZ6n9dy5VinzPyAnc1dhI33XSTE/vazRN6 zGo+s6i0QJ/nJ5xwgmsCLGlgNcH/9E//VOEGYOUC/E4Egb8grLIAyAb/OgNeO326taPgrMu7NRFWUBdWFkBnwX/uGr Kg3htaS4AvfOEL6WOPPdbIDNB9C/4lBtSXJHpx7H8dwFpU45EtA/AFgFDZly8AvvjFL6bXXXedQ/GeTgTwfz52AVDm s2HYBIBe9Ndffz03OO+nAMjLMsj+3eEQAK2C86EQAJ3+twIAVAU1dlUQKAlgZURly45i6QnQ7VwdS5ZAFtV82g6PFn /77bef6yivz3M7QUASQD+j4F/NofQzFghU/3pIWu/sl1wg5n3WD/X1UCQALPi3jv+Hj9/LIQGwevXqdOKZVzgJoLFS Xwih+2r2pt9VynfoAqB57Fq9Z73xpAygYwFs922XWMG/lR3ppInavB45GQBVlgC+ALByIc0l2QwAze2GRLE+FzT/Sw TY6QHKRt5tt90izwBI2nxmJIMnACywzgbVY8eOdal9M2fOTPfdd9/GAPtZAf0QAP7z6e/o7+nv6u+X+e8crIVa0Ztt MAVAuzd4v9/4NtHut9++ud/Trr96MUSfBfCX9sIF8QLQeQaAJIDh9wSwfgCa/2PsCVDX8iI7Bkr1m1rICTvqSX1jbE GvXR8TAFkJYFkAYs6cOWHV/757p/UxT2U6Recv/odaAvgCIBv8P3v7Fa7mVwLgqKOOSp955hmXBZB9/2abuIXcByAv +O9mIwk6X6sqi0TBo2rJwwsK+/+ZUtVx0vyvecIXAJpHrOeL1f/b3H/SSSe5z4LHH3+8EfgvW7YsfeKJJ9Jddtml0T MuFgHw3tzRuqdI0VzTdwFQxKhRo5p26BUA5u3YW2O5dhdG9ucsA8ACS/taf7eKOzi9TvBlgvqhfHPb6y3pkrcTp34P ehNb07+6dekm+AfoHR0np4yAonKj7OOx7+TEHCBo/FTvqVtJAHV2tqOedF/NnvQ9EwBa/NkCUEGldoD8UgD/eNpQUn +bOznnS4ByJQHDmxXSSgD82/yznQDQ7bIrT3X1/5IAQmOktG0FaToJws53t/rtOARA6+zMRpovmwh9QSeLSADMnj3b zS9ViRGGUyhX+TNAc4RJgCIBIOlrAkBBv457V5NxO0Em7LVA+yyvTgTjsAiAvHSc7I6/dZcvIwCyP5eXEVD1QR8MAT Cc/380kW7evDl99dVXnaDZtm2b6+grMfCZT0+Noulftzt1v/vd7/jQBgDoQgD4EkDHPAkTAFrwKe1Tgb/u+9kAvgQw ERCiAMgL9DvLAhjengC+APCDfzX4u/WcI13wL55ffE26etGFTgTMPvSD6aH7jXZrCo2VCQA7491EQIgCoJN0XF/0IA H6M68ou0QCQLvCtXwNArl+ygoAZXtJAlgZwOGHH57ec889kcQavQiAPsaq/R7YvJT/MoF73s90WkJQ5V2cqjxfN4wb N9aNgRo/ajGmExiyxzBGPbH+OYwaK4DQmDZtmgvmZPc1p2TnepV91WHnv07pwRrLxYsXN0kAEwF2tJPVeSrtU9eGFn 9+TajP7bff7n4npOZfWQkwsBFcUloCJMN0rfgCwE/9V4AvJAKUBSCWXHJietKkPd3jqvdV6q8kgJ8BYE0h1ek9DAnQ 7c5c8+9wklDv6DqSACD4T4L5DDAJkCcAtCawki/9nMSv5vp4BECnkjdgAVCV50MAAABUC2UTGdn0f5UfdXKUbIwCIL bPAF8AZLMB/HOetQiUBFDapxZ+xvXXX9/grrvuavy+moCFJwCSHBEwMLhsfXrA8AoAf/ff/76JAOOss85ymAB44YUX 3Hhdcskl6TXXXOOQCFAqtzq9h9DUsbPd/2JxgwDojwSodRZEYNdMngAQEgDK7DIJoFsEQAACoJOa/6F6npDfiHwIAE AdUI2wsgEU7K9bt87d6rQXNXytUz1nXYKBbBbAmjVrBpzzbFkAVu9ZhB3/FZIAyC8FKK4tr+LunwmAvOA/b7z1s3aE lwSAegjp8fPOO6+BjaMd8xaCACif+t+BAOAzASLHFwBq3GjBvySgze0mAoQEgKRv7AKgeR4PUAD044imfj0PAgAAIA xUBqASIwV+mvvzTnupUypnrJ8BvgCw20ceeWTAOc/q9txuZ0/1/0ZYr0Hebed15cMhALR491P/y465JIBhAkAC56KL LkovvfRSN+52rFtcwX9R1gA9AAAJcNVVVzV6ucybN89JAB316kuA+ARAOmAOyZ8HAhIAZWv+h+I5YPBQc45Yj/3rZK HOtQAA0J0AsODfHlMZgB31JHTUU7QNZgfs/KctmgJWc+FeNvi38dXOvwmABx98sKl8Q9hxjtU/0rHbM7jzxxYJAAiA 9zK6FPzrZBg/E6AOAqBY6AYkACC+YD/LypUr0wULFtQ6LZcPaQCA3jIAstJ/7dq1jg0bNkTd1CtpIwa6CzCrKwCyEs AXABb0GyoBqHZGR9LD+JQQAGSAQg0FgP85oIB/zpw5TQLAer7ELADyNxkRADCMAkBvUvVkWL9+fbp8+fKGCEAAcH0A 9Io6vdc6IK7ZXNIqw8++p3Pix4wZU+PrIqm0AOg0+M9KADu9wR9zw8oAhM54tyMD4xmb1ot5fz6IvRwIEAB5c0l2Tr D5QoIwtHKvfojEpM/ZxwgA6DoLoK4p/wT+AIODFgJ1nFsoK4I6ZoDkSQDr5WCNHXUigNARbyKuTu8DJUBS4h/XD8Qk AIqCfwv0Db9cKCYBUBT8F73vEQAAABBlplFdZSMLfqhjFogvAKwEQIv8U045JT3//PPT2bNnO+pwxjvBP0DaVBo0de rUBn6vELKPEQAAABCZBDDqlhHAoh9Y9L+z6JcA0PFgZ5xxRi2Cf0QgQOsyAJrD0wMAAABqUG5U51IAFv1Q50X/yJEj XR+IUaNGMQ9wXQAAAgAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAQAAAAAAAAAAAAAIAAAAAAAAAABAAAAAAAAAAAI AAAAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAAAAAEA AAAAALXhsAu+xusAAIAAAAAAAIDYg/87N/2xtATQzxm8fgAACAAAAAAAiDQDwISBOGjq2Q5eQwAABAAAAAAARJw1IG Yv3YIIAABAAAAAAABAzBJAKPD3RQCvDQAAAgAAAAAAIhUBCv5NAtAbAAAAAQAAAAAAkQb/JgA6aSYIAAAIAAAAAAAI UACIHW+lZAEAACAAAAAAACD2EgAEAAAAAgAAAAAAEAAAAIAAAAAAAIAYBACNAAEAEAAAAAAAEHHw7/cC8B/jNQIAQA AAAAAAQAAcPn6vUgIgG/xzGgAAAAIAACJh7733dtT2NXhvxgUAqKUESJLEkU3/tz4ACAAAAAQAAEQkANavX19fCdA8 60IbPvzhDzvq+xok78K1AOEKAMOC/0vvWJ7+7Dd/GNAA0IJ/SgAAABAAABCRAHjzzTfT7373u/WUAANnXijgwAMPTH fu3FljAZC42B8BAKHz6yfvc0gC+AJgr384oiEBCP4BABAAUONFv2DHDwGAAAib0aNHO2orAHoe4/gEAIFdPbni6HHp mWeema5evdpJAF0HWQEQe/CfvPuP66HPryuCFKBaAsAWf70sAEn1re+uX30lQPy7fiYB7r33XiRAxPOD5v5XXnml68 8Bmwvmzp0bpgToeZz9uSCJIvjPq+1GCtQDEwD+daBMAJMARsyLbARAf5l96Acd1lOC1wSgIgJAiz9bALLI5yIru+hf sWJFjSVAEr0EMAGgca6lBMifgaMVANddd1163333dfQ5YMG/rpFoBEBH45wN/uO4RvKCf1K+68G4ce9kAQiNtzIBxp 81ryEBYg/iEu8f10NvLLvy1Ab3XDjVZZiYCOD1AahACYAWfFr8+btAtZIBxa82IABqLwBUBlBLCVCjecEkwMKFCzuS ACYAbrjhhnT69OnpKaecUjMJkCcAksoF873u2up3VfuNBKiXBFDAZj0BTAKI2AM4BEB/gv+1t17m+I87rkwnTpyYHn XUUY46CgDEElRWAGjRp8WfZQPUKiOg9SsOLQTA9u3bEQA16QWABGgUMyIBcgTA1KlTwxUAXUuA6goAC/qzddvdBvCW Eq7n4TMwXrTLryDfTgSQBBDWGJA0bigb/L+y6uvuujn66KNd4P/MM8+kN998c+2unyTzr2rlXlyzNRYAWQnwgx/8wN FLXWhUEgARkLvw16K/vlkASW2zAGo11jUUAJr7b7nllvSxxx5rOff76f+aC84555z0uOOOS7/0pS/FkwXQcu4vCv6H /xqxwN8/us3Ob7fHu33Oov4AsdeG11UCMLZxMdjj6B8nqUBftw899FCjt8TEM69IF654oiEBdK2x+x/v9QABCABfAm jxp1stALdt25b+9Kc/TffZZx8kABdgY+F/8skn11gAJLUSAMryqK0EKJwLkqgFgOb/r371q+mGDRsKJbAvAK699tr0 ggsuiFMAFM7/1RYAeRkAvgzoNavAFo516Q5fRwmQPf6PsQ0/+B+MBp+nnXZaev7557s+MD/+8Y8bp0QJBfra9ZcA0K 2C/x3/+0f3uImm8CVA0vJzgPR/qLwAsEWgAn8t/oSJAJMA0WcDlBuF4IM6n14EQJASoOfxTGojAbICoHYSoOU8EK8E sM8Ak8GLFy9umvv94P8b3/hGes011zgBoBKAYAVARxKgXfBfrTTPvIyAblP584IIXzgQJMbFscce2zL7ox7CP94MgF 4bfCqQ37Rpk5MAEgDi4Ycfdp8HvgQwFOxbWYk9FroECOWzABAApRaB2vnR4u/66693C8ClS5e6x9atW4cECFwCKKhb v369C+pEpzJAE/pZZ53ldv2iEAAdj2t9BEBRFoCwD3gkQHwSQJlfmvc1/19xxRXp/Pnz01tvvdV9TyI4WgFQev5Pgl v0+UGcZQF0WwqQ11Og3kFi3Gh31w8U6yd64g3iemnwadeBgvgdO3Y0MgGEPg/OPvvshgCwBpIW7L+88pb0xWUL0//6 93sbYiDo4Kyi2WCdjCNzHQKgqRxAiz9fAnz/+99Pf/KTnyABIpAAtqNrIiArA4qEgAkALfq1+I9OArQd44QsgDpJgD Kf/JEJAGV8KQvAlwDizjvvTL/5zW+6n7FrICsALrzwQicA9t9//3jn/jQJctfHD9KNXp/TUsM5JSDekj8L7rLXTz3G Ov5mv900+Dxo6tlNItCXAPpMMAGgtaK+97Pf/KGBTpTQY69959b08ZtmRSEAWkuAao+9X+LD/I0AcAs8pX1q58eXAF oA3nPPPelzzz3ndoKMWgqAdxeBSeClAErn1kLelwEK+ESeCGgnAILp8NrZO6+2AsCXAL/61a8GlALUIxOgXhJAc7ok gKSvSYDLL788vfjii9Mrr7zSfS7oM0Lv/6wA8LMATjjhhPSwww5zxDj/t5sLqlT76e/gdtsIEOpbBiBMAtQv2yPudO 5uGnyaANDjM2bMaPyMJIDQ50K2NMj6SigLwCTAj+78cgSnAiQDPhJCulayfVyY82ouAEwCKO1TAkCLP9WEfutb33IC QOnfs2bNSj/zmc+4sgAkQNjBnS8BWokABXo67ksL+s9+9rPp7NmzW0qAII4M6mGhX7csgNdee82Vj9h1YgIgfglQ9h qJSwKo7MskgOb/OXPmpJdddpmb+z//+c+nH/nIR9IPfOADjWvABMBFF13kBIA+N6Z86dr0pf/+f+mY/SfWRgL4AqCK Cz0WU9CNBFBqtySANoDqVwqQfX/HJwE6afApAeCXhJhUzDYg9fFFgC8BeH9VSwLweiAAGhJAu/7a+bHFn4J/EwBIgP gkQCsRoCDPLxHQ11r450mAY/cfmU6cONE9T+VFQGc5XqUW//aGjaHzqzXz2bp1a/rGG280CYCsBChDsIu/PomiUEoB NK+r7EufAZK/mv+FPg8095944onujGeTAPos8MsAzj33XCcAPnzY9PSDf130BVUW0GnuZwACAKBbLLVbgYIJgHqVfb w3dycRB4FlG3xqbvfLAPLIloz4j/sSgL4QSGKooABQUK+aT6V92uLP0AJQR3sIXwJEVRrQwQ8neT8foATIZgMIpX5r 91cBYJZPfOITbvGfFQB/+c+tTgAsW7assQsYhQQoufgPVQDkBezK+tD1ofHWtWBZAHa93HjjjU0SwO4XUW1RUBC095 gW3h3DLwHU80VZX5b5lZ3/zzjjjIYE0OeAWLRo0YASAGUAqPFTUDs+Xc4DVSwBAOg1AyBvh7heZQDx7wKXbfApIWRZ AH6A7/cXyZ48Ys1HrWdA2N3/4+4JQS+AmgsAW4RrEaiaTy34tPNjiz9fAJgE0CJRgb+OkhJZIRCWFOhc9ZoESAJtCG K7+nnZAAr6tPurAFCsXbs2/frXv57+6U9/cpgI8CWABMC3v/3t9AsLFqeX3f2wCySrHQB0N+ZJborgwMV/lQKBoqBb RzwK9XkwFMD5AkAySEf/mACYN29eOnPmTDf+U6ZMaQT6EoedIImka2doGkp2GIwPkQCoWg2h5n/t+FnmV3b+VymAdv 0/+tGPNiSASsckAPT+F3vuuWc6fs9d0suO3D/deN//iV4CIAAg9h1iywDg1Id4x7hVg0/L6vQlgAX5/ikj9nzZx/yj AXndq3st8DrUTABYIGALcQV0WgRqoWcLv2zwb0HDoYce6tI81QTqK1/5SkMEGLawr3YacPNCPOlmdzjnOQYGitXeBc 6TACYCFADedtttLvD/0Ic+5FCpgC8BFCDqeXQu7Be/+EWHBEAYu4CdBf9lJEDVAgH/KDdDAbihYE/N3YT6PZgAkPjR 2AsTBOedd54TANoNnjZtWlMWgB/cF2HSaGjnhzKd3JOupFDvgX+13h8St/7c78//+lzQ3H/ccce5zwmJAEmAr33ta0 4C6L2uciBhEiC4RV8PEoCFC8SWHpyt+ea1ibcfQLsTHzSXt6r5tw7zeX0EoNqBP2NVEwHg7wD6gb9/1JMaPqnm0w/8 tfizBaBSxCQAJkyYkB5++OFuESgJ4D/P8Cz0O2/wkhsY9CkACEUEWBCXJwEU3CsA/P3vf++C//+eP8LdqvurJIAvAG wXUHzsYx9zAcDmB66PQgI05JCX+RGKAPAlgFCPh6wIsC7vavZoPQAs60Njbz0ijj/+eJfuLQkgJAEOPvjgpv4Q1Qn8 B0qA1hk7A+eAAQ/3IAFCmA8kADSfZ8WvP/8XCQD9rt7rCv6N4D54O+0T4o8ru/8QYXDIzn99xrrdONtOfrZfQLY8gO ul+in+2TIfiFQA5AX9fuBvi39D6Z2q9dQuny38bPFXJAC0SLSdQHueIhEwHIv/3N3+IUoDzv971ZQAlurto51fBX+W ASAU/L/wwgtOFGmMX3755capALYTaDuAYewCdt73IU8ChFLzn50DfBGg60Dj62d9+NkflgGisdfP+gIgKwH8OWD4RW AJ+ZcUBHbZMpAu5oAQMoIUxKvHi83p2d1/CZ+sALjpppuaBEDQH7ydSIAKCwDSbYH0YBisuUXsuuuujXmmqIEgVCOL p0yZD69ZhAJAC7Ns0F+U/mtoMW8SQDWfFvhr8WcLwKwAOOeccxoCoIrpv6V3/jqVAF2k/lY1GPDTudsJAJMAGzdubE gAywQIt+arMwEQogRoVf5jc4NJABMAlvXh3/clgAkA+93q7PqXL/9pLe5Sf2YeeD1EkAXUSgLY/O8LgPe///0NAaA5 Qp8zOkbQf++HGoSWlgDZDKCKLdLVdGv8sWezoAIAQAC0LfPhdYtQABiq0RbTp093Ndp+0J6HJIAWeVrwZfEXgELZAq JVUzDtIl111VXVbgDWiQSIqAFYngRQx3c1fVPdt1K/FfT5waACQJ0coYyQrADQeeJhBgJtJEDOjnDRqQChigAL4DW+ eeLHUBmImgZaJoAvAKqz69+bCGgVCJbJIAgp8C+SAJb1JfLmf73X9fmi68UkgOSxiFoC5IxzMuBzpxoSQPdnH/pBBw ssAID4g/92JRmU+dSoB4CJAO3qC1vM2dc+FthLAijd09DCz1/8aZGn4FDB/ec+9zm3WNStLQB9tJukvz98R4D1UQL0 6fivpKJBoUkAq/VW3XdRFoACQf2svq/fteBf18d+++3njpGJQQK0ywLI7gQmaRJMAOiLAMsGsFIA6/eQHXeNtwRAu+ A/DBGUF7S3lgCtBEDIwb8vAXTai7K9fLLzvy8AJAlMAuj7n/rUp8LNCGjxni8e6+pJgCzLrjy1gYQA5QIAAHEJAP9E Bj+4z0v5J/ivgQDIigB18Pe58MILcyWAFntZbPFXhF8/arjjos68ogILwmQYCeMC9CWAMjskAfwdYd0X999/f/rWW2 81mgiaBNB9ja8EgLI/TAKE3hOgsCa8MB04nLHXuGSzAUwCqN+Djblf/qGAz28AaL9rz/WXXz6f/scdV6ZXHD0uvfnm m4NoCFl40kMJAdDsDJOBk3pgAkDotBeVexnZ+d+aAH784x93gsCXALpO9LP2mRLFsYBJawFQ/P5Phu19rSwAWxTGUK YBAADlMgAsC4DGfwiA3PIAXwpcdNFFTgYsWrTInfNsIsDHD/YXLFiQnn/++U3kPfd+x56e7vjfdxYgm/55fgUWH63r 9Mv2DSj/O2lQAkDorHfV/UoAKNXbdoQV6FsAaCngChh/+ctfut87/fTTGxJAAuDHP/5xumTJEve4rp8gTgYoyABpNc 6t04Grfy1Y4J7NBtAYa7xV8mHix4J/KxmwXX9/p1HBv06FOOqooxzByJ+Cnd3E3xkuHPuBk3mIZ8Qr+NeRrvpMUK8X Izv/33333W5+twyBI444oiEAJACtd4wwCRDEdZAmpef/8gIgGZb3dLZJF4E/AED8WQBZCdBruv/48eNr/tomcQiALN rpyQvctcMj1O1ZDZ+U8in0mC3+stgCwxZ7CgL2+cQ0lwEgJACqIQG6kwKdBvuhLf79DADd1+Jd9xUIKu1bWABoQaCC BZWCmAD46U9/6q6p22+/vdEHQj+rpoIqFal2INCiDKRkw7dsaUAoEkAnOPzlP7e6cVRfB2ESQGMuAaSsD7/2X0dG+s G/vfe186/A/5lnngkkA6BcNkB+2ndSOJmHLAB0xGtWAKvsy+Sv9Ze5+uqr3fUhAeBnAUgCCOsTY1R+F7qDPg/F10Ra iWwwdv0BAOqXBWBlAH4/gF6yALQ+5PWNUAAI1Xpffvnl6bnnnuvuK3DPC/CzzQW1qDjmmGMcWuxlFxt2f9W1MxwmAH S/SguSJM07z719t/DQ0r07EQB21JthgZ+/+2sBoBg5cqQTAEIBhMb317/+dUMA6NpSAKBAQnKgmgvSbno5FF8b7a+d 6mQA6D1v2JjqmEe/N4A//jb22t392Mc+1tQA8qGHHnLlP6tXr3bib+GKJyofgGTf+60lTk6mgBfohxr850kAjaMax9 rxsBIAlu3lj7dQ8P/000+7x774xS+m8+fPd58LKiGwn128eLGj6r0hyo19vhtMc0Vx9nEAAIDBKQOQBDARYNkAflmA oaax7Z534YwjyQIY5DXLsAkA7exO+dK1Dt1XEKAFmtWDamFntcBW86mdH/2MbiUAdH/MmDENIdBKBFRtRyJv8e7Xg5 ZL9wxfBpgAsKA9i9/0Lbv7u2rVKtdBXIHD//zP/zQe/+1vf+t6AUgA6FbNInUaxWOPPRZEJkgvQUAoEkDjoPFctmxZ +u1vf9vJPRMBlg2g8g+TARpjG3sJgL/5m79J33jjjcaYa9dfgaNuFfxbCVAoAiBPAhYf/RivAPDFjwSANXo1AaB53j 4HfCzoFxJDGzZsSNesWdMI/EPpCVFe/BXPI92cMgsAANCLBDAR4AsAPyPAygLKNGaPWwCUjdkiFgAv/ff/Sz982HR3 f88993QpH/6iThJAKZ5W86n72vXxF31HHvnORWISwOq+syKgkqkXeQKgTSCXlAoewxQAQsG+f8a73/TNdn+FAoZsEG C7fuoeruDRAkkF/hb8hyoA8oODoski6fikyeGSABKAX1iw2O3emgT0T+7QOKrfg5V8mCRcv369y/ywecAvAVLzOJUE iFDSkJvngPxgrml8B/x867kkRAEgVMKTFQAmez/96U830v7/7u/+Lp00aZLDRMAPf/hD93P/+I//GKUAKFc2kAYrhQ AAIBwJkG0K6J8QYF//4ymXpPtOm5muv3seGQB1FQBizP4T0w/+wxHudvyeuzgBoFs/cDcJoHpPYQLAFn96TEcM6kLR YyYBwmgAVyZISjtK9Q5NBGQFgAX9vgjwm74p9Vu7v34AaOn9fgfxcGpRO935TwYEgKGWhmhcJAEvu/vhJgFgaCfXlw Eq+VDWh77nB/8KDi2DRI9d++m/T7cs/Wr68spb0heXLQxiHsgL3FsJwDxZEPpRgCYA7H2v8cxmAJjsscBf143e7+PG jWtkjAk9pnIAEwDV/zzo9LjHsiUj4UohAAAIUwT4wb9uTQ6MOeDjLvi/a975hZ/JCv5dPIgAiFcACDVv00L9siP3d8 G/LwC08DMJYCLAb/ikxZ9uVStuEkALRvUUyMsGCHXw/R3ApOSCMaRz4U0A2K6/j5317geFSv32A0Cl+Wun3yTA1q1b 3e2MGTPS2267rSmoHD16dMWuh7ICoCjVO2l5XSQtMk+qIgFUniEkdywLyOr7Nf7W50Go5MPPAFJgqPIBv/mjvqdTAb Yuvyl97Tu3po/fNKvSc0Be+n6z3Ik3A8gXAHYahAkAjacd9erX/6vsS5lfkr/2OXDddde593xWAjzyyCPud+bMmRO0 AGge1yRt1yySLAAAABjOfgB+zb+VBLQTAAT/QxP8V0IAWBCw8b7/05AAvgDwg3i/4ZPVfPoSQOiiUdqoCD8bIEmLmz klHUiAJEgBkA3+/cwQPwAUkgDqGp8nAXS2vB5XgzFDZQKi6gIg6eB320mA/Jrzarz/TQIKG1973+o60EkPfrNHZX1o zE0A6PhHXwDoeUwm/OjOLwfZUdaXAFkBmEQmAGwuMAmQJwDsWtG8rnle0ldzvmUDZCWA7pswDqMUICk5ruXLhJIKyz 8AAIgzA8Dv/i8BYFkBuq/1WJEA0Gd7vYP/oVvHJZVZ7Obs1OvrT33qU24x59f5Ws2n0j616PMFQJ4ECDsboPUCsLwA SIISABb8W/q3znrPC/4V/BlZCWACYPv27e4x/fzs2bMdOiJw9913r7QASFpOBu2EQRKMALD3+uYHrm8SPRbY6b4yhb LNHpX1oTG38X/44YfdtXT22Wc3fsbvKxL2B0FSutljyA1BWwkAG0eb030JYCJAmSN+KZCaTJpMOvXUU91nRpWPBO1F AOSeFNEiywQAAGAoUOAvJAH+/sRz3dpMjBgxounnTBLU5XUZzs/kpPIvzruLN50P79d8qtmT7fKYBDjppJMcuq/FpC 0MfQkQZjZAmV2eJFgRoLHyBUA2+P/LL593Kd1q6qYeEHbOu6V9a/dXAWA2E0CN47Tb72cBqLO4gv9ddtml0mUARcF/ UbO4biRAFd/rvgDQWNoYW58HX+7ovsbaMgGECQCNsdD3NAeELQCKUv/T4DOAiiRAkQDwswDU80USwOZ5m/v/5V/+xX 3fPh/Wrl3rfseCf5UP6H54EiDtWQLQEwAAAIZbBOyx24h3MnNPPSr3+7xWCIDGsV8mANTYyRcAtsjTzo+VBejYQNs9 zKO6Z8J3JwA6lQBJQALA6rnVIO6oo45ywYDQ437zQO3+ZgWArhlJAAkA8dxzz7nHs8ax2gIgf/e+UwEQYj2wSQBL7/ /1r3/dUgKIPAGgviAmAcKXf3FLgFYCwG8SKZGrIF9jaxJAAkDXxOOPP96UBeALAAX/KiUJUQA0v297ywJAAAAAACAA ghAA2r310zyzDZ+086PF3z333NPE9ddf3+Cuu+4KMBBISkuAMlQ5A8AP/m38tfOv4P+ZZ55JV69e7TIALBjwjwwzFP TZsX+6boQEwKOPPlrRcW8d/LdO3+88CyCoCeqv/9FLlixpiJ7f/va3rneD3+fBJIAvAhT8S/4o7VtNQY2YMoD86ySJ SATova95QONnwf9+x56e7vOJaU1ZABpLjalKvSQB9Nkg+as5X9eM0v+feOKJdMOGDeluu+3mgn+hhpPVFQBFEqB8+V D+nJ8gAAAAACAMAeBLAAkALfi1oLPdHV8AaEdIt1r8KUjIHgUX/okA5Xb78wLIqi/4TQD4qf829gr4JQBc4H/mFenC FU+4s9513JuNqXZ9DQWAmzdvdo//67/+q+sBsGXLlqYsgDDGtjhtf+ACvmC3PxsEBCgAtGPry50333xzQLNHuw4kfj T22hFWYKhbO2XAuPHGGyMQgGl+pkgJEZAEMB9oHrjqqqve2fn/63t+x//+0d2uunbGgCwA6/ei35MEkACwJp/6OZX7 6OSAcD4D2vX/KNMHpLl/RJoQ8AMAAEBAAsACAQkA3a5Zsyb94Q9/2CgH8GWANX7S4k+7Per8bEdAKZDQY7EcC9iuHC AbOFZ158cEQHb3P1sbLhT8KxhQVoDOeld5gHWOt7RvocBPgaAfCDz55JOucVw1mv+1EwD9zhTJXjPhvO8V6GlMzz33 XIcd+SihY+997RYr08OuE429+j489dRTjgcffNDh9xKIQQAU7e6HlAHUqgzAyoCELwD8a8MkgDUClACwWn/7DAgr86 OsAEjTdkf/seMPAAAAUQiAxYsXNxaFOudZRz0p6LdgQGmftgA0AWCBv9WBhtsULB3QCTwrA1otAKu4GDQBkBf8510H Vhago+N01rt1erfgX8GgAgJr/JcnEqoY4PUenIe109vJe1/jqfe/MgBMANx2222N/g5q9mgSQFkfrTKAYmkI2L4fSL hjbhLABMCmf57foEgCZAWA5n6b/00ChzTe5ccRAQAAAAARCgBb7Fnwb4s7f1GvZk9CJQJK+/R3/+MQAOmAxV3aQgZk A/8qCwA//b/stfDisoXpa9+5tXHcm9V/q+5bwYB2fsMYZwRA2UwANX2z/g5CkkclHiYCJAD0tQSA/7vW/E0lAKGXAe UJwE56SIQoAHwJUCQAhASAer3ocT/wt8+MMLMAehMAxWVDAAAAgAAISADYws8WeJbiKdTwSTWfed+PRQBkF3h5HaJD EgCdBP/+9fD4TbPSH935ZXdfQb8CRDUGU6BnAsBn9OjRlcwA6M+ubXsBEGoQoDFT+r7GVQIgm9EhEWASQP0espkfCv 7VR0SMHDky4Pd+wbgWCII04N1gvxeIjaMf/GflUFYA+GUA+r7EoB0FGJYE6C5DJG/ckQAAAAAQnADIS+nWzo4t7vwA v933YxrEVou8qi8CuxUAdg1YCYBJABMAqvn2d3+VJm5Yb4C4BEBaKhU41GDAmvz5u78aSx3/qPtq8KiTHiQB1O8h7+ dUJiBBGG4mRP57P5sNkEQgAMp8BmQlgC8A9J73Pwcs+Nd8UO1TAPqTIZL3OVDlXjAAAACAAOhoUegv7rIBfrvvRzOQ LRZ3Vc8A6Cb4L7oWsgLAdn8VAM6ePduhXgHVaQaY9LlmO04BkA0Alc2hwF7jaf1BTARYn4C8nxs1alSU4m9gWUB9do F9AWBHvVqg72MysC4CIKb3PgAAACAABiwAW9X5xlMHXC4g6Ob7MQUCGmPr+K77EgDa/VUAqOBfPSLifWOXCwRiGGsL 7DWmI0aMaDwuuZPNAMj+XMwSoFUPgFjf/1Ym4o+7CV8fzQdxCoC0beYHAgAAAACSmP7P+Ds93XwfARBPIGBnvRuq+1 bqt3Z/YwoAuw0EYvn/qTKOMkKn7M/F9p6v43u/6OSPsE+BAAAAAEAAAHRcKwxxocC+TClH2Z8LVQD06+cAAAAAAAEA AAAAAAAAAAgAAAAAAAAAAEAAAAAAAAAAAAACAAAAAAAAah6U0L8JAAEAAAAAAAD1EAA7duyotQSgYS8gAAAAAAAAoB YCYOvWrQgArgVAAAAAAAAAQB0kwMaNG5EAXAuAAAAAAAAAgJhr/hEACABAAAAAAAAAQMWD937U/GcFQOyNAfOC/ToK gPHjxzdRx4Dc/4cAAAAAAIBhXZjXtUP7UC3IQ7gG7OtRo0alL7/8cl8EQLbmX/f13AcffHDT1/qbZf7bhuIa6Oc1US QAyv690K9PG7+dO3c2URcJkLT4hwAAAAAAgCFfnPuL8jVr1tRKBAz1orzK14AFZOPGjU0XLVqUzpw5M91vv337XvOv 2+3btze+1t/Q39q8ebP72+3++wbzGnD/+7P3yF8GRwI0Bf9/8f7en5O2/30hceCBBzYF/HXLAkja/EMAAAAAAMCwpu UKSYCrr77aLd5ZoNdPACgwf/3113N37QdDANhjr776aq540n+XsgiGSgAMRtp+KwHQ7vlDvh51XWkeqWPK/3CPHQIA AAAAAEoHhFq0SwKwaK9Hrb8vACZPnpwboD/99NN9EwAvvvjigOdXkK+/nXc9rl+/flCDyKYMgIKxHwoB0OpxGgcCAg AAAAAAekZp1wrAFHxZ+n+degFY2nVdAyyNtbI+/AyAbP2/7v/iF7/o6rqw5xs3blxLAbBt27Z0woQJuQJg+fLlQyYA BisDoMzzIwAAAQAAAAAAg4Yar6neWynf2vVVoLZu3Tp3u/fee9e7BODtpJYSQPd1DWQD9J///OddC4CXXnqpSQBs2L BhwPNv2rQpnTRp0oDgf+XKlUOSQp7NAqiCAIgp+D/kkEPc+ErymGwcO3ZsLTOLWl1nCAAAAAAAGLSgT4G+GrD5O/+G vnf6509NJ06c6Ih5UV70vd/97ne12H3VeFvfBz8DwE/bf+WVV3rKABgzZkzj6+eff37AMYD6GQWJ/u/qpIAFCxYgAA K//qZNm9YkFyUbJR0lH4tOf6iTbEQAAAAAAMCQBH0ir9O7Hlcw9uSTT7rAcMqUKY1j26J7Hf6SlF6wx3w9+H0flP3h B+S9CgAFfH4GwKpVqxrXk26feuqp9DOfnloZGaTsjzJBey8CINtzQLIptmtKgb8F/3mSUfKxH8dNBpGO36GARAAAAA AAwLAEhd/73vdcYFjHpoB1PiJQ2R8SQLoGdt99d3f/gAMO6FkA6Dl8ASDJsGLFisoJJj/7w/69/fbbPQsAPUeeAIjt +tJ1o+DeRFJekL/vvvtG3HOk/dxBCQAAAAAADGs2QBYFfkYtX5e0vg3YVPYh6SMB1IsAEFu2bCkUALrV36maAMjLAE EAlEeBvyRAHY4TreLcgQAAAAAAgJaLdR3zpk7vavamdG+hoM/KAEwExLhbl3Twr04CQKUfNva61bXQ7fVlAkCBfp4A qNp11c/xbxXwx3pdzZo1q4HGuEgyZr9XpxKAwcwCQAAAAAAAQMeZANqtFQr8TAjUqRxAu7X+jm3dRIAF57ovCaBrQP f32muvjp7n2WefbfyOH/zb36hq4FcUqHc6/q0C/hhT/xX0S/qYSDTuvfde1+9BstGaAep248aNDcIXAUnHUnEw5hUE AAAAVJrDLviag9cCAKCaWBmA7u+xxx7pxRdf3JEA0O/o/pIlS4JsKNnLrn0ddvx9FOxLAphALNr9z2Pr1q3pjh07gp YA/WwYiQCA2nLQ1LMbAYKhx3htAOII/mcv3eJAAgBUF+3gKogb8ckRjk9+8pO1rOn1swPqlh1i2QAa/04EwMqVKxtB fxXr/bsJ7BAAg5+FxOuBAIAaB/8KDO7c9McGBAsAcUoA3tMA1UZBn9BOsII61YnXUQLUtTmgLwB0DZSVAA888ECTAA g1uCs6yq9TAVCX60V9H4wxY8Y07tclyB/OPiIIAIgmOPAlgCBYAIjrfc7rABCOCJg7d2464qAR6UEHHVTL3bU6BnSG sj8kgHQNtPtZXSP3339/sLv+aUFviG4FQC038/46R8Rb89+9COAYQICSNcISATveShuZAAQNAAAAAEOLsj8U3JcRAE uXLo0uyOu0BIDU/nhr/vtZWoQAAGiRCSAJQNowQNzCj/c2AEC1d3bb/UyVu/wPhQQg+Kfmnx4AAAgAAOjgvc77GwAA AAABADXeFfR7ACAAABAAAAAAAIAAgAgDguwtAgAgXtmHBAAAAACoiACgPhOGQwBYwG+ZAAgAAHoBwNBw4IEH1vw1oE YVAABqKgDygjHd5wWHvl/A7zYGKToKEAEAELcAUL8P3ufVYNasWekrr7zS9e/rd9U0TOi5Qjw+rpeGXtmjn2gOBgAA QQgAP/jPooCMFx36Gfxfesfy9Ge/+cOABoAGQQFA/AKAMoDh3fXXuc0K2O22FwHwvve9zwX+9957b5MA0JFiVd3171 fAPpRnQJeV63TeBgBAAHSclpmFFx0GQwDs9Q9HNCSABf/sCgLEmfKf/RoBMPhB/s6dOwc8Pm3aNBf06/u2+3/AAQe4 740bN66jv6FgX79vv2cSwL5/zDHHuL81HCKgVTBetGPfafCet/uffb6hFAL6fNXZ2zqDu+h87naCQOe7Cx3zFuoCuR +vOZkcAFCbHgAAg42C/jwBQPM/gDjJe18jmAeX8ePHu+A/r76/3wJAAb/9np5HX0+fPr2tAJgxY8agB4FDLQDynq/V f8NgZgFs3LixgcbgpZdecrfbt293bNmyxX397LPPOlauXJk+8MAD6f33358uXbo0+CyCpMd/zCMAZCMhAAD6KADE+L PmORFgEoBgACBe/NIe2/2n3GfwBYBu84L/Qw45xH2tXV4JAFukKZDvpIZfv/fUU08NEABWUqAgv1UGQN5/42ALgH7v 2HcrAAY7Q8BfgGt8xJgxYxr3jb322ivdY4893LVgxLZoJ/gH6B/W86VVhpGykJSNFKMAKDNPDNZcggCAoK2ggn+7NQ mAKQSIvxTA7wFA8D+0wb+CfgXj/lyrW18AKEC0nyk7nz/99NMNAWDPZ+nj9jclHjr5bx2M4L+VEOi3ACgSDJ1mKrDL BgBVQXO7IdEr+av5X3O88LOOYpyXqiAREQAQbPBvGQA2OZgEECxiAOLvBUC2z/AIgEmTJqXr1q1rmmd1Xws5PwNA6e GdCAAt/CQO8oSCzfN+1sFgS4AqCIBu+hF0s2jspObfR5kaQqJm1apV6ZIlS9Krr77aUYea/7ffftvB7j9AZzv/avia zSKyzKLYhWQVMocQABB8TZDJAJMAdp/XCQCg/wJgwoQJA3b3LYXfFwCdZgDo5/0MAF8o2GMSDxIQCIDBywLI1vxbrf +LL77o2LBhQ/r888+7gN8nltT/pA//mD8A2qf+1zVbqQrzBAIAgpcAfj8Agn8AgMEVAJMnTx6wu28p/P6OvaVvlp3P /Z/PPp8vCSQgqi4AigL4tguyNr8/mAIgb4FtwXwefsAfaqf/TseklShgzgAoh3q72FGvlkVUNusolp4AXWdrpX08nQ QgpowAXg8AgP5JgGxArXn29ddfzw3O+ykA8rIMsn+33X/rYC3ShlMAVHlXCQCgbAaAJIDh9wSwfgASzTH2BKhCdlH0 AsCOhuOcaAAAgN4ZO3ZsumjRonTmzJnpvvvu2wjO/ayAfggA//n0d/T39Hf196u0eBsKATAsNaLvLrT322/f3O9p11 /9GKLPAvhLUnoRz/wA0Bk66lUZAUXZRtnHo93IbJHZRQlAlwKATtEAAAD9Y9SoUU079Fqk5e3YW1O5doFm9ucsA8CC Svtaf7eK6ZudZAqUXeT142jBXgWAXnOJl7yFuXo+rFixotH0r27HdBH8A0DQwiGWIL9VR2g6RgMMz3uT1wG4LuLvw5 K342+d5csIgOzP5WUEVD3AHAwBUAXRs3nz5vTVV191kmbbtm3ppk2bnBj4zKenRtH0r9tU3d/97ncE/wBdMnHixPSY Y45xzJgxw2UTZecRZX7V6TSAofwMSIZr0TAYaf6i3cKShSfA0JbfdPKe4/3JdQHhyoC8lP8yi7e8n+m0hKDKKZxVeb 5uGTdurBsHNX9UA0adwlB0FGOU1/afE3b8AQYBiUSfbJaRso86OU0mRgFACUCbBaVq/IUtLLM7/mQAxFXSwWsRTqBX NtgjMOSagPgEQFWeDwEAAFC9LABj2rRpLtjXUa+6VcNX9XypStnXcGYcRS8Axh97dtcZAhYYWrM/1fxb3b89Th8Agg eorrAZrIadnA7BexiGTgKUqfkfqucJWQIQ/ANA3VBmkTKMlGmk+X+4G74OpwCIsgSglQDodbFuAYcFEr4QYMFJ+jBU B41j3nu3l/eqzR97/cMRDruPBKieAOB9HKcA6Mf5zP16HgQAAABARQWAAn+ffnzoZ8sAWGjGFUTwOoSdEdBNw86Dpp 7dNmi49I7lDRT4jz9rHgKggsG/X67FaxOfBOiHAOD9Wl3Gjx8f7ZF/nezScS0AAAKghw96Bf2Wpt8vAQAAYaeA+99X 8N/udzRv/Ow3f2ig4L8OZ8eGNvbZfi28NgDVDvazrFy5Ml2wYEGta3IRAACAAOhRAGR3BVmsQzc7yrweYYxXNw077f fygsbsc1j6v7IATAL4JQGMQzUyALLXAK8RQDUFwM6dO11PhvXr16fLly9viAAEANcHQK/oCMDaB+J1LQHIHvvAGwK6 2VUkiAhL2nTSsNMXB9mA368p9wPKPAnA/FItCaBx7iQbQGPI6wgwvFkAdU35J/AHGBwkGes4twxnWVHChQcIABhOEV CmYWc2cyAb7Gd3le17vgRAAFRXANi48RoBAADUM9OorrJxOLKMEAAQLHkBIBIg7DKOonRwf4z9oNHfPbbvCXvMGgMS /IeRBVBGAlgWABljAAAAcUkAo24ZAQgAAHoBQAZrAmhBvwX6fklAkQAgUKy+BOj0/WsnxtAzBgAAIL5yozqXAgxFOQ ACAKIJKPzAj9ck7pKBbA8AXwxwDYRbAqLxKysAaBoLAAAAgACAmgsAygDqtXtc1ACQ1ynsPhDtdv6F/SwCAAAAAAAB ADVL9892lud1ql/fAMa9HiU8CvgpAQAAAABAAEDNdn9bnQfPawUQ0QdVJsintwMAAAAAAgBqJAGyZ8UXnR8PAAAAAA AACACIKGW46Px4AAAAAAAAQABAhLXgvCYAAAAAAAAIAAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAAAA CAAAAAAAAAAAQAAAAAAAAAAAAAIAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAAAAAEAAAAAAAAAAACAAAAAAAAAAAQAA AAAAAAAACAAAAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAEAAAAAAAAAAACAAAAAA KsH48eObqOOHtP+PawIAAAAQAAAAEGXgv3PnzibqIgGSFv+4PgAAAAABAAAAUXDggQc2Bfx1ywJI2vzjGgEAAAAEAA S1q5ckiaOu6bxcCwDFKPCXBKhjyn9WAHA9AAAAAAIAgg3+/VTeNWvW1EoEsJP37uvQ45jXVR4BAAAAACAAILjdfx9J gKuvvtrt9pHWWy8J0Mvv7tixo9YSgJ1hAAAAAEAAQJBSQMG/JACpvgiAsr+7detWBEAN/n8ecsgh6aRJk9IJEyakky dPdmM+duzYWs4PNubIHwAAAEAAQBCMHDvSLeBtIV/nPgBcD70LhI0bNyIBIv7/N23atPTll19O161b5263b9+evv76 6+miRYvSUaNGkTHEPAAAAAAIAKgqWrBr4a4FvBby/sJ+xN4jar2Y5/ponRGQJ4oQAPEKAAX+Fvz7otCYOXNm43t1zA pi3gAAAAAEAFQ+uNOCXQv3vAW9vve3J/1tOnHiREfMi/pWgVyMC/uyWR7tBEC25j8rAGLPJsm7LmIMAm+44QY3Hwil /+eN6b777hvteJeRgwT/AAAAgACAIILAXffdNfd7Wug/+eSTrg/AlClT0oMPPri2fQBikgDK+ujHTm1ezb+JI7tW7O sqpYb3cyyLBID/eAzXjsZQPUHq0BS0m91/AAAAAAQARIEW/N/73vecBKhjQ8AYBICd7KD76vegkg9lfeSJn15r/nWr UhL7Wn9Df2vz5s3ub7f6bxuqgL/fY5l9rryvQ08bnzVrVgPJnbyMIZH9Xt3mAQQBAAAAIAAgqGyALLvvvnsDdv7CDP 537tzZCLI1pur3kLdrPxgCwB579dVXcwPC7H/fUIxfv9P22wmAVs9f9evLgn5dH6+88koT9957b/rUU0+lTz/9dKMZ oG51PRihi4Ckx398tgAAAAACACqb4quF/C9+8Yv05z//eWORrxIAKwMwEVCHGt9YFvXZAFsnPeQF6Br7fgmAF198cc Dzq1RAfzvvv0/fGyoBUDSGQyEAWj1e5etK84AkwAEHHOAokoV5aGyzfSLqlAWECAAAAAAEAAzbDn83mQC7HLCLQxLA hAClAElQ457NAMjW/+u+xE83QZo937hx41oKgG3btrkz4/MEwPr16we1DGAoMgDKPH+oAqBfmUXMwwAAAAAIAGAhDo M87mvWrGkSADrmMRugK+ujWwHw0ksvNQmADRs2DHj+TZs2pZMmTcoVAMuXL0cABCAANMbGmDFjGvfrMreQ5g8AAAAI AKgVe+21V7rHHnukIz45wrHrJ0fWMgsgZAngZwD4afvK7uglA0ABoX39/PPPDzgG0I6Pywb/K1euHPQmgNmxq4oACD WIPOigg6Kt+e+1XIjPCQAAAEAAQFRcfPHFDpUCKHibOHFirUsBQlj0KyBT2YYd4TZi7xFNAXmvAkCBoJ8BsGrVqsYx gLpVo7h9jttnwO/qewsWLBhyAVA2aO/Hc5c5ASBUqRRrzX8dJSEAAADUUACoyVPtX3AuvI5EwNy5c9MRB41wO4J1Xu iHcO0o+Pd7N/ztSX/rJI4eV2NH3Vevh14FgJ7DFwCSDCtWrGh8XaXArF8ip4wAqMv8QqkRAAAAQEACQLuA3f6+fleB oNBzhRYU9isICGXBzyK93ihzQ0Lge9/7Xk8CQGzZsqVQAOhWf2e4BcBgvl8RAAAAAAAQhAC44YYbXCqwnfPcSxaABM D73vc+F/jrfOgQBMBgBAEs+CEUATBlypTG8Y66lQTo5rn8UwAU6OcJgKrJpn7WcLcK+JkLAAAAAKASAmDatGlu4a4U YNv91xnP+p4t5suiYF+/b79nEsD/WyEE/92mdLdb9BMAQBWx4Fz3JQEsA0jNHjt5nmeffbbxO37wb3+jqpkmRe/ZXs 56570PAAAAAMMqABTg6xzwwRYACvjt9/Q8+nr69Onu62OOOcb9rSql9g+FAGAXEELBygB0Xyc9qMdDJwJAv6P7S5Ys qVy6f69B/GD+LgAAAABA3wSAumsr+Lfu39ng37qAa8HudwFXIN9JCr9+T52+swLASgpmzJjh/l62Y7weH6pd/k537P uxC9guKCBQgMpMOO+eFKD7OuKxEwGg0yAs6K9ivX9Hk24X700EAAAAAABUSgD4x2wp6G93DrjO9LafKRs8PP30001H gen5/E7ger68UoDsf99gC4AywXivAqCdECiToQAw1PgCQNkAZSXAAw880CQAQm0u2e0cENqJEAAAAAAQoQDIC/7FpE mT0nXr1jUt0nVfO/Z+BoCO9upEACjAlzjIEwomG/ysg3b/nYO9+z8UAqBMsE/TQKgau35ypNvV1zGP7X5Wx0Def//9 we76d1o61OvPAgAAAAAMqQCYMGHCgN19S+H3BUCnGQB+J/CsULDHJB4kIMr+t9ZBAAyXBOC8bmiFynUU3JcRAEuXLo 3uOuq0BIBrhnkFAAAAoJICYPLkyQN29y2F39+x37hxY0cCwP/57PP5kkACouoCoJtFfZnfr5oA2LFjR7p169amRXse rYI/EXLNdz9e81gDwDJ9QKrc5X8oxrVOwb+uB9FqrtB8onklxmuizHxBNggAAABUTgBoYfb666/nBuf9FAB5WQbZvz scAqBVcD4UAqDT/9ah2K3T2Bkat5deesndShSJLVu2uK/V7V0oPVx130r9jmH3N+nxHxMWxIzKuQxldilbTIJXc4Lw 548Yd/+ZCwAAACAIAWCBdTaoHjt2bLpo0aJ05syZ6b777tsIBP2sgH4IAP/59Hf09/R39ffL/HcO1o5N0YJtMAVAu0 XicC8e/R08lXEI9XOw+4bOetdxb9r1Neq82GfBD3XZ+X/f+943YD6wOSL2tH/mAAAAAAhGABQxatSoph16BXJ5O/aW Ht4ueMz+nGUAWGq4fa2/W8VUzl6P6SsT1FcpyOcNBgCdpv7Xdd4h0AcAAIDgBYC/MCva8bca8TICIPtzeRkBVV8ADo YAqNT/vw5q/n12OWAXh2TOqlWr0iVLlrij3uzIuLos5Nn5g7oya9Ysl/ovCXDAAQc4ys4fMfQE6OW9z1wBAAAAlREA rVL48yRBGZHQ7vlCEwBVer7BrPm3Wv8XX3zRsWHDhvT55593Ab9PLKn/SR/+MUlB3TIAJAEMvyeA9QPQHBJjTwDmCQ AAAKiNAKjK8yEABq8cwIL5PPyAP7Zz3suME4t5gGamT5/uMgKK5o3s4zH3Awht3gcAAAAEQNta/uF8npAlAItAAAAA AAAAqLQA6EetZr+eBwEwdJkAu+67a+73tJt3yCGHRJ8FQN0/QHumTZuWHnPMMemMGTPcvJCd43XaS51OA0D8AgAAQN ACoGzN/1A8BwzdeKtmV0c05qXz6rzvFStWNJr+xZzSSwkAQHs0XxjZ+ULzSPY0mTqVADBPAAAAQHACAOqHjmbcvHlz +uqrr7rSjW3btqWbNm1yC/l9jtsniqZ/ne7y+wt5FvUAzUycONFlA2iOWLdunbt9/fXX00WLFlXmqNfhnjcAAAAAEA BQWUaOHekC/MmTJ6cTJkxIJ02a5FJ86/imYyEPUA7NEZorNGdo/hg7dmxt5wtKAAAAAAABAAAAAAAAAAAIAAAAAAAA AABAAAAAQAXRKQC1/3DmOgAAAAAEAMTE+PHja3fsX159L9cCwEB27tzp5gjmB64FAAAAQABAgMF+lpUrV6YLFiyo1W Kejt4A5ecMkwA+dRMAzBcAAACAAIBgF/M6BnD9+vXp8uXLa7WgRwAAdD9vGHXLCGC+AAAAAAQARJMFUNeUXhbyAN3N G3UuBWDOAAAAAAQAAAAAAAAAACAAAAAAAAAAAAABAAB9YO+993bU9jV4b0YFAAAAAEAAAEDcAkCNHWsrAZpnVQAAAA AABAAAxCsA3nzzzfS73/1uPSXAwJkVAAAAAAABAAAIAAQAAAAAAAACAAAClwD33nsvEgAJAAAAAAAIAACIXQCsWLGi nhIgf4YFAAAAAEAAAEC8ZQC1lADFsywAAAAAAAIAAJAA8WcBIAEAAAAAAAEAADUQAAceeCACgGsDAAAAABAAABCbAN i+fXt9JUDhTIsEAAAAAAAEAESAgrta7fIOgACvSADUTgK0nG25RgAAAAAAAQARCICdO3fWWAIkLrYjwCvOAhAXXHAB EoBrJJcPf/jDDiQi1wIAAAAgACAAAaAAr74SIEEClMgCqI0EaDvrco3kCcT6CgDmDgAAAEAAAAIAARCBBPjVr341oB SgHpkA9ZEAo0ePdtRWALz3aYoAAAAAAAQA1EcAKOBDALCI9wXAa6+9lq5fv74hAUwAxC8Bysy+STQC4JVXXulaBJgA mDt3bpgSYOCnag8CgPkDAAAAEAAQgAC44YYbapwFkCABcq4JsXXr1vSNN95oEgBZCVCGYK+JUhKgDNUXANddd11633 33dSQBLPjX3BGNAOhIAmSDf+YOAAAAQABAxQO9k08+ucYCIKm9AMgL2KdOneqyACQAVAZgWQAmAG688cYmCWD3i6i2 KCgI2kvPwv1keCXAwoULO5IAJgA0f0yfPj095ZRTaiYB8gQAEgAAAAAqJgAs1bOXus+g6Snds3qp2j69CIAgJUAf0n frIgGKgm6NvzjrrLMaHHbYYU0CQKUAmzZtagiAefPmpTNnznTB/ZQpUxqB/pVXXtkRuuZ0vQ3NNddhMD5EAuC9Pze8 11w3EsAXAJJGwQqAriUAAgAAAAACEQBa6FndZ60FQOASQEGadmfVsV10KgO0gFfAd+2118YhALrYwauTALB0bcPEj9 A1cM011zg++9nPNgTA2rVr09tuu81hguC8885zAuCMM85Ip02b1pQF4Af3Rdh1Ztfa0FxvRcFajwIg7UfgP/zXm30u /OAHP0hvueWW9LHHHmv5+eBfTxrTc845Jz3uuOPSL33pS/FkAbScR9pdTyxQAAAAoEIlAFrYqebTb/5UKxnQU9BYPQ lgNdomArIyoEgImABQ0PeNb3wjPgnQdmyTWkoAoSZ/WRGga0DMnj270QPg61//evqnP/0p/f3vf9+4to4//vj0hBNO cBJASAIcfPDBTgDYdVSdwH9g0DYw+G4tAQY83IMEqFrgnycAlAHw1a9+Nd2wYUPhZ4MvACSPNPZRCoDC+QMBAAAAAI EJAC3ylO5p2QC1ygjoeee4mqUASs/WgtyXAQr0RJ4IiEIAdCIBBoxvvQRAthTAgvE8EaCA7hOf+IQL/j/0oQ81YdeW vn/iiSe6n/UFQFYC2PMPX+CfP+ZlREBe0J8rAkoG/1UOEE0CaPdfAkCZAPqcWLx4cdNngx/8a6w1f2jsVQIQrADoSA KUySZhgQIAAAAVEgBZCaBdH9HLcVDx7/iEIQJ8CdBKBFizN9V7K+Vbu755EuDQ/UbHJQKSToO1eN8DrUSASQATAP89 f0RDANh9XwKYALDfrc6uf3sZ0EoENCUD+HPDuyKgzHVV1V3/os+Fbdu2uc+G66+/Pr3iiivS+fPnp7feeqv73j777B OvAOhgDkEAAAAAQHACwJcAttOjnR8t/n7605+6hR4SIGwJ0EoEaBHvlwhYHXeRBBAnTdozopKA9mKgLqcC5IkAC+AV 4Ou6yWYBGDt27HASyTIBfAGQ3fW/4uhxFRVKrUVA0uK6KpNBEFJQqM8Ezf/6LPAlgLjzzjvTb37zm+5nbH7JCoALL7 wwfgGQIgAAAAAgUAFgCz5L+RQmAkwCRJ8N0HX9ePUlQDYbQFhXd9V3Z1GwZ0GcH7wtu/LUdPWiC91tEBkBXb+j6ikA 8kSABXhWCqBAX7d+8G9yQAKgXfD/b/PPTm8958iKXz/Fu7tFEiApVUoS1jWkeV/z/9KlSxsS4PLLL08vvvhi1+BRGQ H6XLByD18A1CYLIK139hAAAAAELABMAqjhkzIBtNjTok+LPz22bt06JECgEkCBV142gE4OeOONN5wMEOr0bs3ehIkA P4ibOHFietRRRzmSIBa3Obv8JXb1kpw6cXfr/auDCPCzAUwCvPDCC+7WRIBuN27cmB577LFN2SP2u7pO9FzP3n6FQx KgulkA6YAa79xroYQAaL70wrxeJAE0/5sEkByeM2dOetlll6WzZs1KP//5z6cf+chH0g984AONEyBMAFx00UVhC4Ae JQACAAAAACovAPxyAKV6+hLg+9//fvqTn/wECRBo4FckAUwEKBtAR7z5zd6sttskgM6A1/M888wz6c033xyIAPACsA 6C/zISIPqJ5d3APZsNoDR/BfxKA9f1cf/99zeCfysZMGGUuNctSQ8fv1f6i0dvc8G/kAgIo69EfjaA3wCwMFMgguBP 873kr+Z/pf5/61vfcsG/UCaAJICuh6OPProhAT7zmc/EUQbQaRYRAgAAAABCFQDq9qz0Tl8CaPF3zz33pM8995zbFT LynuPY/Uc2SEJbAHW8SxyWBLBgPisBFNxLAOiYN7/Bm6V8+wJg9erV6cQzr0gXrngiOgnQ2N3NCe58AVCHiUUB+uxD P+iCdY27xl+YBFDQr+vjrbfeaqr91/Wknz/ttNPc9SFZJAEgVD7y/OJrAhIA7bMBikRRLMGfPhMkfzX/Cx33ZxJAAu DMM89MzzjjjIYEkAAQixYtCl8A9CABEAAAAAAQhACwBZ+6PUsAqOZTaZ/a+bHFnxZ9WuBpZygrART0r7p2RgMkQDUl gPUG8NFRgNlGb5byrQBPgd/LL7/snkPB/47//WN4Y5uUFAAF6d11W9QrSLe0fcsG0DXg9wYw/OBf14VkgW4VIAqVja iERH0kllxyontuyxAI5tpJytb7v3epJWn4pSP6TJD81fxvAkCfAyYAVAqgXf+PfvSjDQmgz5AoBECXEgABAAAAAMEI AFvwaddfaZ5W82mLP1v4ZSWALeb/69/vdem+v1nzf5EAFZYAWRGQJwD8Gm+TAJYJoDpuEVYQ11oClGnyVqeFvQkA7d pr917j7WcD6HoxGaDjQ/20f6GAXxkAyhpR6YgkgJ5HJ0noelMzOfUMCO36ySsTKbouigVAElSmgOZ5m/v94N8EwMkn n5wed9xx7rNDIkCfD1/72teQAEgAAAAACEEAaLGnGl8t0C3dM5v2KXwJ4LNl6VfTF5ctdAJg8uTJ6QknnBBWoNjBD+ cGjTkBQFUlwI033pjOmzcvPe+889Ljjz/eBXX+ee8SALoWlPLtCwCN8csrb3HjLOkTlQTIjGmdBYB267Vrbw0g9b63 bACh6+WXv/ylCwL19R83/Vv6n08sTq/99N+nEz/6jy5bRCUjEgH6fZUV6HklAHT9+RKgytdQcxA/sAyg3XXRWgAkQQ gAzff+/G/BfzsBoN8NTxQOjOm7EQBNZUUAAAAAVRQAtrDXQk69ALTgUyZANu3TlwAqD9AiT7uAIisEhCSAiYAQUn27 kQBFZ4hXsXmcLwFmzpzp0PgUZQGo3ls/q+/rd//jjivTrctvSl/7zq3p4zfNiqYcoF0WQN129bRbr117Be/axdduvo J5CQG/UaAYOXJketmR+7trQ4JIGQMqFbF+EULBv186IAFgEqDK2QDldvKTzuaYgM6O1xwu2av5PisAFPxPmzZtgAC4 6aabGgJAfQJEqCIg6UQCFDSLTFiwAAAAQJUEgN/x27p+azGnBV5e2qfQwk8ceuih6f777+/Ofv7KV77SEAGGfxZ4dR d/OTt6Xa4S89b1VVzg+xJAi3NJADvX3QJ/6/SuZm/WRNAkgAJ/lXj86M4vB7q7V04ClE33jjULQLv2EgAu8H+3AaR2 97XLr91+7fpbYKfrQWJI2SF+iYh47LHH0s2bNzeCfWECwCSAMlKqeC31Q+C1EoTN11YYEsDmf18AvP/9728IAJUWSQ DoJBm7BtRkVvjXRShSoPTnQrZxaO41AAAAADAMAsDfvfMDf0MLcp3zrPrvorRPpYZLAEyYMCE9/PDD3cJPEsB/HjtL 3hcBldrtT1rs3nezQixY2FdNBNhYTJkyxS3gJQA01rbjr0Dfzni3Tu8aS6V8Z+u9gxUABeOctAjY6tgM0MbYGkAquN cuv3b7tev/55eedt//9ZP3uawQlYbo6+3bt7vGcHqe3XbbzT0mCaDmkk899ZTjwQcfdNx+++3Bp4rnpo43/v8k7aaJ IEoBTALY/C8U/GcFgE6QkQDQfOJLAF8E+EIgmkyAnIaRSZuPChYzAAAAMGgCIC/o9wN/f3dOaPGuI560Q2yBvwX/RQ JAksB2lu15ikTA0MuAVvW7Pa7Kk/bk/73hzwDQfUkA3Vewf9hhhznsjHfr9K6MDqv31mPnnntuI7U3aAGQlBvL4uul JhPOuwGcBIB2+bXbb40+hbJBlBlifSF8AaDg0MjbAU4ifB2bTgZI45BHkgAq+9K87+MH//rM8AWA5hGTAH4pQEjBv9 8jplACFB4J6UuAJHN9AAAAAAySANBiLBv0K6gz1OX/mmuuaUJBnkkAHfXkp3xa2mdWAJxzzjlNQWMew5MV0EHQ340E 6OD5qlAe4AsAcfDBBzewHX9/DO2YN6v3jioDoOSY1THoLxIB2uXXbr92/fOCeWUCbdmyxd0/8sgj04ULFza45JJLXO NJPR5r8O8HfUmLfyEKAKGyL837hh/8C2sC+PGPf9x9RvgSINjgv9Xuf9v5YmA5AIsYAAAAGHQBYMydO9cxffr0dOrU qU1Bex6SAFrgWaqnj7/zI6zhU7bRl492ka+66ioXWPoioEoBX0cSoIfnLdNFfDAFgMYjb8w1NsreyJ7xrppvpX1r51 fBX9A9ADoO/pl0TABol1+7/dnx132dG//oo486CfDkk0++Uz7w18D/jjvucLeSixIAF110UXr66ac3iYAYhID/ni4j AUISAdbwVT1fJH0NP/gXd999t/ussQyBI444oiEA1qxZE+4Yp0kpgdxKABD8AwAAwJD3ADARoF19YcG8fe1jgb0kgB oDGpbO6+/86Cg5Bfef+9znXKaAbv1FoaEyAf19vxRgaMsB+igBkv4w1ItCXwD4ndhtx9/um5yxwEyN3/JOAQjyJACC /57LAfLG3R6XCFC2j58FoNRwEwCXXnppkwAYN25c434sJQCdCIAQZIAJAMkd+2wwNP9rfl+wYEFDNF999dVu918CwM 8CeOSRR8KcN0oIgCSTcYYEAAAAgGEXAFkRoN0cnwsvvDBXAijYz5Ld+ckL9rPob1Zj4ZcMI8P7/z0rACzo90WABf+n nXZaumnTJjdm6v6uBnCqAVcauNV7K9gLazHfWdp/mSQQJqWBEmDXXXcdIAB0q8Bf158CyqwAiEkCpF0IgJAkgOZzZZ BZnxjN+eeff35jjhcPPfSQQ8H/00+/0zBSY28yINzyjnLSMN8jJ8wZAAAAMPQCIK88wJcCStGVDFi0aFF66623Dtjx yQb/2vnR4s8n77kVAMybN69Ci7/Wdfpl+waU/Z0qLPJ9AdCqT4O/06vz33UEnJrA+ce8KRBQyndYO3r9zMpgMV8GBf bz589314sEgIkBHRFowb8eV1lSlE0Bi4L+gu9VXQBojvCPErWML5v31RtA45ot79Dj+h3drl27NsjsoXICoEj2Dl/m FwAAACAAOpICauwkbrrpJnfOs3bzhB6zms8sKi0YP358esIJJ6THHHOMkwZWE/xP//RPFV78lQvwu2ssOPzpvq0EQD b41xnw2unTrR0FZ13ehZq9KagLKwugs+A/b7ySgnpvaC0BvvCFL7ig364vCxIV/FvWkRpNxjppv3cigDeRByQB8gSA UNmXLwC++MUvptddd51Dwb5OBPB/PnYBUOazgTkDAAAAKiMAykqBbHNB2+HR4m+//fZzHeUlAOwEAUkA/YyCfzWH0s +Es3OctN7ZL7lArEK6b5EAsODf+jIcPn4vhwTA6tWr04lnXuEkgMZLfSGE7qvZm35XKd+hC4C80xnyx8obT8oAOi4P yD4miaTgUanku+22Wy0n9NAEgJULaS7JZgBobjckivW5oPlfIsBOD9iwYUOAY91pBkDS5jODHiMAAABQUQFgiz+h+k 0t5IQd9aSGT7ajp10fEwBZCWBZAGLOnDmNVOAgJMC7d1of81SmU/TA3b/hkAC+AMgG/8/efkX6i0dvcwLgqKOOSp95 5hmXBZAN4LJd3EPuA1B0NGOrwCzE49yqhhqLSgDMnj3bpZOPGjWq1sF/1QWAHSVrAkDziN/gVZlfNvefdNJJ7rPg8c cfbwT+y5YtS5944ol0l112SceMGROVACjbU2Q4j4EFAAAABEBHu3daoOtWEkCdne2oJ91Xsyd9zwSAFn+2AFRQqR0g vxTATwMORQI0d3LOlwDlFohpmx3m4RMA/zb/bCcAdLvsylNd/b8kgNAYKYVbO3c6CcLOd7cGbnEIgLSlAGik+abhn+ 1elawAySUJgLPOOisdMWIEGQAV/m/VHGESIE8ASPgKEwAK+mfMmJEuWbKkcYJM2H0eepcAvO8BAAAgOAHgSwAd8yRM AGjBp7RPBf6672cD+BLARECIAiAv0E+6WiAOvwDwg381+Lv1nCNd8C+eX3xNunrRhU4EzD70g+mh+41ON2/e7MbKBI Cd8W4iIEQB0Ek6ri96kAD9QdfStdde63aF6zqhh3L9tBMA6vmibC9JACsDOPzww9N77rknkgaPvQgAAAAAgIAEgEmA xYsXN0kAEwF2tJPVeSrtUzs/Wvz5NaE+t99+e1hlADkSYGAjuKT0IjEZplRyXwD4qf8K8IVEgLIAxJJLTkxPmrSne1 z1vkr9lQTwMwCsKaQ6vYchAbrdmWv+nVZHu0FnAmD33Xev9YQe0nVjEiBPAEjwWsmXfk7iV3N9PAKgOwmAAAAAAIDg BUA2G8A/51mLQEkApX1q4Wdcf/31De66667G74cpAJIcETAwuGx9esDwCgB/99//vokAQ6nZwgTACy+84MbrkksuSa +55hqHRIBqudXpvfpj2enuf7G4QQBA3WglAJTZZRJAtwgABAAAAAAELADysgDWrFkz4JxnywKwes9WWP14SIvDpOB+ u3r/quz+mQDIC/7zxls/a0d4SQA89dRT7vHzzjuvgY5yE3bMWwgCoHzqfwcCgAkKaiIBJBB1coMF/5KANq+bCBASAJ K+SVT17wMlQPM8jgAAAACACAWA3T7yyCMDznlWt2cJgFbPo8BfQePUqVODFADtmwImlaz91eLdT/9vN94K+iUBDBMA Gr+LLroovfTSS924h3Ss42AIACYnqFsWwFVXXeWCf73v582b5ySAjnr1JUA9BEDefI4AAAAAgIgEgAX/9pjKAOyoJ6 Gjntot+NQA0AhqAAbs/KctmgJWUwCUCf6LJMCDDz7YCPZt519HhIWTydHNOdz5Y4sEgLqXAdg8ove+gn+dDONnAtRF AORndCEAAAAAIKIMAP8xsXbtWseGDRui7uidtBEDnQeXaaUFQFYC+ALASjiE0v/DkDlJl2PURgAMQz8HgCrNI5oTFP DPmTOnSQD4PV/ilABFZV0IAAAAAIhAABQt4ux7Oid+zJgxNR6kpPICoJPg3xcAwk5v8MfcjnS0+6NHj67wYr/b8Wm9 mPeDf0QA1FEAZOcEYfOFCcPQMr56FYlJoRwAAAAACEAAQI0vvL+uZG+88cYB2R9WxmE9HXQagLj55ptdH4hWvSBiyP 5ISvzj+oFYJUCeALBA35eCNj/EIwDSQiGY995nPgAAAAAEAAQpAbICwEoAtLg/5ZRT0vPPPz+dPXu249prr43+jHcE AECaKwGyqOFrXAKgu3mBawQAAAAQABC0ELDFvQSAjgY744wz0rPOOivqXhAs9gHazw1ZeG0AAAAAEAAQyWJ/5MiRrg fEqFGj0hEjRtTyzUnwDwAAAAAACAAAAAAAAAAAQAAAAAAAAAAAAAIAAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAEAA AAAAAAAAAAACAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAAAEAAA3XHYBV/jdQAAAA AAAEAAQOzB/52b/ogEAAAAAAAAQAAAGQAAAAAAAACAAAAAAAAAAAAABADEly3gw2sCAAAAAACAAIDIAn59fdDUs9PZ S7ekO95K3a2+FrxWAAAAAAAACAAIOPhXkK8mgbr1JYDQ4/Y9JAAAAAAAAAACACLKAPCxbICsIAAAAAAAAAAEAEQoCP xMACQAAAAAAAAAAgAiLhOwngAIAAAAAAAAAAQARNwjQALAMgGQAAAAAAAAAAgAiFwAkAUAAAAAAACAAIDIsCaAJgEQ AAAAAAAAAAgAiHT33z8JgPR/AAAAAAAABAAExuHj9yolAGzH388EQAIAAAAAAAAgACBwCZAkicOv/zc4CQAAAAAAAG AYBQDBGPQiAAwL/i+9Y3n6s9/8YUADQGsCyPUGAAAAAAAwDALAgrTBCsoI9uLn10/e55AE8AXAXv9wROP64gQAAAAA AACACgiAwQrMBlsuQDW44uhx6ZlnnpmuXr3aSYA8AWCoIWCsb7LknTvQz9c14TUFAAAAAOh7CYAfpNvXvQbuCID6YA Jg4YonnAQYf9Y8JwJMAvTjekIA1IvZh37QYT0leE0AAAAAAPogAPKCdqvd1m0vwT813/Vg3Lh3sgCElQOYBKjDtZB4 /7geemPZlac2uOfCqS7DxEQArw8AAAAAQB8FgF8W4NdtdysB/K7viIB6SAAFbHkSIHYZhADoT/C/9tbLHP9xx5XpxI kT06OOOspRRwGAWAIAAACAQRcA2d4AJgM6+V0L9PznoRwgfuxEAEkAYY0BKQeBVvOFH/y/surr7ro5+uijXeD/zDPP pDfffHPtBECS+ce1AgAAAACDJgDyygHKSgC/qaDfBZ4AsD4SwIJ+Nf2zxn+MPRTNMbo1eaRrR7cPPfRQo7fExDOvcP 0lTAKotwS7/wAAAAAAfRQA2Vr+TrIA8rIJsinglAXEybHHHjvgupEEqM9YJ7UK4Lv93dNOO62pNOTAAw9soEBfu/4S ALpV8L/jf//oHlfwbw0m47pOEg8EAAAAAAAMswAwei0psMCfc+HjlwCWAVC/EpCkFsF/t2OqQH7Tpk1Nz/Hwww+nF1 xwQZMEMBTsW1mJPRa6BEhyr5lmCRCC/GH+BgAAAIhQAPilAN0u+PySANsZRgDEy/nnn5/u2LHD3ZcEyMsCiV0CJAiA 3DlgwoQJLojX9aGvda0ICYCzzz67IQAU5BsK9l9eeUv64rKF6X/9+70NMRCyIEoKg/+k0uOeHXvmcAAAAIBIBEB2oW 879/14To4IjBcFcArulOadLQmox7hb8B/Gbm4vmUGdSADLBslKAF0n3/jGNxoC4KyzznLf+9lv/tBAJ0rosde+c2v6 +E2zAhcAWQkQhgDI6wtDKRcAAABApAKglxIAqGcZgFBwZ/Xe9ToNIKyU7rI7v/7XlsVTdkwlAPzMH18CCEkA+zuGgn yr+zcJ8KM7vxzJqQDvSYAkkNIRf2x8CcScBwAAABCZAODFhG4kgFK7JQCee+65Gh4J+F50l0QgAPxMoOyOcKvxtN+x DADLApkxY0a6ffv2AUGljy8CfAlAmUh1rglJHeQwAAAAQCQCAKBbLLVbEkACwC8jQQCEF+xZFlD2mM9WpQC+OPAFQP Y5/IDfzzjyH/clAO+v6pUEIAEAAAAAEABQ8wwA2/33U8YVCNbjNYgj+M9L/84TA1kB4GcK2Pd9CWABfl6wbzXmfslA DN3/Y5QA9SvvAQAAAEAAALQMEuy2PsF/vcY3u6tvwsduTQAoiPclgAX59jO+FLDHfAFg8LpX671NuRgAAAAAAgCgaW fQAkJel3h3grM7+nlZA34vCP/n/d/LBv+8xtXLAMmW8/TrlBgAAAAAQABA4EGDBXdkANRnvFsF7iYB/OwBP/0/23AQ qiHysuOaDf4lbni9AAAAAAIWAKTbQr8CCIL/eqaGt5pbfBHgB5ME/tUUAO2aPZKxAQAAABCBAFDTLUQAAEA9MzrKiB nEDQAAAEAkJQAmAUwEzD70gw5eYACAeIP/+hzZCQAAAIAAyE3X9Vl25akNJATIEgAAiCvtHwEAAAAAUEMBYBJg/LFn N3aGskKAFxwAIC4BMFhZAOPHj6/5a8xnJgAAAAQgAPyGXXY2Ny80AECcJQB2JGO/JcCx+4/kdQYAAACosgDIKwXgRQ YAiDsDwO/wX9Tsz/+e+sW0e/6FM44kC4DPUAAAAKi6AAAAgPpKgDwZYFimwIEHHthWEMctABIEAAAAACAAAAAgPAFg ZQBGVgaYEPB7w6y/ex4ZAAgAAAAAQAAAAEBIAsAkgIkAP+C3XX/7WQv+75p3fnrCCScUBv/qARC7AEjSBAEAAAAACA AAAAhHAvgiwA/6rUmgsO/7AmDcuHG1Df7bCwCCfwAAAEAAAABAxUWAH/xb0z97TPcV4BcJAAX+dUn9zxcACcE/AAAA IAAAACAsCeCfBqDAX0gCSAAY2TIAkwS1+hDm2gEAAAAEAAAAhCoCir5nIkDBv8oBRoxIcr/P6wgAAACAAAAAAAAAAA AABAAAAAAAAAAAIAAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAAAABAAAAAAAAAAAI AAAAAAAAAABAAAAAAAAAAAAAAgAAAAAAAAAAAcCLAAAAAAAAAIAAAAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAAAQ AAAAAAAAAACAAAqOOklCQOXgsAAAAAAAQAAEQuAHbs2FFrCZCkCBAAAAAAQAAAQA0EwNatWxEAXAsAAAAAgAAAgDpI gI0bNyIBuBYAAAAAAAEAADHX/CMAEAAAAAAAgAAAgIoH7/2o+c8KgNgbA+YF+wgAAAAAAEAAwLAxfvx4R127tCfv/u NaeIdRo0alL7/8cl8EQLbmX/f13AcffHDT1/qbMV4PRQLAf7wu15/NM0Zd5xnmGwAAAEAAwLAuynfu3NlgzZo1tRIB Sc6/ugog3R83bmy6aNGidObMmel+++3b95p/3W7fvr3xtf6G/tbmzZvd32713zYUAX/yZ+9K+MvgSICm4P8v3t/7cz KoMmK4ry9/nhF1kQBJi398BgEAAAACAIZ1V05IAlx99dXpgQceWOvFeV12Zf1gTIH566+/nrtrPxgCwB579dVXc6VT 9r9vMMd/sNL2WwmAds8f+rWoOcQP+OuWBVD3+QUAAAAQABBIUKiFuyRAXd88dRUAkydPzg3Qn3766b4JgBdffHHA86 tUQH87779P3xsqAVA07kMhAFo9Huq1qGtLc0kdU/7rNpcAAAAAAgACQGnXCsAUfFnqf536AFjadV0X6BrrbAZAtv5f 93/xi190dV3Y840bN66lANi2bVs6YcKEXAGwfv36QQ0ghyIDoMzzxygAAAAAAAABABVBjddU762Ub+36KlBbt26du9 17773rnZ77dlIbAaCSD18A6BrIBug///nPuxYAL730UpMA2LBhw4Dn37RpUzpp0qRcAbB8+XIEAAIAAAAAABAA0Evg p0BfDdj8nX9D3zv986emEydOdMQsAIq+97vf/a4WwZcvAfwMAD9t/5VXXukpA2DMmDGNr59//vkBxwDqZw455JABwf /KlSuHJH08WwZQBQEQU/CvsZXgUZaHZRuNHTu2lqUAra4zAAAAAAQADFrQJ/I6vetxLdiffPJJ1wdgypQpjWPbonsd /pKUzg6I+Vrwmz4q+8MPyHsVAMou8TMAVq1a1biedPvUU0+ln/n01AG/q+8tWLBg6AXA2+UaA/YiALI9BySbYt39nz ZtWlN2ka4HZR0p+6hKxz8OV7YRn0cAAACAAIBKoIDwe9/7ngsO69gQsE4L9WzTR2V/SADp8d13393dP+CAA3oWAHoO XwBIMqxYsWLYBVN2jP3sD/v39ttv9/zceo48ARDj9aXA34L/vCwjZR9l+01E+2HcYQYSAAAAAAIABj0bIIsCP6Oub6 K6LtJV9iEhIAHUiwAQW7ZsKRQAutXfqVqGSd5OLQKgPDfccIML7i2TJC/I33fffaNtOlpGHhL8AwAAAAIAhgUt0nXM mzq9q9mb0r2Fgj4rAzARUIfFOum67wgAlX7Y2OtW10K315cJAAX6eQKgatdVP8e/VcAf63WlMVf2iJWVIA8BAAAAEA BQ8UwA7dYKBX4mBPxa8djRbq2/Y/vegr4ei3oLznVfEkDXgO7vtddeHT3Ps88+2/gdP/i3v1FVqVQUqHca1LUK+GMN EGfNmtXAxjiP7PfqVAJAFgAAAAAgAACgklgZgO7vscce6cUXX9yRANDv6P6SJUuCbCjZy659HXb8s4G/MgAsk8i499 57XcNHZRtZM0Ddbty4sUEsIiDp8h9zDQAAACAAoBJoB1dB3IhPjnB88pOfrGVKr58dULfsEMsG0Ph3IgB0lJ8F/VWs 9+9mJxcBUIyCfUkAyyAq2v3PY+vWremOHTuClgD9PDECAAAAAAEAw4aCPqGdYAV1qhOva11vHRfqvgDQNVBWAjzwwA NNAiDU4K7oKL9OBQBzSbkyJF4PAAAAAAQAVEQEzJ07Nx1x0Ij0oIMOquWbq84BnbI/JIB0DbT7WV0j999/f7C7/mlB b4huBUCdUONHY8yYMY37dQnySfMHAAAABAAARIGyPxTclxEAS5cujS7Y67QEoM7XiiRh7DX/3fYDYC4BAAAABAAABB PYtfuZKnf5HwoJQJA3MLU/tpr/fmUTAQAAACAAAACAmn8AAAAAQAAAAAAAAAAAIAB4EQAAAAAAAAAQAN2gs515cQEA AAAAAABqIABeeeWVrn9fv6vGYULPFeIRcr00bMp2f6b5EwAAAAAAAFRGANxwww3u6CYF7HbbiwB43/ve5wL/e++9Nw gB0M+AvSrHQNF4CwAAAAAAAAHQxLRp01zQf+CBBzZ2/w844AD3vXHjxnX0XAr29fv2eyYB/L8VkgDoNHjP2/0fTgGg o7d0BFfR8VztBIHOdxc65i3UN0g/Xn+yOAAAAAAAICgBoAB/586dgy4AFPDb7+l59PX06dPd18ccc4z7W1ULBgdLAO Q931AGkxbgb9y4sYFe/5deesndbt++3bFlyxb39bPPPutYuXJl+sADD6T3339/unTp0uCzCJIe/zHZAAAAAABAMAJg /PjxLvhXkJ8X/B9yyCHua+30SgBYwKdAvpMUfv3eU089NUAAWEnBjBkz3N+bOHFi0+/p8aEKANsF/70G7N0IgMEOMv 3dfo2NGDNmTOO+sddee6V77LGHuw6M2EoICP4BKEcCAAAAqIUA0K09pqBfwbi/MNOtLwAUJNrPlF3oPf300w0BYM9n KeT2N/NKAbL/fYMtAMoE4/0SAGVKAnoNOFlkA8BQYw1fW5UYqQxJ5Ugxzk1l5m1kIgAAAAypAMgL/sWkSZPSdevWNS 3KdF879n4GgFLEOxEACvAlDvKEgi0I/ayDdv+dg7X7P5QCoMyCsNdd505q/n2UpSEkaVatWpUuWbIkvfrqqx11qPl/ ++23Hez+A5RH87qhzwxlfkn+am4XftlRjGKSLCIAAAAITgBMmDBhwO6+pfD7AqDTDAD9vJ8B4AsFe0ziQQKi7H9rHQ RAvyRAXs2/1fq/+OKLjg0bNqTPP/+8C/h9Ykn9T/rwjwkGoPXOv057yZYRWWlR7BlJzB8AAAAQnACYPHnygN19S+H3 d+xtB6dsAOr/fPb5fEkgAVF1AdBNfX6Z3x8sAZBXDmDBfB5+wB9qp/9Ox6PVIp5JBaCz1P+6lisxZwAAAEBwAkCLr9 dffz03OO+nAMjLMsj+3eEQAK2C86EQAJ3+twIAVAU1dlV2lySAlRGVLTuKpSdAt3M1czwAAAAMqgCwwDobVI8dOzZd tGhROnPmzHTfffdtBOd+VkA/BID/fPo7+nv6u/r7Zf47B2uhVrT7O5gCoN2Oc78Xhrbg3m+/fXO/p11/9WKIPgvgL+ 2FC4tygM4zACQBDL8ngPUD0PwfY08AyosAAACg0gKgiFGjRjXt0CsAzNuxt8Zy7YLN7M9ZBoAFlva1/m4Vd3B6Paav TFA/lItAe70lXfJ24tTvYcWKFY2mf3Xr0s3CHKB3pk+f7jICisqNso9H/YHcYRkSAAAAwJAKAH+XuGjH37rLlxEA2Z /Lywio+gJwMATAcP7/kWzZvHlz+uqrrzpBs23btnTTpk1ODHzm01OjaPrX7U7d7373O4J/AAAAAACojwBolcKfJwnK iIR2zxfiLk5Vnq8bxo0b68ZAjR/VfFEnMGSPYYz6jfLnhB1/gEFg2rRp6THHHJPOmDHDzSnZuV5lX3XY+e81ewwAAA CgUgKgKs+HAAAAqBbKJjKy6f8qP+rkKNkYBQCfAQAAAFBZAdBJzf9QPU/IEoCFHwDUgYkTJ7psAAX769atc7c67UUN X6vS82U4S464RgAAAKDSAqAfRzT163kQAAAAYaAyAJUYqdRIc3/eaS91EQB8BgAAAEAQAqBszf9QPAcMHjpuMdZj/z pZqHMtAAAAAABArQUAxBfsZ1m5cmW6YMGCWqflIgAAAAAAAAABANEJgJ07d7qeDOvXr0+XL1/eEAEIAK4PgF7RKQC1 /zDmOgAAAAAEAFQ1C6CuKf8E/gCDgyRjHecWyooAAAAAAQAAALXMNKqrbCTLCAAAABAAAABQOwlg1C0jAAEAAAAACA AAAKhluVGdSwEI/gEAAAABAAAAAAAAAAAIAAAAAAAAAABAAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAAAACAAAAAAA AAAAQAAAAAAAAAAAAAIAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAAAAAEAAAAAAAAAAACgBcBAAAAAAAAAAEAAAAAAA AAAAgAAAAAAAAAAEAAAAAAAAAAAAACAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAAA EAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAAAABAAAAAAAAAAAIAAAAAAAAAABAAABA5dh7770dtX 0N3ptxAQAAAAAQAAAQtwBYv359fSVA86wLbfjwhz/sqO9rkLwL1wIAAAAgAAAgQAHw5ptvpt/97nfrKQEGzrxQwIEH Hpju3LmzxgIgcbE/AgAAAAAQABD1ol+w44cAQACEzejRox21FQA9jzECAAAAAAISALb462UBSKpvfXf96isB4l/0mw S49957kQARzw+a+1955ZWuPwdsLpg7d26YEqDncfbnAj5HAAAAIAABoMWfLQBZ5HORlV30r1ixosYSIIleApgA0DjX UgLkz8DRCoDrrrsuve+++zr6HLDgX9dINAKgo3HOBv98hgAAAEAAJQBa8Gnx5+8C1UoGFL/agACovQBQGUAtJUCN5g WTAAsXLuxIApgAuOGGG9Lp06enp5xySs0kQJ4A4LMDAAAAAhAAWvRp8WfZALXKCGj9ikMLAbB9+3YEQE16ASABbE5A AuQJgKlTp4YrALqWAAgAAAAACFAAZCXAD37wA0cvdaFRSQBEQO7CX4v++mYBJLXNAqjVWNdQAGjuv+WWW9LHHnus5d zvp/9rLjjnnHPS4447Lv3Sl74UTxZAy7m/KPhHAgAAAEAAAsCXAFr86VYLwG3btqU//elP03322QcJwAXYWPiffPLJ NRYASa0EgLI8aisBCueCJGoBoPn/q1/9arphw4ZCCewLgGuvvTa94IIL4hQAhfM/AgAAAAACFwC2CFTgr8WfMBFgEi D6bIByoxB8UOfTiwAIUgL0PJ5JbSRAVgDUTgK0nAfilQD2GWAyePHixU1zvx/8f+Mb30ivueYaJwBUAhCsAOhIArQL /hEAAAAAEIgAsEWgdn60+Lv++uvdAnDp0qXusXXr1iEBApcACurWr1/vgjrRqQzQ4v+ss85yu35RCICOx7U+AqAoC0 Ao4EMCxCkBlPmleV/z/xVXXJHOnz8/vfXWW933JIKjFQCl538EAAAAAEQkAPxyAC3+fAnw/e9/P/3JT36CBIhAAtiO romArAwoEgImALTo1+I/OgnQdowTsgDqJAFKBIOxCQBlfCkLwJcA4s4770y/+c1vup+xayArAC688EInAPbff/945/ 4UAQAAAAARCgClfWrnx5cAWgDec8896XPPPed2goxaCoB3F4FJ4KUASufWQt6XAQr4RJ4IaCcAklAWv52982orAHwJ 8Ktf/WpAKUA9MgHqJQE0p0sCSPqaBLj88svTiy++OL3yyivd54I+I/T+zwoAPwvghBNOSA877DBHjPN/u7nA/8cCBg AAACotAEwCKO1TAkCLP9WEfutb33ICQOnfs2bNSj/zmc+4sgAkQNjBnS8BWokABXo67ksL+s9+9rPp7NmzW0qAxC2G k/DHOSlH7FkAr732misfsevEBED8EqDsNRKXBFDZl0kAzf9z5sxJL7vsMjf3f/7zn08/8pGPpB/4wAca14AJgIsuus gJAH1uTPnStelL//3/0jH7T6yNBPAFAAsXAAAACEYAmATQrr92fmzxp+DfBAASID4J0EoEKMjzSwT0tRb+eRLg2P1H phMnTnTPU3kR0Mliv+Ti396wMQQBGk+xdevW9I033mgSAFkJUIYgBUDSXTAYanq45n7N6yr70meA5K/mf6HPA839J5 54Ynr00Uc3JIA+C/wygHPPPdcJgA8fNj394D8cEVZZQEefzAgAAAAAiEQAKKhXzafSPm3xZ2gBeOaZZzp8CRBVaUAH P5zk/XyAEiCbDSCU+q3dXwWAWT7xiU+4xX9WAPzlP7c6AbBs2bLGLmAUEqDk4j9UAZAXsCvrQ9eHxlvXgmUB2PVy44 03NkkAu19EtUVBQdDeY1p4dwy/BFDPF2V9WeZXdv4/44wzGhJAnwNi0aJFA0oAlAHw8spbwikR6kECUAIAAAAAQQoA W4RrEaiaTy34tPNjiz9fAJgE0CJRgb+OkhJZIRCWFOh8W98kwHu/Gtbun+3q52UDKOjT7q8CQLF27dr061//evqnP/ 3JYSLAlwASAN/+9rfTLyxYnF5298MukKx2ANDdmGfHOhsANL2BKxzo2xGPQn0eDAVwvgCQDNq0aVNDAMybNy+dOXOm G/8pU6Y0An2Jw06QRNK1MzQNJTsMxodIADRfT9XIBFDPF8v8ys7/KgXQrv9HP/rRhgRQ6ZgEgN7/Ys8990zH77lLet mR+6cb7/s/0UsABAAAAAAEJQAsELCFuAI6LQK10LOFXzb4t6Dh0EMPdWmeagL1la98pSECDFvYVzsNuHkhnnSzO5zz HAMDxWrvAudJABMBCgBvu+02F/h/6EMfcqhUwJcAChD1PHPnzk2/+MUvOiQAwtgF7Cz4LyMBqhYI+Ee5GQrADQV7au 4m1O/BBIDEj8ZemCA477zznADQbvC0adOasgD84L4Ik0ZDOz+U6eSedCWFeg/8q/X+kLj1535//tfngub+4447zn1O SARIAnzta19zEkDvdZUDCZMASWj9EnqQACxcAAAAoJICwN8B9AN//6gnNXxSzacf+GvxZwvAY4891gmACRMmpIcffr hbBEoC+M8zPAv9znYDC3fv+xQAhCICLIjLkwAK7hUA/v73v3fB/3/PH+Fud+zY4SSALwBsF1B87GMfcwHA5geuj0IC NOSQl/kRigDwJYBQj4esCLAu72r2aD0ALOtDY289Io4//niX7i0JICQBDj744Kb+ENUJ/AdKgNYZOwPngAEP9yABQp gPJAA0n2fFrz//FwkA/a7e6wr+jeA+eDvtE+KPK7v/AAAAUBUBkBf0+4G/Lf4NpXeq1lO7fLbws8VfkQDQItF2Au15 ikTAcCz+c3f7hygNOP/vVVMCWKq3j3Z+FfxZBoBQ8P/CCy84UaQxfvnllxunAthOoO0AhrEL2HnfhzwJEErNf3YO8E WArgONr5/14Wd/WAaIxl4/6wuArATw54DhF4El5F9SENhly0C6mANCyAhSEK8eLzanZ3f/JXyyAuCmm25qEgBBf/B2 IgEQAAAAAFBFAaCFWTboL0r/NbSYNwmgmk8L/LX4swVgVgCcc845DQFQxfTf0jt/nUqALlJ/qxoM+Onc7QSASYCNGz c2JIBlAljQH14w0JkACFECtCr/sbnBJIAJAMv68O/7EsAEgP1udXb9y5f/tBZ3qT8zD7weIsgCaiUBbP73BcD73//+ hgDQHKHPGR0j6L/3Q5UBpSVANgOIhQsAAABURQAYqtEW06dPdzXaftCehySAFnla8GXxF4BC2QKiVVMw7SJdddVV1W 4A1okEiKgBWJ4EUMd3NX1T3bdSvxX0+cGgAkCdHKGMkKwA0HniYQYCbSRAzo5w0akAoYoAC+A1vnnix1AZiJoGWiaA LwCqs+vfmwhoFQiWySAIKfAvkgCW9SXy5n+91/X5ouvFJIDksYhaAuSMczLgc4fFDAAAAAxjDwATAdrVF7aYs699LL CXBFC6p6GFn7/40yJPwaGC+8997nNusahbWwD6aDdJf3/4jgDrowTo0/FfSUWDQpMAVuutuu+iLAAFgvpZfV+/a8G/ ro/99tsvPe2006KQAO2yALI7gUmaBBMI+CLAsgGsFMD6PWTHXeMtAdAu+A9DBOUF7a0lQCsBkEQQBEoC6LQXZXv5ZO d/XwBIEpgE0Pc/9alPhZsR0OI9XzzWSAAAAACokADIigB18Pe58MILcyWAFntZbPFXhF8/arjjos68ogILwmQYCeMC 9CWAMjskAfwdYd0X999/f/rWW281mgiaBNB9ja8EgLI/TAKE3hOgsCa8MB04nLHXuGSzAUwCqN+Djblf/qGAz28AaL 9rz/WXXz6f/scdV6ZXHD0uvfnmm4NoCFl40kMJAdDsDJOBk3pgAkDotBeVexnZ+d+aAH784x93gsCXALpO9LP2mRLF sYBJawFQ/P5HBgAAAMAwCYC88gBfClx00UVOBixatMid82wiwMcP9hcsWJCef/75TeQ9937Hnp7u+N8/ukXgpn+eX4 HFYOs6/bJ9A8r/ThqUABA66111vxIASvW2HWEF+hYAWgq4AsZf/vKX7vdOP/30hgSQAPjxj3+cLlmyxD2u6yeIkwEK MkBajXPrdODqXwsWuGezATTGGm+VfJj4seDfSgZs198kz7IrT3XBv06FOOqooxzByJ+Cnd3E3xkuHPuBk3mIZ8Qr+N eRrvpMUK8XIzv/33333W5+twyBI444oiEAJACtd4wwCRDEdZAmpef/8gIACQAAAADDKACyaKcnL3DXDo9Qt2c1fFLK p9BjtvjLYgs8W+wpCNjnE9NcBoCQAKiGBOhOCnQa7Ie2+PczAHRfi3fdVyCotG9hAaAFgQoWVApiAuCnP/2pu6Zuv/ 32Rh8I/ayaCqpUpNqBQIsykJIN37KlAaEEAjrB4S//udWNo/o6CJMAGnMJIGV9+LX/OjLSD/7tva+dfwX+zzzzTCAZ AOWyAfLTvpPCyTxkAaAjXrMCWGVfJn+tv8zVV1/trg8JAD8LQBJAWJ8Yo/IZQR30eSi+JtLgs8EAAAAgYgEgVOt9+e WXp+eee667r8A9L8DPNhfUIu6YY45xaLGXXdzZ/VXXznCYAND9Ki0AkzTvPPf23cJDS/fuRADYUW+GBX7+7q8FgGLk yJFOAAgFEBrfX//61w0BoGtLAYACCcmBagYA3fRyKL422l871ckA0HvesDHVMY9+bwB//G3stbv7sY99rKkB5EMPPe TKf1avXu3E38IVT1ReAmTf+60lTk6mgBfohxr850kAjaMax9rxsBIAlu3lj7dQ8P/000+7x774xS+m8+fPd58LKiGw n128eLGj6r0hyo19vhtMc0Vx9nEAAACAYRQA2tmd8qVrHbqvIEALNKsH1cLOaoGt5lM7P/oZ3UoA6P6YMWMaQqCVCK jaDlDe4t2vBy2X7hm+DDABYEF7Fr/pW3b3d9WqVa6DuAKH//mf/2k8/tvf/tb1ApAA0K2aReo0isceeyyITJBegoBQ JIDGQeO5bNmy9Nvf/raTeyYCLBtA5R8mAzTGNvYSAH/zN3+TvvHGG40x166/AkfdKvi3EqBQBECeBCw++jFeAeCLHw kAa/RqAkDzvH0O+FjQLySGNmzYkK5Zs6YR+IfSE6K8+CueR7o5ZRYAAAAQAEMiAF767/+Xfviw6e7+nnvu6VKC/UWd JIBSPK3mU/e16+Mv+o488sh0/PjxDQlgdd9ZEVDJFz5PALQJ5JJSwWOYAkAo2PfPePebvtnur1DAkA0CbNdP3cMVPF ogqcDfgv9QBUB+cJD3XGmLfhHVywKQAPzCgsVu99YkoH9yh8ZR/R6s5MMk4fr1613mh80DfgmQmsepJECEUgrQPAfk B3NN4zvg51vPJSEKAKESnqwAMNn76U9/upH2/3d/93fppEmTHCYCfvjDH7qf+8d//McoBUC5soE0WCkEAAAAkQkAMW b/iekH/+EIdzt+z12cANCtH7ibBFC9pzABYIs/PaYjBiUB9JhJgDAawJUJktKOUr1DEwFZAWBBvy8C/KZvSv3W7q8f AFp6v99BPCsHqrzw72znPxkQAIZaGqJxkQS87O6HmwSAoZ1cXwao5ENZH/qeH/wrOLQMEj127af/Pt2y9KvpyytvSV 9ctjCIeSAvcG8lAPNkQehHAZoAsPe9xjObAWCyxwJ/XTd6v48bN66RMSb0mMoBTABU//Og0+Mey5aMhCuFAAAAIEIB INS8TQv1y47c3wX/vgDQws8kgIkAv+GTFn+6Va24SQAtGNVTIC8bIDySAbWdSckFY0jnwpsAsF1/Hzvr3Q8KlfrtB4 BK89dOv0mArVu3utsZM2akt912W1NQOXr06IpdD2UFQFGqd9LyukhaZJ5URQKoPENI7lgWkNX3a/ytz4NQyYefAaTA UOUDfvNHfU+nAmxdflP62nduTR+/aVal54C89P1muRNvBpAvAOw0CBMAGk876tWv/1fZlzK/JH/tc+C6665z7/msBH jkkUfc78yZMydoAdA8rknarlkkWQAAAABQWQFgQcDG+/5PQwL4AsAP4v2GT1bz6UsAIQmgtFERfjZAkhY3c0o6kABJ kAIgG/z7mSF+ACgkAdQ1Pk8C6Gx5Pa4GY4bKBETVBUDSwe+2kwD5NefVeP+bBBQ2vva+1XWgkx78Zo/K+tCYmwDQ8Y ++ANDzmEz40Z1fdveDnJwLBGASmQCwucAkQJ4AsGtF87rmeUlfzfmWDZCVALpvwjiMUoCk5LiWLxNKKiz/AAAAoMYC oKhWX19/6lOfcos5v87Xaj6V9qlFny8A8iRA2NkArReA5QVAEpQAsODf0r911nte8K/gz8hKABMA27dvd4/p52fPnu 3QEYG77757pQVAXkfvckFA2jIVuIoN4zQ+mx+4vkn0WGCn+8oUyjZ7VNaHxtzG/+GHH3bX0tlnn934Gb+vSNgCMCnd 7DHkhqCtBICNo83pvgQwEaDMEb8USE0mTSadeuqp7jOjykeC9iIAck+KaJFlAgAAAAiAytYJa/Gm8+H9mk81e7JdHp MAJ510kkP3tZi0haEvAcLMBiizy5MEKwI0Vr4AyAb/f/nl8y6lW03d1APCznm3tG/t/ioAzGYCqHGcdvv9LAB1Flfw v8suu1S6DKAo+C9qFteNBKjie90XABpLG2Pr8+DLHd3XWFsmgDABoDEW+p7mgLAFQFHqfxp8BlCRBCgSAH4WgHq+SA LYPG9z/7/8y7+479vnw9q1a93vWPCv8gHdD08CpD1LAHoCAAAAQBACQF3fTQCosZMvAGyRp50fKwvQsYG2e5hHdc+E 704AdCoBkoAEgNVzq0HcUUcd5YIBocf95oHa/c0KAF0zkgASAOK5555zj48YMaLCWR7Z8czfve9UAIRYD2wSwNL7f/ 3rX7eUACJPAKgviEmA8OVf3BKglQDwm0RK5CrI19iaBJAA0DXx+OOPN2UB+AJAwb9KSUIUAM3v296yABAAAAAACIAg BIB2b/00z2zDJ+38aPF3zz33NHH99dc3uOuuuwIMBJLSEqAMVc4A8IN/G3/t/Cv4f+aZZ9LVq1e7DAALBvwjwwwFfX bsn64bIQHw6KOPVnTcWwf/rdP3O88CCGqC+ut/9JIlSxqi57e//a3r3eD3eTAJ4IsABf+SP0r7VlNQI6YMIP86SSIS AXrvax7Q+Fnwv9+xp6f7fGJaUxaAxlJjqlIvSQB9Nkj+as7XNaP0/yeeeCLdsGFDuttuu7ngX6jhZHUFQJEEKF8+lD /nJwgAAAAACEMA+BJAAkALfi3obHfHFwDaEdKtFn8KErJHwYV/IkC53f68ALLqC34TAH7qv429An4JABf4n3lFunDF E+6sdx33ZmOqXV9DAeDmzZvd4//6r//qegBs2bKlKQsgjLEtTtsfuIAv2O3PBgEBCgDt2Ppy58033xzQ7NGuA4kfjb 12hBUY6tZOGTBuvPHGCARgmp8pUkIEJAHMB5oHrrrqqnd2/v/6nt/xv390t6uunTEgC8D6vej3JAEkAKzJp35O5T46 OSCcz4B2/T/K9AFp7h+RJgT8AAAAEJAAsEBAAkC3a9asSX/4wx82ygF8GWCNn7T4026POj/bEVAKJPRYLMcCtisHyA aOVd35MQGQ3f3P1oYLBf8KBpQVoLPeVR5gneMt7Vso8FMg6AcCTz75pGscV43mf+0EQL8zRbLXTDjvewV6GtNzzz3X YUc+SujYe1+7xcr0sOtEY6++D0899ZTjwQcfdPi9BGIQAEW7+yFlALUqA7AyIOELAP/aMAlgjQAlAKzW3z4Dwsr8KC sA0rTd0X/s+AMAAEAUAmDx4sWNRaHOedZRTwr6LRhQ2qctAE0AWOBvdaDhNgVLB3QCz8qAVgvAKi4GTQDkBf9514GV BejoOJ31bp3eLfhXMKiAwBr/5YmEKgZ4vQfnYe30dvLe13jq/a8MABMAt912W6O/g5o9mgRQ1kerDKBYGgK27wcS7p ibBDABsOmf5zcokgBZAaC53+Z/k8AhjXf5cUQAAAAAQIQCwBZ7Fvzb4s5f1KvZk1CJgNI+/d3/OARAOmBxl7aQAdnA v8oCwE//L3stvLhsYfrad25tHPdm9d+q+1YwoJ3fMMYZAVA2E0BN36y/g5DkUYmHiQAJAH0tAeD/rjV/UwlA6GVAeQ Kwkx4SIQoAXwIUCQAhAaBeL3rcD/ztMyPMLIDeBEBx2RAAAAAgAAISALbwswWepXgKNXxSzWfe92MRANkFXl6H6JAE QCfBv389PH7TrPRHd37Z3VfQrwBRjcEU6JkA8Bk9enQlMwD6s2vbXgCEGgRozJS+r3GVAMhmdEgEmARQv4ds5oeCf/ URESNHjgz4vV8wrgWCIA14N9jvBWLj6Af/WTmUFQB+GYC+LzFoRwGGJQG6yxDJG3ckAAAAAAQnAPJSurWzY4s7P8Bv 9/2YBrHVIq/qi8BuBYBdA1YCYBLABIBqvv3dX6WJG9YbIC4BkJZKBQ41GLAmf/7ur8ZSxz/qvho86qQHSQD1e8j7OZ UJSBCGmwmR/97PZgMkEQiAMp8BWQngCwC95/3PAQv+NR9U+xSA/mSI5H0OVLkXDAAAACAAOloU+ou7bIDf7vvRDGSL xV3VMwC6Cf6LroWsALDdXwWAs2fPdqhXQHWaASZ9rtmOUwBkA0Blcyiw13hafxATAdYnIO/nRo0aFaX4G1gWUJ9dYF 8A2FGvFuj7mAysiwCI6b0PAAAACIABC8BWdb7x1AGXCwi6+X5MgYDG2Dq+674EgHZ/FQAq+FePiHjf2OUCgRjG2gJ7 jemIESMaj0vuZDMAsj8XswRo1QMg1ve/lYn4427C10fzQZwCIG2b+YEAAAAAgCSm/zP+Tk8330cAxBMI2Fnvhuq+lf qt3d+YAsBuA4FY/n+qjKOM0Cn7c7G95+v43i86+SPsUyAAAAAAEAAAHdcKQ1wosC9TylH250IVAP36OQAAAABAAAAA AAAAAAAAAgAAAAAAAAAAEAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAAAABAAAAAAAAAAAIAAAAAA AAAAAEAAAAAAAAAAAgAAAAAAAAAAAAAQAAAAAAAAAACAAAAAAAAAAAQAAAAAAAAAAAAAIAAAAAAAAAABAAAAAAAAAA AIAAAAAAAAAAAEAAAAAAAAAAAAACAAAAAAAAAAAQAAAAAH3ksAu+xusAAAAAgAAAAIDYg//ZS7cgAQAAAAAQAAADOW jq2Q5eCwAEAAAAAAAgACDyYOHOTX9EAgBQAgAAAAAACACIPfhHAAAAAAAAACAAoCYCgLRhAAAAAAAABADUQAAIBAAA AAAAAAACACIWADveSskCAAAAAAAAQABAzBLAFwB0EAeI971u8HoAAAAAIACALAAEAEAN3uu8vwEAAAAqJABYnMFQ7w r6u/8IAAAkAAAAAAAMgQDwgzBebBiKay17iwAAQAAAAAAAwCALAD8AQwDAUAUDFvBzHCAAvQAAAAAAYAgEQDb4RwLA oF3ASeLIHgPoNwLkdQKIVwDovY7oAwAAABgmAeCnYPtYcMaLDv0M/i+9Y3n6s9/8Id3rH45oOgUAAQBQDwHgN/3kNQ EAAAAYpgyAIjHAiw6DKQB0jZkAYFcQIM6U/zwJwHsdAAAAYBh7AAAMNgr68wQAzf8A4iTvfU0fAAAAAAAEANREAIjx Z81zIsAkAMEAQLz46f5+w0/e8wAAAAAIAIi8BEDBv92aBLDGgLxGAPGWAtitlfwgAAAAAAAQABBx8G8ZABbwmwQQCA CA+HsBkPEDAAAAgACAmggAHxMBkgB2n9cJAAAAAAAAAQARSQC/HwDBPwAAAAAAAAIAapIRwOsBAAAAAABQQwFgR8PR JRoAoDrzMq8DAAAAAAJgUBaa1imaRScAAR5UQ8pyjQAAAAAgAHoK8sv8DItOgksgwAOuDQAAAAAEwBDWaw/WorKMCG DgCSCAMYLhuS64NgAAAADIAOh5Yakaf39xmZUBZAAQXEK1szR4j9Yj+Of9CwAAAIAAcIw/9uyuMwRMAlizP9X82337 Hn0AKAH4/9m792A7qjrv/x0IAQxSjiAGEjPhZILRMRQoBQUEMDHKTUUgCkEgZCAolyFIHiCUCSlBlJtKAg95JkWiJv 5mkJLLICHITEIwlQgpkgyJBCwDzOMf49RIlfU45T+O5fr5WfLdrN2ne+/el3NOr+53pV517vvA6d691/ezvms1yl8g 9nvDTu4OQQAAAACAkgYAvQzWwxlEDTLDEIAAACgXPUeznr+9PE/t+nHwh07w7H1CgHKEACwDAAAAIADwhX+oHwP1MA ygtRgoVxHY6vnY7fNV140v37OqQYX/xPMXEACUtMuDEAAAAKCGAYAG5Sr6bZa+XwEAgHIWgen9OvKWeHQTAPzbr/+7 QcW/Ff5cU8oXAPR7qQcAAAAiCQDSs4IM1tHpjDJ/izhDgKwunXDvjiKdA+HnrfVf1AVgIUC4JIBjMPIhgAUARe/eAg AAgAotAQhn6Rigo5tikgIi3uOmNf+t9utIbyCXDg7yPp8VAnB9KVcAkA4C2v28jiF/RwAAgMgDAKAfBQUhQJzdG+Hx S28CeNSMCzILxvTscXpW2b4WhgAEAOVaBhAGP3bc+BsBAAAQAACZrMgbqtvHYWSWcaSPYbrwzyocw84Bsc/ZxoAU/+ XdC8ACH/tc0S4AOsYAAAAIAFDjApK1xNWV1QlghWO6+E8HABSK5Q8BsvZ9aMXuGMOeMQAAAAQAqGlBERZ+/E2qvWQg vf6/m/XkKNcSEAtxigYAbBoLAABAAIAaFQ9ZAQDLAOo1e5y3ASB/p/i6d4os47GZf7HvJQAAAAAgAEANCsD0unGK// ou++C4V28viNwXrT8X/CwBAAAAIABAzQMACkGgoi9UqSKfvR0AAAAIAFCjACBrE7j0/eMBAAAAAAQAqFALeLgHAMU/ AAAAABAAoAZrwfmbAAAAAAABAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAAAAAAAAQAAAAAAAAAAIAAAAAA AAAAEAAAAAAAAgAAAAAAAAAAQAAAAAAAAQAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAA AAAABAAAAAAAAIAAAAAAAAAAAgAAAEph4sSJTer4Ih3+45wAAAAEAACAShb+e/fubVKXECBp8Y/zAwAAEAAAACph8u TJTQV/3boAkjb/OEcAAAABAKKa1UuSxKtrOy/nApBPhb9CgDq2/KcDAM4HAABAAIBoi/+wlXf9+vW1CgKYyXv779Dj Ma9reAQAAAAQACC62f+QQoDrr7/ez/bR1luvEKCXn92zZ0+tQwBmhgEAAEAAgChDARX/CgFo9SUAKPqz27dvJwCowf /nMccc46ZMmeImTZrkpk6d6o/5+PHja3l9sGNO+AMAAAgAEIXR40f7AbwN5Ou8DwDnQ+8BwubNmwkBKvz/N3PmTLdr 1y63YcMG/3bnzp3u9ddfd0uXLnVjxoyhY4jrAAAAIABAWWnAroG7BvAayIcD+1GHjKr1YJ7zo3VHQFZQRABQ3QBAhb 8V/2FQaObMmdP4Wh27grhuAAAAAgCUvrjTgF0D96wBvb72/jPf7wYGBrwqD+pbFXJVHNgX7fJoFwCk1/ynA4Cqd5Nk nRdVLAIXLVrkrwei9v+sYzpu3LjKHu8i4SDFPwAAIABAFEXgvuP2zfyaBvpPPvmk3wdg2rRp7uijj67tPgBVCgHU9d GPmdqsNf8WHNm5Yh+XqTW8n8cyLwAIP1+Fc0fHUHuC1GFT0G5m/wEAAAgAUAka8D/yyCM+BKjjhoBVCADszg56X/s9 aMmHuj6ygp9e1/zrrZaS2Mf6HfpdW7du9b+71X/bcBX8/T6W6cfK+jj2tvG5c+c2KNzJ6hiS9Nfqdh0gIAAAAAQAiK obIG3//fdvYOYvzuJ/7969jSJbx1T7PWTN2g9FAGCfe+WVVzILwvR/33Acv3637bcLAFo9ftnPLyv6dX7s3r27yfLl y91TTz3l1q1b19gMUG91PpjYg4Ckx3+8tgAAAAIAlLbFVwP51157zf385z9vDPK1BMCWAVgQUIc1vlUZ1KcLbN3pIa tA17HvVwDw0ksvDXp8LRXQ787679PXhisAyDuGwxEAtPp8mc8rXQcUAhx55JFeXliYRcc2vU9EnbqACAIAAAABAEZs hr+bToB9jtzHUwhggQBLAZKojnu6AyC9/l/vK/jppkizx5swYULLAGDHjh3+nvFZAcDGjRuHdBnAcHQAFHn8WAOAfn UWcR0GAAAgAAADcQzxcV+/fn1TAKDbPKYLdHV9dBsAvPzyy00BwKZNmwY9/pYtW9yUKVMyA4BVq1YRAEQQAOgYm7Fj xzber8u1hTZ/AABAAIBaOfjgg91BBx3kRn1slLfvx0bXsgsg5hAg7AAI2/bV3dFLB4AKQvv4+eefH3QbQLt9XLr4X7 NmzZBvApg+dmUJAGItIo866qjKrvnvdbkQrxMAAIAAAJVy5ZVXeloKoOJtYGCg1ksBYhj0qyDTsg27hduoQ0Y1FeS9 BgAqBMMOgLVr1zZuA6i32iju0FMPHfSz+trixYuHPQAoWrT347GL3AEg1lCpqmv+6xgSAgCAGgYA2uSp9n9wTryOgo D58+e7UUeN8jOCdR7ox3DuqPgP9254/5nv9yGOPq+NHfW+9nroNQDQY4QBgEKG1atXNz4uU2HWryCnSABQl+sLS40A AAAiCgA0C9jtz+tnVQiKHiu2orBfRUAsA34G6fWmzg0FAo888khPAYBs27YtNwDQW/2ekQ4AhvL5SgAAAACAKAKARY sW+VZgu89zL10ACgAOOOAAX/jr/tAxBABDUQQw4EcsAcC0adMat3fUW4UA3TxWeBcAFfpZAUDZwqZ+ruFuVfBzLQAA AEApAoCZM2f6gbtagG32X/d41tdsMF+Uin39vP2chQDh74qh+O+2pbvdoJ8CAGVkxbneVwhgHUDa7LGTx3n22WcbPx MW//Y7ytppkvec7eVe7zz3AQAAMKIBgAp83Qd8qAMAFfz2c3ocfTxr1iz/8fTp0/3vKlNr/3AEAMwCIha2DEDv604P 2uOhkwBAP6P3V6xYUbp2/16L+KH8WQAAAKBvAYB211bxb7t/p4t/2wVcA/ZwF3AV8p208OvntNN3OgCwJQWzZ8/2vy +9Y7w+P1yz/J3O2PdjFrBdUUChgNJccN6+U4De1y0eOwkAdDcIK/rLuN6/o4tuF89NAgAAAACUKgAIb7Olor/dfcB1 T2/7nqLFw7p165puBabHC3cC1+NlLQVI//cNdQBQpBjvNQBoFwgU6VAAhlsYAKgboGgI8OCDDzYFALFuLtntNSC2O0 IAAACgggFAVvEvU6ZMcRs2bGgapOt9zdiHHQC6tVcnAYAKfAUHWYGChQ1h10G7/86hnv0fjgCgSLHPpoEom30/NtrP 6us2j+2+V7eBfOCBB6Kd9e906VCv3wsAAAAMawAwadKkQbP71sIfBgCddgCEO4GnAwX7nIIHBRBF/1vrEACMVAjA/b rRipbrqLgvEgCsXLmycudRp0sAOGe4rgAAAJQyAJg6deqg2X1r4Q9n7Ddv3txRABB+f/rxwpBAAUTZA4BuBvVFfr5s AcCePXvc9u3bmwbtWVoVfxLzmu9+/M2rWgAW2QekzLv8D8dxrVPxr/NBWl0rdD3RdaWK50SR6wXdIAAAoHQBgAZmr7 /+emZx3s8AIKvLIP17RyIAaFWcD0cA0Ol/63DM1unYGR23l19+2b9VUCTbtm3zH2u3d1F7uNZ9q/W7CrO/SY//uGCh yrScy6izS91iCnh1TZDw+lHF2X+uBQAAIIoAwArrdFE9fvx4t3TpUjdnzhw3bty4RiEYdgX0IwAIH0+/R79Pv1e/v8 h/51DN2OQN2IYyAGg3SBzpwWM4g6dlHKL9HOx9o3u963ZvmvU1dR7sM+BHXWb+DzjggEHXA7tGVL3tn2sAAACIJgDI M2bMmKYZehVyWTP21h7ernhMf591AFhruH2s31vGVs5eb9NXpKgvU5HPEwxAp63/db3uUOgDAIDoA4BwYJY3429rxI sEAOnvy+oIKPsAcCgCgFL9/3Ww5j+0z5H7eApz1q5d61asWOFv9Wa3jKvLQJ6ZP9TV3Llzfeu/QoAjjzzSK3r9qMKe AL0897lWAACA0gQArVr4s0KCIkFCu8eLLQAo0+MN5Zp/W+v/0ksveZs2bXLPP/+8L/hDVWn9T/rwj4sU6tYBoBDAhH sC2H4AuoZUcU8ArhMAAKA2AUBZHo8AYOiWA1gxnyUs+Kt2n/cix4nBPNBs1qxZviMg77qR/nyV9wOI7boPAAAIANqu 5R/Jx4k5BGAQCAAAAAAodQDQj7Wa/XocAoDh6wTYd9y+mV/TbN4xxxxT+S4A1v0D7c2cOdNNnz7dzZ49218X0td43e 2lTncDIPgFAABRBwBF1/wPx2Ng+I631uzqFo1Z7by63/fq1asbm/5VuaWXJQBAe7pemPT1QteR9N1k6rQEgOsEAACI LgBA/ejWjFu3bnWvvPKKX7qxY8cOt2XLFj+QP/TUQyux6V+ns/zhQJ5BPdBsYGDAdwPoGrFhwwb/9vXXX3dLly4tza 1eR/q6AQAAQACA0ho9frQv8KdOneomTZrkpkyZ4lt86/ikYyAPFKNrhK4Vumbo+jF+/PjaXi9YAgAAAAgAAAAAAAAA AQAAAAAAACAAAACUkO4CUPsXZ84DAABAAIAqmThxYu1u+5e1vpdzARhs7969/hrB9YFzAQAAEAAgwmI/bc2aNW7x4s W1GsyzozdQ/JphIUCobgEA1wsAAEAAgGgH87oN4MaNG92qVatqNaAnAAC6v26YunUEcL0AAAAEAKhMF0BdW3oZyAPd XTfqvBSAawYAACAAAAAAAAAABAAAAAAAAIAAAEAfHHLIIV5t/wbvXFEBAAAAAgAA1Q4AtLFjbUOA5qsqAAAAQAAAoL oBwJtvvul++MMf1jMEGHxlBQAAAAgAABAAEAAAAAAABAAAIg8Bli9fTghACAAAAAACAABVDwBWr15dzxAg+woLAAAA EAAAqO4ygFqGAPlXWQAAAIAAAAAhQPW7AAgBAAAAQAAAoAYBwOTJkwkAODcAAABAAACgagHAzp076xsC5F5pCQEAAA BAAIAKUHFXq1neQSjw8gKA2oUALa+2nCMAAAAgAEAFAoC9e/fWOARIfG1HgZffBSCXXnopIQDnSKbDDjvMI0TkXAAA AAQAiCAAUIFX3xAgIQQo0AVQmxCg7VWXcyQrQKxvAMC1AwAAEACAAIAAoAIhwC9/+ctBSwHq0QlQnxDgwAMP9GobAL zzakoAAAAACABQnwBABR8BAIP4MAB49dVX3caNGxshgAUA1Q8Bilx9k8oEALt37+46CLAAYP78+XGGAINfVXsIALh+ AAAAAgBEEAAsWrSoxl0ACSFAxjkh27dvd2+88UZTAJAOAYqI9pwoFAIUUf4A4MYbb3T3339/RyGAFf+6dlQmAOgoBE gX/1w7AAAAAQBKXuidddZZNQ4AktoHAFkF+4wZM3wXgAIALQOwLgALAG655ZamEMDez1PuoCCnaC98Fe6nkQ0BlixZ 0lEIYAGArh+zZs1yZ599ds1CgKwAgBAAAACULACwVs9e1n1Grad2z/K1aod6CQCiDAH60L5blxAgr+jW8Zfzzz+/4b jjjmsKALQUYMuWLY0AYMGCBW7OnDm+uJ82bVqj0L/22ms7onNO59vwnHMdFuPDFAC88+tG9pzrJgQIAwCFRtEGAF2H AAQAAAAgkgBAAz1b91nrACDyEEBFmmZntWO7dBoGaACvgm/hwoXVCAC6mMGrUwBg7drGgh/ROXDDDTd4n/rUpxoBwD PPPOPuuusuzwKCiy++2AcA5557rps5c2ZTF0BY3Oex88zOteE53/KKtR4DANePwn/kzzd7Xfjxj3/sbr/9dvfoo4+2 fH0Izycd0wsvvNCdeuqp7otf/GJ1ugBaXkfanU8MUAAAQImWAGhgpzWf4eZPtQoDeioayxcC2BptCwLSYUBeIGABgI q+O+64o3ohQNtjm9QyBBBt8pcOAnQOyLx58xp7AHz96193f/jDH9zvfve7xrl12mmnudNPP92HAKIQ4Oijj/YBgJ1H 5Sn8Bxdtg4vv1iHAoE/3EAKUrfDPCgDUAfDVr37Vbdq0Kfe1IQwAFB7p2FcyAMi9fhAAAACAyAIADfLU7mndALXqCO h55ricSwHUnq0BeRgGqNCTrCCgEgFAJyHAoONbrwAgvRTAivGsIEAF3Uc/+lFf/L/vfe9rYueWvn7GGWf47w0DgHQI YI8/coV/9jEvEgRkFf2ZQUDB4r/MBaKFAJr9VwCgTgC9TixbtqzptSEs/nWsdf3QsdcSgGgDgI5CgCLdJAxQAABAiQ KAdAigWR/p5XZQ1Z/xiSMICEOAVkGAbfam9d5q+dasb1YIcOzhB1YrCEg6Ldaq+xxoFQRYCGABwH/cNKoRANj7YQhg AYD9bHlm/duHAa2CgKZmgPDa8HYQUOS8Kuusf97rwo4dO/xrw8033+yuueYad9NNN7k777zTf+3QQw+tbgDQwTWEAA AAAEQXAIQhgM30aOZHg78XXnjBD/QIAeIOAVoFARrEh0sEbB13XgggZ055d4WWBLQPBupyV4CsIMAKeBX4Om/SXQBm z549PkSyToAwAEjP+l9z8oSSBkqtg4CkxXlVpIMgpqJQrwm6/uu1IAwB5N5773Xf+MY3/PfY9SUdAFx22WXVDwAcAQ AAAIg0ALABn7V8igUBFgJUvhug6/Xj5Q8B0t0AYru6a313moo9K+LC4u2haz/jHl96mX8bRUdA18+oegYAWUGAFXi2 FECFvt6Gxb+FAwoA2hX//3jTBe7OC08s+fmTP7ubFwIkhZaSxHUO6bqv6//KlSsbIcDVV1/trrzySr/BozoC9Lpgyz 3CAKA2XQCu3t1DAAAg4gDAQgBt+KROAA32NOjT4E+f27BhAyFApCGACq+sbgDdOeCNN97wYYBop3fb7E0sCAiLuIGB AXfSSSd5SRSD24xZ/gKzeknGOnH/NvhXhyAg7AawEODFF1/0by0I0NvNmze7U045pal7xH5W54ke69m7r/EUApS3C8 ANWuOdeS4UCACaT704zxeFALr+WwigcPiKK65wV111lZs7d6777Gc/6z7wgQ+497znPY07QFgAcPnll8cdAPQYAhAA AACA0gcA4XIAtXqGIcCPfvQj97Of/YwQINLCLy8EsCBA3QC6xVu42Zut7bYQQPeA1+M8/fTT7rbbboskAAgKsA6K/y IhQOUvLG8X7uluALX5q+BXG7jOjwceeKBR/NuSAQuMEv93S9zxEw92rz18ly/+RUFAHPtKZHcDhBsA5nYKVKD40/Ve 4a+u/2r9/+Y3v+mLf1EngEIAnQ8nn3xyIwT45Cc/WY1lAJ12EREAAACAWAMA7fas9s4wBNDg77777nPPPfecnxUyWY 9xyhGjG5LYBkAdzxLHFQJYMZ8OAVTcKwDQbd7CDd6s5TsMAB5//HE3cN41bsnqJyoXAjRmdzOKuzAAqMOFRQX6vGPf 64t1HXcdf7EQQEW/zo+33nqrae2/zid9/znnnOPPD4VFCgBEy0eeX3ZDRAFA+26AvKCoKsWfXhMU/ur6L7rdn4UACg DOO+88d+655zZCAAUAsnTp0vgDgB5CAAIAAAAQRQBgAz7t9qwAQGs+1fapmR8b/GnQpwGeZobSIYCK/rULZzcQApQz BLC9AUK6FWB6ozdr+VaBp8Jv165d/jFU/O/5r9/Hd2yTggFATnt33Qb1KtKtbd+6AXQOhHsDmLD413mhsEBvVSCKlo 1oCYn2kVjxpTP8Y1uHQDTnTlJ0vf87p1ri4l86otcEhb+6/lsAoNcBCwC0FECz/h/84AcbIYBeQyoRAHQZAhAAAACA aAIAG/Bp1l9tnrbm0wZ/NvBLhwA2mP+//7zct/v+ev3/IQQocQiQDgKyAoBwjbeFANYJoHXcElcR1zoEKLLJW50G9h YAaNZes/c63mE3gM4XCwN0+9Cw7V9U8KsDQF0jWjqiEECPoztJ6HzTZnLaMyC28ydrmUjeeZEfACRRdQroOm/X/rD4 twDgrLPOcqeeeqp/7VAQoNeHr33ta4QAhAAAACCGAECDPa3x1QDd2j3TbZ8ShgChbSu/6l56aIkPAKZOnepOP/30uA rFDr45s2jMKADKGgLccsstbsGCBe7iiy92p512mi/qwvu9KwDQuaCW7zAA0DHeteZ2f5wV+lQqBEgd0zoHAJqt16y9 bQCp5711A4jOl1/84he+CNTHv9/yj+7fn1jmFn7ib9zABz/su0W0ZERBgH5eywr0uAoAdP6FIUCZz6HmIn7wMoB250 XrACCJIgDQ9T68/lvx3y4A0M/GFxQOrum7CQCalhUBAACUMQCwgb0GctoLQAM+dQKk2z7DEEDLAzTI0yygpAMBUQhg QUAMrb7dhAB59xAv4+ZxYQgwZ84cT8cnrwtA6731vfq6fvZf7rnWbV91q3v1n+50j906tzLLAdp1AdRtVk+z9Zq1V/ GuWXzN5quYVyAQbhQoo0ePdledeIQ/NxQQqWNAS0VsvwhR8R8uHVAAYCFAmbsBis3kJ51dYyK6d7yu4Qp7db1PBwAq /mfOnDkoALj11lsbAYD2CZBYg4CkkxAgZ7PIhAELAAAoUwAQ7vhtu35rMKcBXlbbp2jgJ8cee6w74ogj/L2fv/KVrz SCABPeC7y8g7+MGb0uR4lZ4/oyDvDDEECDc4UAdl93K/xtp3dt9mabCFoIoMJfSzz+9d6/j3R2r1gIULTdu6pdAJq1 VwDgC/+3N4DU7L5m+TXbr1l/K+x0PigYUndIuEREHn30Ubd169ZGsS8WAFgIoI6UMp5L/QjwWgWEzedWHCGAXf/DAO Bd73pXIwDQ0iIFALqTjJ0D2mRWwvMillCg8OtCeuPQzHMAAABgBAKAcPYuLPyNBuS6z7PWf+e1fao1XAHApEmT3PHH H+8HfgoBwsexe8mHQUCpZvuTFrP33YwQcwb2ZQsC7FhMmzbND+AVAOhY24y/Cn27x7vt9K5jqZbv9HrvaAOAnOOctC jY6rgZoB1j2wBSxb1m+TXbr1n//3l5nf/6r56833eFaGmIPt65c6ffGE6Ps99++/nPKQTQ5pJPPfWU993vfte7++67 o28Vz2wdb/z/JO0uE1EsBbAQwK7/ouI/HQDoDjIKAHQ9CUOAMAgIA4HKdAJkbBiZtHmpYDADAACGLADIKvrDwj+cnR MN3nWLJ80QW+FvxX9eAKCQwGaW7XHygoDhDwNard/tcVSetJf9+0a+A0DvKwTQ+yr2jzvuOM/u8W47vaujw9Z763MX XXRRo7U36gAgKXYs88+Xmlxw3i7gFABoll+z/bbRp6gbRJ0hti9EGACoODRZM8BJBf+OTXcGcNUIjxQCaNmXrvuhsP jXa0YYAOg6YiFAuBQgpuI/3CMmNwTIvSVkGAIkqfMDAABgiAIADcbSRb+KOqNd/m+44YYmKvIsBNCtnsKWT2v7TAcA F154YVPRmGVkugI6KPq7CQE6eLwyLA8IAwA5+uijG2zGPzyGdps3W+9dqQ6AgsesjkV/XhCgWX7N9mvWP6uYVyfQtm 3b/PsnnniiW7JkScOXvvQlv/GkPl/V4j8s+pIW/2IMAETLvnTdN2HxL7YJ4Ec+8hH/GhGGANEW/61m/9teLwYvB2AQ AwAAhjwAMPPnz/dmzZrlZsyY0VS0Z1EIoAGetXqGwpkfsQ2f0ht9hTSLfN111/nCMgwCylTwdRQC9PC4RXYRH8oAQM cj65jr2Kh7I32Pd635Vtu3Zn5V/EW9B0DHxT8XHQsANMuv2f708df7um/8ww8/7EOAJ5988i/LB/5c+N9zzz3+rcJF BQCXX365+9znPtcUBFQhEAif00VCgJiCANvwVXu+KPQ1YfEv3/72t/1rjXUInHDCCY0AYP369fEeY5cUCpBbBQAU/w AAYNj3ALAgQLP6YsW8fRyywl4hgDYGNNbOG8786FZyKu4//elP+04BvQ0HhUbLBPT7w6UAw7scoI8hQNIfwz0oDAOA cCd2m/G39y2cscJMG79l3QUgyjsBUPz3vBwg67jb5xUEqNsn7AJQa7gFAF/+8pebAoAJEyY03q/KEoBOAoAYwgALAB Tu2GuD0fVf1/fFixc3gubrr7/ez/4rAAi7AH7wgx/Eed0oEAAkqY4zQgAAADDiAUA6CNBsTuiyyy7LDAFU7KelZ36y iv00/c5yDPySETSy/+/pAMCK/jAIsOL/nHPOcVu2bPHHTLu/awM4rQFXG7it91axF9dgvrO2/yJNIFyUBocA++6776 AAQG9V+Ov8U0GZDgCqFAK4LgKAmEIAXc/VQWb7xOiaf8kllzSu8fK9733PU/G/bt1fNozUsbcwIN7lHcVCw+wcOeGa AQAAhj8AyFoeEIYCatFVGLB06VJ35513DprxSRf/mvnR4C+U9dgqABYsWFCiwV/rdfpF9w0o+jNlGOSHAUCrfRrCmV 7d/123gNMmcOFt3lQIqOU7rhm9fnZlMJgvQoX9TTfd5M8XBQAWDOgWgVb86/NallTJTQHziv6cr5U9ANA1IryVqHV8 2XVfewPouKaXd+jz+hm9feaZZ6LsHioWAOSFvSPX+QUAAAgAOgoFtLGT3Hrrrf4+z5rNE33O1nymaWnBxIkT3emnn+ 6mT5/uQwNbE/x3f/d3JR78FSvwu9tYcOTbfVsFAOniX/eA10yf3tqt4GyXd9Fmbyrq4uoC6Kz4zzpeSc56b7QOAT7/ +c/7ot/OLysSVfxb15E2mqzqRfudOwIEF/KIQoCsAEC07CsMAL7whS+4G2+80VOxrzsChN9f9QCgyGsD1wwAAFCaAK BoKJDeXNBmeDT4O/zww/2O8goA7A4CCgH0PSr+tTmUvieemeOk9cx+wQFiGdp98wIAK/5tX4bjJx7sKQB4/PHH3cB5 1/gQQMdL+0KI3tdmb/pZtXzHHgBk3Z0h+1gFx5NlAB0vD0h/TiGSike1ku+33361vKDHFgDYciFdS9IdALq2GwXFel 3Q9V9BgN09YNOmTREe6047AJI2rxnsMQIAAEoaANjgT7R+UwM5sVs9acMnm9HTrI8FAOkQwLoA5Iorrmi0AkcRArz9 TuvbPBXZKXrw7N9IhABhAJAu/p+9+xr32sN3+QDgpJNOck8//bTvAkgXcOld3GPeByDv1oytCrMYb+dWNtpYVAHAvH nzfDv5mDFjal38lz0AsFvJWgCg60i4was6v+zaf+aZZ/rXgscee6xR+D/00EPuiSeecPvss48bO3ZspQKAonuKjORt YAEAAAFAR7N3GqDrrUIA7exst3rS+9rsSV+zAECDPxsAqqjUDFC4FCBsA44lBGjeyTk7BCg2QHRtZphHLgD4x5su8A GA3j507Wf8+n+FAKJjpBZuzdzpThB2f3fbwK0aAYBrGQA02nxd/Pd2L0tXgMIlBQDnn3++GzVqFB0AJf5v1TXCQoCs AECBr1gAoKJ/9uzZbsWKFY07yMS9z0PvIQDPewAAEF0AEIYAus2TWACgAZ/aPlX46/2wGyAMASwIiDEAyCr0k64GiC MfAITFvzb4u/PCE33xL88vu8E9vvQyHwTMO/a97tjDD3Rbt271x8oCALvHuwUBMQYAnbTjhkEPIUB/6FxauHChnxWu 6wU9lvOnXQCgPV/U7aUQwJYBHH/88e6+++6ryAaPvQQAAAAAEQUAFgIsW7asKQSwIMBu7WTrPNX2qZkfDf7CNaGhu+ ++O65lABkhwOCN4JLCg8RkhFrJwwAgbP1XgS8KAtQFICu+dIY7c8q7/ee13letvwoBwg4A2xRSO73HEQJ0OzPX/DOt bu2GzgKA/fffv9YX9JjOGwsBsgIABby25Evfp+BX1/rqBADdhQAEAAAAIPoAIN0NEN7nWYNAhQBq+9TAz9x8880N3/ rWtxo/H2cAkGQEAYOLy9Z3DxjZACCc/Q+/bkGAUWu2WADw4osv+uP1pS99yd1www2eggCt5dZO7+U/lp3O/ucHNwQA qJtWAYA6uywE0FsCAAIAAAAQcQCQ1QWwfv36Qfd5ti4AW+/Ziq0fj2lwmOS83269f1lm/ywAyCr+s463vtdu4aUA4K mnnvKfv/jiixt0Kzex27zFEAAUb/3vIADgAoWahAAKEHXnBiv+FQLadd2CAFEAoNA3qdT698EhQPN1nAAAAABUMACw tz/4wQ8G3edZuz0rAGj1OCr8VTTOmDEjygCg/aaASSnX/mrwHrb/tzveKvoVAhgLAHT8Lr/8cvflL3/ZH/eYbus4FA EAFyfUrQvguuuu88W/nvcLFizwIYBu9RqGAPUIALKu5wQAAACgQgGAFf/2OS0DsFs9iW711G7Apw0ATVQHYNDMv2ux KWA5A4AixX9eCPDd7363UezbzL9uERZPJ0c39+HOPraEAKj7MgC7jui5r+Jfd4YJOwHqEgBkd3QRAAAAgAp1AISfk2 eeecbbtGlTpXf0TtoEA50Xl67UAUA6BAgDAFvCIWr/jyPMSbo8Rm0CgBHYzwEo03VE1wQV/FdccUVTABDu+VLNECBv WRcBAAAAqEAAkDeIs6/pPvFjx46t8UFKSh8AdFL8hwGA2N0bwmNut3S09w888MASD/a7PT6tB/Nh8U8QgDoGAOlrgt j1wgLD2Dq+eg0Sk9xwAAAAIIIAADU+8f48kr3lllsGdX/YMg7b00F3A5DbbrvN7wPRai+IKnR/JAX+cf6gqiFAVgBg hX4YCtr1oToBgMsNBLOe+1wPAAAAAQCiDAHSAYAtAdDg/uyzz3aXXHKJmzdvnrdw4cLK3+OdAABwmSFAmjZ8rVYA0N 11gXMEAAAQACDqQMAG9woAdGuwc889151//vmV3guCwT7Q/tqQxt8GAACAAAAVGeyPHj3a7wExZswYN2rUqFo+OSn+ AQAAABAAAAAAAAAAAgAAAAAAAEAAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAA AAAAAAQAAAAAAAAAAIAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAAAQAKAmjrv0a17e5+WoGRd4/L0AAAAAgAAA EQcA9275/aAQQB/PW7nN09f1liAAAAAAAAgAEHkIsOctNygEULGvwl9fsxDAggD+bgAAAABAAIAKLQWwWX/rFAhDgI Xnnlrrv9nBBx/MuQMAAACAAADVWyYg1g1AFwAAAAAAEACgwiGAAgBCAAAAAAAgAECFAwDbENDoY33+hnOm1/pvs//+ +3OOAAAAACAAQLUCAAsBrAvA9g244ZyTa/u32Weffdy+++7LeQIAAACAAADVKP6zbg2YtXFgHQMAzhMAAAAABACo1O x/+D63BAQAAAAAAgBULAAIbwFoQQDFPwAAAAAQACAyx0/Mvqd9kiRNGwDa2n/DEgAAAAAAIABA5CGAiv8v37MqcwPA 9CaAAAAAAIBhDACGqhijyKtPAGDCAODffv3f7uAPndAIAqz4ZxNAAAAAABiBACDcqb3fxT+FXn386sn7PYUAKvqzAo BwHwD+ZgAAAABQkQ4AAoB6uebkCe68885zjz/+eCMEmHj+Ah8EWAhgqvwkS/7yDvr5d034mwIAAACl3wOg6gUfmlkA sGT1Ez4E0LEPQwAVclUu5ggA+m/ese/1qn7uAAAAAKUIADot4rO+lxCgHiZM+EsXgNgtAMMQQOoQABAC9B4aPnTtZx ruu2yG7zCxIIC/EwAAANDnAMAG4p2u207v8M5SgHqGACrYdMzVCaCiTSGAdQFU/YlGANB98R9uEvnMnVe5f7nnWjcw MOBOOukkr44BAMESAAAAhjQACO/fbiwI6LQLID2o52BUn90RQCGABQEsB6lmwT4UAYDe7l77dX8OnXzyyb7wf/rpp9 1tt91WuwAgSf2r+jkAAACAEQoA0h0Adh/3oiFA+Fh5t3+jMKx2CKBiLQyTdB5wrKtT/Pc71LN9I+zc0dvvfe97jb0l Bs67xu8vYSGAOkqY/QcAAAD6vAdAOgTo9jGylgfQHVBdp5xyirvkkkuajn+9jnXyNgKAPOecc44/R+bPn+9++tOfus mTJzeo0NesvwIAvVXxv+e/fu8/b7eajD8ESFooZwBAaAsAAFDhACBdwNtsfi/tvWHrKHsEVJuKuz179gxaVlKnECCp cBdAt8fRfnbLli0+BFAAIN///vfdpZde2hQCGBX7tqzEPhd7CJAUCAHKGPxwzQYAAKhJANBLAReGAPbWAgUGk9WjAk 7Fvwo8dQPYeVSfY56kCrxqrvvv9Dimi0g7RxQWiQKACy64oBEA2B0krNjfteZ299JDS9z//efljWAg6otzyxCgvMFP GOLSFQAAAFChACA9aO/X7E/9ZoPruQxAVOBJ/ZZ9lL+g67aLp9sOnqNmXNC0J0QYAtxxxx1NBaUK/H/79X836G4S+t yr/3Sne+zWuZUIAAaHAPEtBel2eRgAAABKHADQro9e9wJ47rnnMgvJuuwFkFQwAOg00FEAEO4JYY+ZtfGoPa6KfFv3 byHAv97797W8LWCZQwD+HgAAABUJAIBuhTP/9Vz2kVSq2Et/nHeXj7x9AnQ+hCFA+lajeSGABQFhCMD5QAgAAAAAAg CUrAMg7B6p37KPas9SF73Lh33toosuagQAtidEGCKEIUDW58MQgPOhvHsDAAAAgAAAtApTIFT02Obd5SMdEKgDQLP3 YReAFfphsR9+TezciX/3/6QW5wPPCwAAAAIAUCQ2Nn/jb1LdECBruUf4vor4F1980YcAtilgGASE3SLpz4W3Boz6ol zRWX87bjwnAAAACABAkcidHyp+fNO3DU13A7xTACdu3/3+1T388MODNgYMA4Cq3zUiifhYh6FO+taAPB8AAAAIAACK gxoFAe2Otc3k290h6nqP+STSY5wOeMJuD54HAAAAEQcA3G4LwNAUv38JAUbvN8aNGrVP7f8e++yzT1QhQPh+uHcDQR 8AAEDkAUC46dZhhx1W8z8qgQjQbzecc3Kt///33Xff0nd19KPzAwAAABEsAbAQQPT+vGPf69EdAADVXtLBHTwAAABq uAdAuAO3eejazzQQCABA9QIA2voBAABqGABYCDDxlAsag8J0IMAfHACqNfs/VHdjmDhxIsvJOM8AAEDZA4D0jt0U/g BQ/QDAQoD0BoDdBgOnHDGavzMAAECZA4CspQD8kQGgPiFAGASEH4eBQLhxbJ4ls0+kC4DXUAAAUPYAAABQrwBgz1vO hwAmLwSw/QImT57cNiCudgCQEAAAAAACAABAnB0ACgHCIMAK/zAQCPeG2fjtBXQAEAAAAAACAABAbCGAFfvpgt9m/e 37rPj/1oJL3Omnn55b/GsPgKoHAIlLCAAAAAABAAAgrhDACnx7P+wKEAsJwgBgwoQJtS3+2wcAFP8AAIAAAAAQyZKA cNM/CwX0vgr8vABAhX9dWv+zA4CE4h8AABAAAADi6QZI3/5Phb8oBFAAYNLLACwkqNWLMOcNAAAgAAAAVI0FASr+tR xg1Kgk8+v8rQAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAACAAAAAAAAAABAAAAAAAAAAAgAAAAAAAEAAAAAAAAAACAAA AAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAEADwRwAAAAAAgAAAAAAAAAAQAAAAAAAAAAIAAAAAAABAAAAAAAAAAA gAANTxopQkHn8LAAAAgAAAQMUDgD179tQ6BEgcAQgAAAAIAADUIADYvn07AQDnAgAAAAgAANQhBNi8eTMhAOcCAAAA CAAAVHnNPwEAAQAAAAAIAACUvHjvx5r/dABQ9Y0Bs4p9AgAAAAAQAGDETJw40avrLu3J2/84F/5izJgxbteuXX0JAN Jr/vW+Hvvoo49u+li/s4rnQ14AEH6+LuefXWdMXa8zXG8AAAABAEZ0UL53796G9evX1yoISDL+1TUA0vsTJox3S5cu dXPmzHGHHz6u72v+9Xbnzp2Nj/U79Lu2bt3qf3er/7bhKPiT/wnOhD8OTQjQVPz/Mfh9/5MMaRgx0udXeJ2RuoQASY t/vAYBAAACAIzorJwoBLj++uvd5MmTaz04r8usbFiMqTB//fXXM2fthyIAsM+98sormaFT+r9vKI//ULXttwoA2j1+ 7OeiriFhwV+3LoC6X18AAAABACIpCjVwVwhQ1ydPXQOAqVOnZhbo69at61sA8NJLLw16fC0V0O/O+u/T14YrAMg77s MRALT6fKznos4tXUvq2PJft2sJAAAgAEAE1HatAkzFl7X+12kfAGu7rusAXcc63QGQXv+v91977bWuzgt7vAkTJrQM AHbs2OEmTZqUGQBs3LhxSAvI4egAKPL4VQwAAAAAQACAktDGa1rvrZZvzfqqUNuwYYN/e8ghh9S7PfdPSW0CAC35CA MAnQPpAv3nP/951wHAyy+/3BQAbNq0adDjb9myxU2ZMiUzAFi1ahUBAAEAAAAACADQS+GnQl8bsIUz/0Zf+9xnP+MG Bga8KgcAeV/77W9/W4viKwwBwg6AsG1/9+7dPXUAjB07tvHx888/P+g2gPqeY445ZlDxv2bNmmFpH08vAyhDAFCl4l /HVgGPujys22j8+PG1XArQ6jwDAAAgAMCQFX2StdO7Pq8B+5NPPun3AZg2bVrjtm2V+zv8MSncHVDlcyHc9FHdH2FB 3msAoO6SsANg7dq1jfNJb5966in3yU/MGPSz+trixYuHPwD4U7GNAXsJANJ7Dihsqurs/8yZM5u6i3Q+qOtI3Udluv 3jSHUb8XoEAAAIAFAKKggfeeQRXxzWcUPAOg3U05s+qvtDAZA+v//++/v3jzzyyJ4DAD1GGAAoZFi9evWIB0zpYxx2 f9i/P/3pTz0/th4jKwCo4vmlwt+K/6wuI3UfpfebqOyLcYcdSAAAAAQAGPJugDQVfqauT6K6DtK17EOBgAKgXgIA2b ZtW24AoLf6PWXrMMmaqSUAKG7RokW+uLdOkqwif9y4cZXddLRIeEjxDwAACAAwIjRI123etNO7NntTu7eo6LNlABYE 1GGwTrvuXwIALf2wY6+3Ohe6Pb8sAFChnxUAlO286ufxb1XwV/W80jFX94gtKyE8BAAAIABAyTsBNFsrKvwsEAjXil edZmvDGdt3BvT1GNRbca73FQLoHND7Bx98cEeP8+yzzzZ+Jiz+7XeUNVTKK9Q7LepaFfxVLRDnzp3bYMc4S/prdVoC QBcAAAAgAABQSrYMQO8fdNBB7sorr+woANDP6P0VK1ZEuaFkL7P2dZjxTxf+6gCwTiKzfPlyv+Gjuo1sM0C93bx5c0 NVgoCky39cawAAAAEASkEzuCriRn1slPexj32sli29YXdA3bpDrBtAx7+TAEC38rOiv4zr/buZySUAyKdiXyGAdRDl zf5n2b59u9uzZ0/UIUA/7xgBAABAAIARo6JPNBOsok7rxOu6rreOA/UwANA5UDQEePDBB5sCgFiLu7xb+XUaAHAtKb YMib8HAAAAAQBKEgTMnz/fjTpqlDvqqKNq+eSqc0Gn7g8FQDoH2n2vzpEHHngg2ll/l7M3RLcBQJ1o40czduzYxvt1 KfJp8wcAAAQAACpB3R8q7osEACtXrqxcsdfpEoA6nysKCau+5r/b/QC4lgAAAAIAANEUdu2+p8y7/A9HCECRN7i1v2 pr/vvVTQQAAEAAAABgzT8AAAAIAAAAAAAAIADgjwAAAAAAAAFAN3RvZ/64AAAAAADUIADYvXt31z+vn9XGYaLHivEW cr1s2JTe/ZnNnwAAAAAApQkAFi1a5G/dpILd3vYSABxwwAG+8F++fHkUAUA/C/ay3AaKjbcAAAAAgACgycyZM33RP3 ny5Mbs/5FHHum/NmHChI4eS8W+ft5+zkKA8HfFFAB0Wrxnzf6PZACgW2/pFlx5t+dqFxDo/u6i27zF+gTpx9+fLg4A AAAAUQUAKvD37t075AGACn77OT2OPp41a5b/ePr06f53la0YHKoAIOvxhrOYtAJ/8+bNDfr7v/zyy/7tzp07vW3btv mPn332WW/NmjXuwQcfdA888IBbuXJl9F0ESY//uNgAAAAAiCYAmDhxoi/+VeRnFf/HHHOM/1gzvQoArOBTId9JC79+ 7qmnnhoUANiSgtmzZ/vfNzAw0PRz+vxwFYDtiv9eC/ZuAoChLjLD2X4dGxk7dmzjfXPwwQe7gw46yJ8HpmpLCCj+AZ YjAQAA1CIA0Fv7nIp+FePhwExvwwBARaJ9T9GB3rp16xoBgD2etZDb78xaCpD+7xvqAKBIMd6vAKDIkoBeC04G2QCG m2342mqJkZYhaTlSFa9NRa7bhIkAAGBYA4Cs4l+mTJniNmzY0DQo0/uasQ87ANQi3kkAoAJfwUFWoGADwrDroN1/51 DN/g9nAFBkQNjrrHMna/5D6tIQhTRr1651K1ascNdff71XhzX/f/rTnzxm/4HidF03es1Q55fCX13bJVx2VMVgki4i AAAQXQAwadKkQbP71sIfBgCddgDo+8MOgDBQsM8peFAAUfS/tQ4BQL9CgKw1/7bW/6WXXvI2bdrknn/+eV/wh6rS+p /04R8XGKD1zL/u9pJeRmRLi6rekcT1AwAARBcATJ06ddDsvrXwhzP2NoNTtAANvz/9eGFIoACi7AFAN+vzi/z8UAUA WcsBrJjPEhb8se703+nxaDWI56ICdNb6X9flSlwzAABAdAGABl+vv/56ZnHezwAgq8sg/XtHIgBoVZwPRwDQ6X8rAJ SFNnZVd5dCAFtGVHTZUVX2BOj2Ws01HgAADGkAYIV1uqgeP368W7p0qZszZ44bN25cozgPuwL6EQCEj6ffo9+n36vf X+S/c6gGanmzv0MZALSbce73wNAG3IcfPi7za5r1114Mle8C+GP7wIVBOdB5B4BCABPuCWD7Aej6X8U9AVheBAAASh 0A5BkzZkzTDL0KwKwZe9tYrl2xmf4+6wCwwtI+1u8t4wxOr7fpK1LUD+cg0P7eCl2yZuK038Pq1asbm/7VbZduBuZA 72bNmuU7AvKWG6U/X+kX5A6XIQEAAAxrABDOEufN+Nvu8kUCgPT3ZXUElH0AOBQBwEj+/yhs2bp1q3vllVd8QLNjxw 63ZcsWHwx88hMzKrHpX7czdb/97W8p/gEAAADUJwBo1cKfFRIUCRLaPV6MszhlebxuTJgw3h8DbfyozRd1B4b0bRgr /UT5n4QZf2AIzJw5002fPt3Nnj3bX1PS13ot+6rDzH+v3WMAAAClCgDK8ngEAABQLuomMun2fy0/6uRWslUMAHgNAA AApQ0AOlnzP1yPE3MIwMAPQB0MDAz4bgAV+xs2bPBvdbcXbfhalj1fRnLJEecIAAAodQDQj1s09etxCAAAIA5aBqAl RlpqpGt/1t1e6hIA8BoAAACiCACKrvkfjsfA0NHtFqt6279OBuqcCwAAAABqHQCgesV+2po1a9zixYtr3ZZLAAAAAA CAAACVCwD27t3r92TYuHGjW7VqVSMIIADg/AB6pbsA1P7FmPMAAAAQAKCsXQB1bfmn8AeGhkLGOl5bWFYEAAAIAAAA tew0qmvYSJcRAAAgAAAA1C4EMHXrCCAAAAAABAAAgFouN6rzUgCKfwAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAEAA AAAAAAgAAAAAAAAAAQAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAACAAIA/AgAAAAAA BAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAAAAAAAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAgAAAAAAAAA AQAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAFA6hxxyiFfbv8E7V1wAAACAAABAtQOAjRs3 1jcEaL7qoo3DDjvMq+/fIHkb5wIAACAAABBhAPDmm2+6H/7wh/UMAQZfeZFj8uTJbu/evTUOABJf+xMAAAAAAgBUet AvzPgRABAAxO3AAw/0ahsA9HyMCQAAAEBEAYAN/noZANLqW99Zv/qGANUf9FsIsHz5ckKACl8fdO3fvXt3168Ddi2Y P39+nCFAz8c5vBbwOgIAACIIADT4swEgg3xOsqKD/tWrV9c4BEgqHwJYAKDjXMsQIPsKXNkA4MYbb3T3339/R68DVv zrHKlMANDRcU4X/7yGAACACJYAaMCnwV84C1SrMCD/rw0CgNoHAFoGUMsQoEbXBQsBlixZ0lEIYAHAokWL3KxZs9zZ Z59dsxAgKwDgtQMAAEQQAGjQp8GfdQPUqiOg9V8cLQKAnTt3EgDUZC8AQgC7JhACZAUAM2bMiDcA6DoEIAAAAAARBg DpEODHP/6x18u60EqFAAQBmQN/Dfrr2wWQ1LYLoFbHuoYBgK79t99+u3v00UdbXvvD9n9dCy688EJ36qmnui9+8YvV 6QJoee3PK/4JAQAAQAQBQBgCaPCntxoA7tixw73wwgvu0EMPJQTgBGwM/M8666waBwBJrQIAdXnUNgTIvRYklQ4AdP 3/6le/6jZt2pQbAocBwMKFC92ll15azQAg9/pPAAAAACIPAGwQqMJfgz+xIMBCgMp3AxQ7CtEXdaFeAoAoQ4Cej2dS mxAgHQDULgRoeR2obghgrwEWBi9btqzp2h8W/3fccYe74YYbfACgJQDRBgAdhQDtin8CAAAAEEkAYINAzfxo8HfzzT f7AeDKlSv95zZs2EAIEHkIoKJu48aNvqiTTsMADf7PP/98P+tXiQCg4+NanwAgrwtAVPARAlQzBFDnl677uv5fc801 7qabbnJ33nmn/5qC4MoGAIWv/wQAAACgQgFAuBxAg78wBPjRj37kfvaznxECVCAEsBldCwLSYUBeIGABgAb9GvxXLg Roe4wTugDqFAIUKAarFgCo40tdAGEIIPfee6/7xje+4b/HzoF0AHDZZZf5AOCII46o7rXfEQAAAIAKBgBq+9TMTxgC aAB43333ueeee87PBJlaBgBvDwKTyJcCqJ1bA/kwDFDBJ1lBQLsAIIll8NvZM6+2AUAYAvzyl78ctBSgHp0A9QoBdE 1XCKDQ10KAq6++2l155ZXu2muv9a8Leo3Q8z8dAIRdAKeffro77rjjvCpe/9tdC8J/DGAAAECpAwALAdT2qQBAgz+t Cf3mN7/pAwC1f8+dO9d98pOf9MsCCAHiLu7CEKBVEKBCT7f70oD+U5/6lJs3b17LECDxg+Ek/uOcFFP1LoBXX33VLx +x88QCgOqHAEXPkWqFAFr2ZSGArv9XXHGFu+qqq/y1/7Of/az7wAc+4N7znvc0zgELAC6//HIfAOh1Y9oXF7qX/+P/ ubFHDNQmBAgDAAYuAAAgmgDAQgDN+mvmxwZ/Kv4tACAEqF4I0CoIUJEXLhHQxxr4Z4UApxwx2g0MDPjHKX0Q0Mlgv+ Dg356wVSgCdDxl+/bt7o033mgKANIhQBFRBgBJd8VgrO3huvbruq5lX3oNUPir67/o9UDX/jPOOMOdfPLJjRBArwXh MoCLLrrIBwCHHTfLvfdDJ8S1LKCjV2YCAAAAUJEAQEW91nyq7dMGf0YDwPPOO88LQ4BKLQ3o4JuTrO+PMARIdwOIWr 81+6sCMO2jH/2oH/ynA4A//vt2HwA89NBDjVnASoQABQf/sQYAWQW7uj50fuh461ywLgA7X2655ZamEMDez1PuoCCn aO+xLbw7Ix8CaM8XdX1Z51f6+n/uuec2QgC9DsjSpUsHLQFQB8CuNbfHs0SohxCAJQAAACDKAMAG4RoEas2nBnya+b HBXxgAWAigQaIKf91KStKBQFyhQOfT+hYCvPOjcc3+2ax+VjeAij7N/qoAlGeeecZ9/etfd3/4wx88CwLCEEABwHe+ 8x33+cXL3FXf/r4vJMtdAHR3zNPHOl0AND2BS1zo2y0eRfs8GBVwYQCgMGjLli2NAGDBggVuzpw5/vhPmzatUegrOO yEQiSdO8OzoWSHxfgwBQDN51M5OgG054t1fqWv/1oKoFn/D37wg40QQEvHFADo+S/vfve73cR37+OuOvEIt/n+/1X5 EIAAAAAARBUAWCFgA3EVdBoEaqBnA7908W9Fw7HHHuvbPLUJ1Fe+8pVGEGBsYF/uNuDmgXjSzexwxmMMLhTLPQucFQ JYEKAC8K677vKF//ve9z5PSwXCEEAFoh5n/vz57gtf+IKnACCOWcDOiv8iIUDZCoHwVm5GBbhRsafN3UT7PVgAoOBH x14sILj44ot9AKDZ4JkzZzZ1AYTFfR4LjYb3+lBkJ/ekq1Co98K/XM8PBbfhtT+8/ut1Qdf+U0891b9OKAhQCPC1r3 3NhwB6rms5kFgIkMS2X0IPIQADFwAAUMoAIJwBDAv/8FZP2vBJaz7Dwl+DPxsAnnLKKT4AmDRpkjv++OP9IFAhQPg4 IzPQ72w2MHf2vk8FQCxBgBVxWSGAinsVgL/73e988f8fN43yb/fs2eNDgDAAsFlA+du//VtfAGx98OZKhACNcCjo/I glAAhDANEeD+kgwHZ512aPtgeAdX3o2NseEaeddppv91YIIAoBjj766Kb9IcpT+A8OAVp37Ay+Bgz6dA8hQAzXAwUA up6ng9/w+p8XAOhn9VxX8W+ie+HtdJ+Q8Lgy+w8AAMoSAGQV/WHhb4N/o/ZOrfXULJ8N/GzwlxcAaJBoM4H2OHlBwE gM/jNn+4epDTj795UzBLBW75BmflX8WQeAqPh/8cUXfVCkY7xr167GXQFsJtBmAOOYBex834esECCWNf/pa0AYBOg8 0PENuz7C7g/rANGx1/eGAUA6BAivASMfBBYI/5Kcwi69DKSLa0AMHUEq4rXHi13T07P/CnzSAcCtt97aFABE/cLbSQ hAAAAAAMoYAGhgli7689p/jQbzFgJozacV/hr82QAwHQBceOGFjQCgjO2/hWf+Og0Bumj9LWsxELZztwsALATYvHlz IwSwTgAr+uMrBjoLAGIMAVot/7Frg4UAFgBY10f4fhgCWABgP1ueWf/iy39aB3cuvDIPPh8q0AXUKgSw638YALzrXe 9qBAC6Ruh1RrcRDJ/7sYYBhUOAdAcQAxcAAFCWAMBojbbMmjXLr9EOi/YsCgE0yNOALy0cAIq6BaTVpmCaRbruuuvK vQFYJyFAhTYAywoBtOO7Nn3Tum+1fqvoC4tBFYC6c4Q6QtIBgO4nHmch0CYEyJgRzrsrQKxBgBXwOr5ZwY/RMhBtGm idAGEAUJ5Z/96CgFaFYJEOgpgK/7wQwLq+JOv6r+e6Xl90vlgIoPBYKh0CZBznZNDrDoMZAAAwgnsAWBCgWX2xwZx9 HLLCXiGA2j2NBn7h4E+DPBWHKu4//elP+8Gi3toAMKTZJP3+kbsFWB9DgD7d/ispaVFoIYCt9da677wuABWC+l59XT 9rxb/Oj8MPP9ydc845lQgB2nUBpGcCE5dEUwiEQYB1A9hSANvvIX3cdbwVALQr/uMIgrKK9tYhQKsAIKlAEagQQHd7 UbdXKH39DwMAhQQWAujrH//4x+PtCGjxnM8/1oQAAACgRAFAOgjQDv6hyy67LDME0GAvzQZ/ecL1o8bfLuq8a0owIE xGUBwnYBgCqLNDIUA4I6z35YEHHnBvvfVWYxNBCwH0vo6vAgB1f1gIEPueALlrwnPbgeM59jou6W4ACwG034Md83D5 hwq+cANA+1l7rD/+4nn3L/dc6645eYK77bbbotgQMvdODwUCgObMMBl8UY8sABDd7UXLvUz6+m+bAH7kIx/xAUEYAu g80ffaa0olbguYtA4A8p//hAEAAGCEAoCs5QFhKHD55Zf7MGDp0qX+Ps8WBITCYn/x4sXukksuaZL12Ief8jm3579+ 7weBW/73TSUYDLZep19034DiP+OiCgBE93rXul8FAGr1thlhFfpWAFoLuArGX/ziF/7nPve5zzVCAAUAP/3pT92KFS v853X+RHFngJwOkFbHuXU7cPnPBSvc090AOsY63lryYcGPFf+2ZMBm/S3keejaz/jiX3eFOOmkk7xowp+cmd0knBnO PfaDL+Yx3iNexb9u6arXBO31YtLX/29/+9v++m4dAieccEIjAFAAaHvHiIUAUZwHLil8/S8eABACAACAEQwA0jTTk1 W4a4ZHtNuzNnxSy6foczb4S7MBng32VAQc+tGZvgNAFACUIwToLhTotNiPbfAfdgDofQ3e9b4KQbV9ixWAVgSqWNBS EAsAXnjhBX9O3X333Y19IPS92lRQS0XKXQi0WAZScMO39NKAWAoB3cHhj/++3R9H7esgFgLomCsAUtdHuPZft4wMi3 977mvmX4X/008/HUkHQLFugOy27yT3Yh5zAKBbvKYDYC37svDX9pe5/vrr/fmhACDsAlAIILZPjCl9R1AH+zzknxMu +m4wAABQ4QBAtNb76quvdhdddJF/X4V7VoGf3lxQg7jp06d7GuylB3f2/tqFsz0LAPR+mQaAicu6n3v73cJja/fuJA CwW70ZK/zC2V8rAGX06NE+ABAVEDq+v/rVrxoBgM4tFQAqJBQOlLMA6GYvh/xzo/25U54OAD3njR1T3eYx3BsgPP52 7DW7+7d/+7dNG0B+73vf88t/Hn/8cR/8LVn9ROlDgPRzv3WIk9EpEBT6sRb/WSGAjqM2jrXbwyoAsG6v8HiLiv9169 b5z33hC19wN910k39d0BIC+95ly5Z5Zd8botixz84GXWZQnP48AADACAYAmtmd9sWFnt5XEaABmq0H1cDO1gLbmk/N /Oh79FYBgN4fO3ZsIxBoFQSUbQYoa/Aergct1u4ZfxhgAYAV7Wnhpm/p2d+1a9f6HcRVOPznf/5n4/O/+c1v/F4ACg D0VptF6m4Ujz76aBSdIL0UAbGEADoOOp4PPfSQ+853vuPDPQsCrBtAyz8sDNAxtmOvAOCv/uqv3BtvvNE45pr1V+Go tyr+bQlQLAFAVgiYf+vH6gYAYfCjAMA2erUAQNd5ex0IWdEvCoY2bdrk1q9f3yj8Y9kTonjwl38d6eYuswAAgABgWA KAl//j/7nDjpvl33/3u9/tW4LDQZ1CALV42ppPva9Zn3DQd+KJJ7qJEyc2QgBb950OAkr5h88KANoUckmh4jHOAEBU 7If3eA83fbPZX1HBkC4CbNZPu4ereLRCUoW/Ff+xBgDZxUHWY7kW+0WUrwtAAeDnFy/zs7cWAoZ37tBx1H4PtuTDQs KNGzf6zg+7DoRLgLR5nJYESCxLAZqvAdnFXNPxHfT9ra8lMQYAoiU86QDAwt5PfOITjbb/v/7rv3ZTpkzxLAj4yU9+ 4r/vwx/+cCUDgGLLBly0oRAAAKhYACBjjxhw7/3QCf7txHfv4wMAvQ0LdwsBtN5TLACwwZ8+p1sMKgTQ5ywEiGMDuC JFkuuo1Tu2ICAdAFjRHwYB4aZvav3W7G9YAFp7f7iDeDocKPPAv7OZ/2RQARjr0hAdF4WAV337+00BgNFMbhgGaMmH uj70tbD4V3FoHST63MJP/I3btvKrbtea291LDy2J4jqQVbi3CgCzwoLYbwVoAYA973U80x0AFvZY4a/zRs/3CRMmND rGRJ/TcgALAMr/etDp7R6LLhmJNxQCAAAVDABEm7dpoH7ViUf44j8MADTwsxDAgoBwwycN/vRWa8UtBNCAUXsKZHUD xCcZtLYzKThgjOm+8BYA2Kx/yO71HhaFav0OC0C1+Wum30KA7du3+7ezZ892d911V1NReeCBB5bsfCgaAOS1eictz4 ukRedJWUIALc8QhTvWBWTr+3X8bZ8H0ZKPsANIhaGWD4SbP+pruivA9lW3ulf/6U732K1zS30NyGrfbw53qtsBFAYA djcICwB0PO1Wr+H6fy37UueXwl97Hbjxxhv9cz4dAvzgBz/wP3PFFVdEHQA0H9fEtdsski4AAABQ2gDAioDN9/+vRg gQBgBhER9u+GRrPsMQQBQCqG1U4u8GSFz+Zk5JByFAEmUAkC7+w86QsAAUhQDaNT4rBNC95fV5bTBmtExAyh4AJB38 bLsQIHvNeTme/xYCih1fe97qPNCdHsLNHtX1oWNuAYBu/xgGAHocCxP+9d6/9+9HeXHOCQCTigUAdi2wECArALBzRd d1XecV+uqab90A6RBA71tgHMdSgKTgcS2+TCgpcfgHAABqHADkrdXXxx//+Mf9YC5c52trPtX2qUFfGABkhQBxdwO0 HgAWDwCSqAIAK/6t/Vv3es8q/lX8mXQIYAHAzp07/ef0/fPmzfN0i8D999+/1AFA1o7exYoA17IVuIwbxun4bH3w5q agxwo7va9OofRmj+r60DG34//973/fn0sXXHBB43vCfUXiDgCTwps9xrwhaKsAwI6jXdPDEMCCAHWOhEuBtMmkhUmf +cxn/GtGmW8J2ksAkHmniBZdJgAAgACgtOuENXjT/eHDNZ/a7MlmeSwEOPPMMz29r8GkDQzDECDOboAiszxJtEGAjl UYAKSL/z/+4nnf0q1N3bQHhN3n3dq+NfurAjDdCaCN4zTbH3YBaGdxFf/77LNPqZcB5BX/eZvFdRMClPG5HgYAOpZ2 jG2fhzDc0fs61tYJIBYA6BiLvqZrQNwBQF7rv4u+AygvBMgLAMIuAO35ohDArvN27f+Hf/gH/3V7fXjmmWf8z1jxr+ UDej++EMD1HAKwJwAAAIgiANCu7xYAaGOnMACwQZ5mfmxZgG4baLOHWcp7T/juAoBOQ4AkogDA1nNrg7iTTjrJFwOi z4ebB2r2Nx0A6JxRCKAAQJ577jn/+VGjRpW4yyN9PLNn7zsNAGJcD2whgLX3/+pXv2oZAkhWAKB9QSwEiD/8q3YI0C oACDeJVJCrIl/H1kIABQA6Jx577LGmLoAwAFDxr6UkMQYAzc/b3roACAAAACAAiCIA0Oxt2OaZ3vBJMz8a/N13331N br755oZvfetbERYCSeEQoIgydwCExb8df838q/h/+umn3eOPP+47AKwYCG8ZZlT02W3/dN6IAoCHH364pMe9dfHfun 2/8y6AqC5Qf/6PXrFiRSPo+c1vfuP3bgj3ebAQIAwCVPwr/FHbtzYFNVXqAArPk6RCQYCe+7oO6PhZ8X/4KZ9zh350 ZlMXgI6ljqmWeikE0GuDwl9d83XOqP3/iSeecJs2bXL77befL/5FG06WNwDICwGKLx/KvuYnBAAAACCOACAMARQAaM CvAZ3N7oQBgGaE9FaDPxUJ6VvBxX9HgGKz/VkFZNkH/BYAhK3/duxV8CsA8IX/ede4Jauf8Pd61+3e7Jhq1teoANy6 dav//P/3//1/fg+Abdu2NXUBxHFs89v2Bw/gc2b700VAhAGAZmzDcOfNN98ctNmjnQcKfnTsNSOswlBv7S4D5pZbbq lAAOiyO0UKBAFJBNcDXQeuu+66v8z8//k5v+e/fu/frl04e1AXgO33op9TCKAAwDb51PdpuY/uHBDPa0C7/T+K7APS vH+ESyj4AQBARAGAFQIKAPR2/fr17ic/+UljOUAYBtjGTxr8abZHOz/bLaBUSOhzVbktYLvlAOnCsawzPxYApGf/02 vDRcW/igF1Behe71oeYDvHW9u3qPBTIRgWAk8++aTfOK4cm/+1CwD63SmSPmfied6r0NMxveiiizy75aMCHXvua7ZY nR52nujYa9+Hp556yvvud7/rhXsJVCEAyJvdj6kDqNUyAFsGJGEAEJ4bFgLYRoAKAGytv70GxNX5UTQAcK7drf+Y8Q cAAJUIAJYtW9YYFOo+z7rVk4p+KwbU9mkDQAsArPC3daDxbgrmBu0Eng4DWg0AyzgYtAAgq/jPOg9sWYBuHad7vdtO 71b8qxhUQWAb/2UFCWUs8HovzuOa6e3kua/jqee/OgAsALjrrrsa+ztos0cLAdT10aoDqCobArbfDyTeY24hgAUAW/ 73TQ15IUA6ANC1367/FgLHdLyLH0cCAAAAUMEAwAZ7Vvzb4C4c1GuzJ9ESAbV9hrP/1QgA3KDBnWsRBqQL/zIHAGH7 f9Fz4aWHlrhX/+nOxu3ebP231n2rGNDMbxzHmQCgaCeANn2z/R1EIY+WeFgQoABAHysACH/WNn/TEoDYlwFlBYCd7C ERYwAQhgB5AYAoANBeL/p8WPjba0acXQC9BQD5y4YAAAABQEQBgA38bIBnLZ6iDZ+05jPr61UJANIDvKwdomMKADop /sPz4bFb57p/vffv/fsq+lUgamMwFXoWAIQOPPDAUnYA9GfWtn0AEGsRoGOm9n0dVwUA6Y4OBQEWAmi/h3Tnh4p/7S Mio0ePjvi5n3NccwICF/FscLgXiB3HsPhPh0PpACBcBqCvKxi0WwHGFQJ01yGSddwJAQAAQHQBQFZLt2Z2bHAXFvjt vl6lg9hqkFf2QWC3AYCdA7YEwEIACwC05juc/VWbuLG9AaoVALhCrcCxFgO2yV84+6tjqds/6n1t8Kg7PSgE0H4PWd +nZQIKCOPthMh+7qe7AZIKBABFXgPSIUAYAOg5H74OWPGv60G57wLQnw6RrNeBMu8FAwAACAA6GhSGg7t0gd/u65U5 kC0Gd2XvAOim+M87F9IBgM3+qgCcN2+ep70CyrMZYNLnNdvVDADSBaC6OVTY63ja/iAWBNg+AVnfN2bMmEoGf4OXBd RnFjgMAOxWr1bohywMrEsAUKXnPgAAIAAYNABstc63OuuAixUE3Xy9SoWAjrHt+K73FQBo9lcFoIp/7RFR3Sd2sUKg CsfaCnsd01GjRjU+r3An3QGQ/r4qhwCt9gCo6vPflomEx90C35CuB9UMAFzbzg8CAAAAkFTpfyac6enm6wQA1SkE7F 7vRuu+1fqt2d8qFYDdFgJV+f/UMo4igU7R76vac76Oz/28O3/EfRcIAAAAAgCg47XCqBYV9kWWchT9vlgDgH59HwAA AAgAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAAAAAAAAQAAAAAAAAAABAAAAAA AAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAAAQAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAgAAAAAAAAAAQAAAAA AACAAAAYQUfNuIC/AwAAAAAQAKDKjrv0a27eym2EAAAAAABAAIA6BACEAAAAAABAAICKBwD3bvm9RwgAAAAAAAQAqH gHgIUABAAAAAAAQACAGgQAel+f428DAAAAAAQAqHgIQAAAAAAAAAQAqHAAsOctRxcAUOHnOc9rAAAAAgBQGDQ6ABQC 2McUC0D1nucEAQAAAAQAoDAgAABq8FynywcAAIAAALQGN+0BQIEAVDvs4/kNAABAAIAatwWHbwkAAEIAAAAADEMAwB pNjFQxQIswUJ+uH57jAAAAIxwApGdgGaBhSE7gJPHStwA0BABAtQMA7ffB8xwAAGAEA4Cw+DdWkPFHRz+L/y/fs8r9 26//2x38oROabgNoKAqA6hb/YdjHcx0AAGCEOwDSVJzxR8dwBQDMCgLVbPlPf8xzHQAAoAR7AABDSUV/VgDA5n9ANa Wf19YFwHMdAACAAAA1CABk4vkLfBBgIQB7TgDVFS7tsT0AeL4DAAAQAKAGSwBU/NtbCwFsY0D+RkB1lwIQAAAAABAA oEbFv3UAWMFvIYAQAADV3wuAbh8AAAACANQkAAhZEKAQwN7n7wQAAAAABACoUAgQ7gdA8Q8AAAAABACoSUcAfw8AAA AAqGEAYLeG41ZRAAAAAAACgIoHAOwUDQDlui7zdwAAACAA6HqGv91u0OwYDQDlumbz9wAAAKhBANDvddoaSKrFPz2o zBpgMugEmB3GyBb/BAAAAAB0APRlnX/YDWDr/rlnNMDsMAgAAAAACABK9B8z8ZQLuu4QSBf9WvNv7+utPmYfAKD8BW K/N+zk7hCEPAAAAChpANDrYN2CgKyOAAacQLmKwKzP9xLU2fXj4A+d4Nn7hADVDnkAAAAQUQCgwj/Uj4E6RT8Q5wxw t89bXTe+fM+qBhX+E89fQABQ8uVa/F0AAABqFABoUK6i32aF+hUAACj3DHC/QwBdN/7t1//doOLfCn+uKeVa/6/jTx cAAABATQOA9CZ9DNaB+gQA1vJvxWCnG3iGX7fWf1EXgIUA4ZIAjkF5AoAit3AFAABAxZYAhLN0DNDBUo96rQNXERiG AHr/qBkXNBWL4c7xafa19NezQgCuL+UIAOy42matRZcD6BjytwQAAIg8AAB6XU9MO3Gcxy8MA9Kz/hYC2NfCICBd8G d9PR0CEACUrwvAAgA7dvyNAAAACACATFbkhQUFIUC1OjmyQoCwaAxnj8PbfdrnbGNAiv/yhwD2uaJdAHSMAQAAEACA 4hEVoxAgHQRYoR92DeQFABSK5Q8BOn0O2x1j2DMGAACAAAA1FBZ9/D2qHfSk1/qngwHOg/iOZxjeFA0A2DQWAACAAA A1LibCGWH+JvWYPc7bE4C/U3zdO0X28rCZf7HvJQAAAAAgAEBNCwkCgPoVjiwBqdYxbfui9eeCnyUAAAAABACo+Zp/ CkGgoi9UqSKfvR0AAAAIAFCj9m9bMxzeSi78GAAAAABAAIAKtn+nAwEAAAAAAAEAarIkAAAAAABAAAAAAAAAAAEAAA AAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAAAAgAAAAAAAEAAAAAAAAAACAAAAAAAACAAAAAAAAAABAAA AAAAAIAAAAAAAAAAEAAAAAAAAAACAAAAAAAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAEAPwRAAAAAAAgAAAAYMRMnD ixSR1fpMN/nBMAAIAAAABQycJ/7969TeoSAiQt/nF+AAAAAgAAQCVMnjy5qeCvWxdA0uYf5wgAACAAQFSzekmSeHVt 5+VcAPKp8FcIUMeW/3QAwPkAAAAIABBt8R+28q5fv75WQQAzeW//HXo85nUNjwAAAAACAEQ3+x9SCHD99df72T7aeu sVAvTys3v27Kl1CMDMMAAAAAgAEGUooOJfIQCtvgQARX92+/btBAA1+P885phj3JQpU9ykSZPc1KlT/TEfP358La8P dswJfwAAAAEAojB6/Gg/gLeBfJ33AeB86D1A2Lx5MyFAhf//Zs6c6Xbt2uU2bNjg3+7cudO9/vrrbunSpW7MmDF0DH EdAAAABAAoKw3YNXDXAF4D+XBgP+qQUbUezHN+tO4IyAqKCACqGwCo8LfiPwwKzZw5cxpfq2NXENcNAABAAIDSF3ca sGvgnjWg19fef+b73cDAgFflQX2rQq6KA/uiXR7tAoD0mv90AFD1bpKs86KKReCiRYv89UDU/p91TMeNG1fZ410kHK T4BwAABACIogjcd9y+mV/TQP/JJ5/0+wBMmzbNHX300bXdB6BKIYC6PvoxU5u15t+CIztX7OMytYb381jmBQDh56tw 7ugYak+QOmwK2s3sPwAAAAEAKkED/kceecSHAHXcELAKAYDd2UHva78HLflQ10dW8NPrmn+91VIS+1i/Q79r69at/n e3+m8broK/38cy/VhZH8feNj537twGhTtZHUOS/lrdrgMEBAAAgAAAUXUDpO2///4NzPzFWfzv3bu3UWTrmGq/h6xZ +6EIAOxzr7zySmZBmP7vG47j1++2/XYBQKvHL/v5ZUW/zo/du3c3Wb58uXvqqafcunXrGpsB6q3OBxN7EJD0+I/XFg AAQACA0rb4aiD/2muvuZ///OeNQb6WANgyAAsC6rDGtyqD+nSBrTs9ZBXoOvb9CgBeeumlQY+vpQL63Vn/ffracAUA ecdwOAKAVp8v83ml64BCgCOPPNLLCwuz6Nim94moUxcQQQAAACAAwIjN8HfTCbDPkft4CgEsEGApQBLVcU93AKTX/+ t9BT/dFGn2eBMmTGgZAOzYscPfMz4rANi4ceOQLgMYjg6AIo8fawDQr84irsMAAAAEAGAgjiE+7uvXr28KAHSbx3SB rq6PbgOAl19+uSkA2LRp06DH37Jli5syZUpmALBq1SoCgAgCAB1jM3bs2Mb7dbm20OYPAAAIAFArBx98sDvooIPcqI +N8vb92OhadgHEHAKEHQBh2766O3rpAFBBaB8///zzg24DaLePSxf/a9asGfJNANPHriwBQKxF5FFHHVXZNf+9Lhfi dQIAABAAoFKuvPJKT0sBVLwNDAzUeilADIN+FWRatmG3cBt1yKimgrzXAECFYNgBsHbt2sZtAPVWG8Udeuqhg35WX1 u8ePGwBwBFi/Z+PHaROwDEGipVdc1/HUNCAABQwwBAmzzV/g/OiddREDB//nw36qhRfkawzgP9GM4dFf/h3g3vP/P9 PsTR57Wxo97XXg+9BgB6jDAAUMiwevXqxsdlKsz6FeQUCQDqcn1hqREAAEBEAYBmAbv9ef2sCkHRY8VWFParCIhlwM 8gvd7UuaFA4JFHHukpAJBt27blBgB6q98z0gHAUD5fCQAAAAAQRQCwaNEi3wps93nupQtAAcABBxzgC3/dHzqGAGAo igAG/IglAJg2bVrj9o56qxCgm8cK7wKgQj8rAChb2NTPNdytCn6uBQAAAChFADBz5kw/cFcLsM3+6x7P+poN5otSsa +ft5+zECD8XTEU/922dLcb9FMAoIysONf7CgGsA0ibPXbyOM8++2zjZ8Li335HWTtN8p6zvdzrnec+AAAARjQAUIGv +4APdQCggt9+To+jj2fNmuU/nj59uv9dZWrtH44AgFlAxMKWAeh93elBezx0EgDoZ/T+ihUrStfu32sRP5Q/CwAAAP QtANDu2ir+bffvdPFvu4BrwB7uAq5CvpMWfv2cdvpOBwC2pGD27Nn+96V3jNfnh2uWv9MZ+37MArYrCigUUJoLztt3 CtD7usVjJwGA7gZhRX8Z1/t3dNHt4rlJAAAAAIBSBQDhbbZU9Le7D7ju6W3fU7R4WLduXdOtwPR44U7geryspQDp/7 6hDgCKFOO9BgDtAoEiHQrAcAsDAHUDFA0BHnzwwaYAINbNJbu9BsR2RwgAAABUMADIKv5lypQpbsOGDU2DdL2vGfuw A0C39uokAFCBr+AgK1CwsCHsOmj33znUs//DEQAUKfbZNBBls+/HRvtZfd3msd336jaQDzzwQLSz/p0uHer1ewEAAI BhDQAmTZo0aHbfWvjDAKDTDoBwJ/B0oGCfU/CgAKLof2sdAoCRCgG4Xzda0XIdFfdFAoCVK1dW7jzqdAkA5wzXFQAA gFIGAFOnTh00u28t/OGM/ebNmzsKAMLvTz9eGBIogCh7ANDNoL7Iz5ctANizZ4/bvn1706A9S6viT2Je892Pv3lVC8 Ai+4CUeZf/4TiudSr+dT5Iq2uFrie6rlTxnChyvaAbBAAAlC4A0MDs9ddfzyzO+xkAZHUZpH/vSAQArYrz4QgAOv1v HY7ZOh07o+P28ssv+7cKimTbtm3+Y+32LmoP17pvtX5XYfY36fEfFyxUmZZzGXV2qVtMAa+uCRJeP6o4+8+1AAAARB EAWGGdLqrHjx/vli5d6ubMmePGjRvXKATDroB+BADh4+n36Pfp9+r3F/nvHKoZm7wB21AGAO0GiSM9eAxn8LSMQ7Sf g71vdK933e5Ns76mzoN9Bvyoy8z/AQccMOh6YNeIqrf9cw0AAADRBAB5xowZ0zRDr0Iua8be2sPbFY/p77MOAGsNt4 /1e8vYytnrbfqKFPVlKvJ5ggHotPW/rtcdCn0AABB9ABAOzPJm/G2NeJEAIP19WR0BZR8ADkUAUKr/vw7W/If2OXIf T2HO2rVr3YoVK/yt3uyWcXUZyDPzh7qaO3eub/1XCHDkkUd6Ra8fVdgToJfnPtcKAABQmgCgVQt/VkhQJEho93ixBQ BleryhXPNva/1feuklb9OmTe7555/3BX+oKq3/SR/+cZFC3ToAFAKYcE8A2w9A15Aq7gnAdQIAANQmACjL4xEADN1y ACvms4QFf9Xu817kODGYB5rNmjXLdwTkXTfSn6/yfgCxXfcBAAABQNu1/CP5ODGHAAwCAQAAAAClDgD6sVazX49DAD B8nQD7jts382uazTvmmGMq3wXAun+gvZkzZ7rp06e72bNn++tC+hqvu73U6W4ABL8AACDqAKDomv/heAwM3/HWml3d ojGrnVf3+169enVj078qt/SyBABoT9cLk75e6DqSvptMnZYAcJ0AAADRBQCoH92acevWre6VV17xSzd27NjhtmzZ4g fyh556aCU2/et0lj8cyDOoB5oNDAz4bgBdIzZs2ODfvv76627p0qWludXrSF83AAAACABQWqPHj/YF/tSpU92kSZPc lClTfItvHZ90DOSBYnSN0LVC1wxdP8aPH1/b6wVLAAAAAAEAAAAAAAAgAAAAAAAAAAQAAIAS0l0Aav/izHkAAAAIAF AlEydOrN1t/7LW93IuAIPt3bvXXyO4PnAuAAAAAgBEWOynrVmzxi1evLhWg3l29AaKXzMsBAjVLQDgegEAAAgAEO1g XrcB3Lhxo1u1alWtBvQEAED31w1Tt44ArhcAAIAAAJXpAqhrSy8DeaC760adlwJwzQAAAAQAAAAAAACAAAAAAAAAAB AAAOiDQw45xKvt3+CdKyoAAABAAACg2gGANnasbQjQfFUFAAAACAAAVDcAePPNN90Pf/jDeoYAg6+sAAAAAAEAAAIA AgAAAACAAABA5CHA8uXLCQEIAQAAAEAAAKDqAcDq1avrGQJkX2EBAAAAAgAA1V0GUMsQIP8qCwAAABAAACAEqH4XAC EAAAAACAAA1CAAmDx5MgEA5wYAAAAIAABULQDYuXNnfUOA3CstIQAAAAAIAFABKu5qNcs7CAVeXgBQuxCg5dWWcwQA AAAEAKhAALB3794ahwCJr+0o8PK7AOTSSy8lBOAcyXTYYYd5hIicCwAAgAAAEQQAKvDqGwIkhAAFugBqEwK0vepyjm QFiPUNALh2AAAAAgAQABAAVCAE+OUvfzloKUA9OgHqEwIceOCBXm0DgHdeTQkAAAAAAQDqEwCo4CMAYBAfBgCvvvqq 27hxYyMEsACg+iFAkatvUpkAYPfu3V0HARYAzJ8/P84QYPCrag8BANcPAABAAIAIAoBFixbVuAsgIQTIOCdk+/bt7o 033mgKANIhQBHRnhOFQoAiyh8A3Hjjje7+++/vKASw4l/XjsoEAB2FAOnin2sHAAAgAEDJC72zzjqrxgFAUvsAIKtg nzFjhu8CUACgZQDWBWABwC233NIUAtj7ecodFOQU7YWvwv00siHAkiVLOgoBLADQ9WPWrFnu7LPPrlkIkBUAEAIAAI CSBQDW6tnLus+o9dTuWb5W7VAvAUCUIUAf2nfrEgLkFd06/nL++ec3HHfccU0BgJYCbNmypREALFiwwM2ZM8cX99Om TWsU+tdee21HdM7pfBuec67DYnyYAoB3ft3InnPdhABhAKDQKNoAoOsQgAAAAABEEgBooGfrPmsdAEQeAqhI0+ysdm yXTsMADeBV8C1cuLAaAUAXM3h1CgCsXdtY8CM6B2644QbvU5/6VCMAeOaZZ9xdd93lWUBw8cUX+wDg3HPPdTNnzmzq AgiL+zx2ntm5NjznW16x1mMA4PpR+I/8+WavCz/+8Y/d7bff7h599NGWrw/h+aRjeuGFF7pTTz3VffGLX6xOF0DL60 i784kBCgAAKNESAA3stOYz3PypVmFAT0Vj+UIAW6NtQUA6DMgLBCwAUNF3xx13VC8EaHtsk1qGAKJN/tJBgM4BmTdv XmMPgK9//evuD3/4g/vd737XOLdOO+00d/rpp/sQQBQCHH300T4AsPOoPIX/4KJtcPHdOgQY9OkeQoCyFf5ZAYA6AL 761a+6TZs25b42hAGAwiMd+0oGALnXDwIAAAAQWQCgQZ7aPa0boFYdAT3PHJdzKYDaszUgD8MAFXqSFQRUIgDoJAQY dHzrFQCklwJYMZ4VBKig++hHP+qL//e9731N7NzS18844wz/vWEAkA4B7PFHrvDPPuZFgoCsoj8zCChY/Je5QLQQQL P/CgDUCaDXiWXLljW9NoTFv461rh869loCEG0A0FEIUKSbhAEKAAAoUQCQDgE06yO93A6q+jM+cQQBYQjQKgiwzd60 3lst35r1zQoBjj38wGoFAUmnxVp1nwOtggALASwA+I+bRjUCAHs/DAEsALCfLc+sf/swoFUQ0NQMEF4b3g4CipxXZZ 31z3td2LFjh39tuPnmm90111zjbrrpJnfnnXf6rx166KHVDQA6uIYQAAAAgOgCgDAEsJkezfxo8PfCCy/4gR4hQNwh QKsgQIP4cImArePOCwHkzCnvrtCSgPbBQF3uCpAVBFgBrwJf5026C8Ds2bPHh0jWCRAGAOlZ/2tOnlDSQKl1EJC0OK +KdBDEVBTqNUHXf70WhCGA3Hvvve4b3/iG/x67vqQDgMsuu6z6AYAjAAAAAJEGADbgs5ZPsSDAQoDKdwN0vX68/CFA uhtAbFd3re9OU7FnRVxYvD107Wfc40sv82+j6Ajo+hlVzwAgKwiwAs+WAqjQ19uw+LdwQAFAu+L/H2+6wN154YklP3 /yZ3fzQoCk0FKSuM4hXfd1/V+5cmUjBLj66qvdlVde6Td4VEeAXhdsuUcYANSmC8DVu3sIAABEHABYCKANn9QJoMGe Bn0a/OlzGzZsIASINARQ4ZXVDaA7B7zxxhs+DBDt9G6bvYkFAWERNzAw4E466SQviWJwmzHLX2BWL8lYJ+7fBv/qEA SE3QAWArz44ov+rQUBert582Z3yimnNHWP2M/qPNFjPXv3NZ5CgPJ2AbhBa7wzz4UCAUDzqRfn+aIQQNd/CwEUDl9x xRXuqquucnPnznWf/exn3Qc+8AH3nve8p3EHCAsALr/88rgDgB5DAAIAAABQ+gAgXA6gVs8wBPjRj37kfvaznxECRF r45YUAFgSoG0C3eAs3e7O13RYC6B7wepynn37a3XbbbZEEAEEB1kHxXyQEqPyF5e3CPd0NoDZ/FfxqA9f58cADDzSK f1syYIFR4v9uiTt+4sHutYfv8sW/KAiIY1+J7G6AcAPA3E6BChR/ut4r/NX1X63/3/zmN33xL+oEUAig8+Hkk09uhA Cf/OQnq7EMoNMuIgIAAAAQawCg3Z7V3hmGABr83Xfffe65557zs0Im6zFOOWJ0QxLbAKjjWeK4QgAr5tMhgIp7BQC6 zVu4wZu1fIcBwOOPP+4GzrvGLVn9ROVCgMbsbkZxFwYAdbiwqECfd+x7fbGu467jLxYCqOjX+fHWW281rf3X+aTvP+ ecc/z5obBIAYBo+cjzy26IKABo3w2QFxRVpfjTa4LCX13/Rbf7sxBAAcB5553nzj333EYIoABAli5dGn8A0EMIQAAA AACiCABswKfdnhUAaM2n2j4182ODPw36NMDTzFA6BFDRv3bh7AZCgHKGALY3QEi3Akxv9GYt3yrwVPjt2rXLP4aK/z 3/9fv4jm1SMADIae+u26BeRbq17Vs3gM6BcG8AExb/Oi8UFuitCkTRshEtIdE+Eiu+dIZ/bOsQiObcSYqu93/nVEtc /EtH9Jqg8FfXfwsA9DpgAYCWAmjW/4Mf/GAjBNBrSCUCgC5DAAIAAAAQTQBgAz7N+qvN09Z82uDPBn7pEMAG8//3n5 f7dt9fr/8/hAAlDgHSQUBWABCu8bYQwDoBtI5b4iriWocARTZ5q9PA3gIAzdpr9l7HO+wG0PliYYBuHxq2/YsKfnUA qGtES0cUAuhxdCcJnW/aTE57BsR2/mQtE8k7L/IDgCSqTgFd5+3aHxb/FgCcddZZ7tRTT/WvHQoC9Prwta99jRCAEA AAAMQQAGiwpzW+GqBbu2e67VPCECC0beVX3UsPLfEBwNSpU93pp58eV6HYwTdnFo0ZBUBZQ4BbbrnFLViwwF188cXu tNNO80VdeL93BQA6F9TyHQYAOsa71tzuj7NCn0qFAKljWucAQLP1mrW3DSD1vLduANH58otf/MIXgfr491v+0f37E8 vcwk/8jRv44Id9t4iWjCgI0M9rWYEeVwGAzr8wBCjzOdRcxA9eBtDuvGgdACRRBAC63ofXfyv+2wUA+tn4gsLBNX03 AUDTsiIAAIAyBgA2sNdATnsBaMCnToB022cYAmh5gAZ5mgWUdCAgCgEsCIih1bebECDvHuJl3DwuDAHmzJnj6fjkdQ Fovbe+V1/Xz/7LPde67atuda/+053usVvnVmY5QLsugLrN6mm2XrP2Kt41i6/ZfBXzCgTCjQJl9OjR7qoTj/DnhgIi dQxoqYjtFyEq/sOlAwoALAQoczdAsZn8pLNrTET3jtc1XGGvrvfpAEDF/8yZMwcFALfeemsjANA+ARJrEJB0EgLkbB aZMGABAABlCgDCHb9t128N5jTAy2r7FA385Nhjj3VHHHGEv/fzV77ylUYQYMJ7gZd38Jcxo9flKDFrXF/GAX4YAmhw rhDA7utuhb/t9K7N3mwTQQsBVPhrice/3vv3kc7uFQsBirZ7V7ULQLP2CgB84f/2BpCa3dcsv2b7NetvhZ3OBwVD6g 4Jl4jIo48+6rZu3doo9sUCAAsB1JFSxnOpHwFeq4Cw+dyKIwSw638YALzrXe9qBABaWqQAQHeSsXNAm8xKeF7EEgoU fl1IbxyaeQ4AAACMQAAQzt6Fhb/RgFz3edb677y2T7WGKwCYNGmSO/744/3ATyFA+Dh2L/kwCCjVbH/SYva+mxFizs C+bEGAHYtp06b5AbwCAB1rm/FXoW/3eLed3nUs1fKdXu8dbQCQc5yTFgVbHTcDtGNsG0CquNcsv2b7Nev/Py+v81// 1ZP3+64QLQ3Rxzt37vQbw+lx9ttvP/85hQDaXPKpp57yvvvd73p333139K3ima3jjf+fpN1lIoqlABYC2PVfVPynAw DdQUYBgK4nYQgQBgFhIFCZToCMDSOTNi8VDGYAAMCQBQBZRX9Y+Iezc6LBu27xpBliK/yt+M8LABQS2MyyPU5eEDD8 YUCr9bs9jsqT9rJ/38h3AOh9hQB6X8X+cccd59k93m2nd3V02Hpvfe6iiy5qtPZGHQAkxY5l/vlSkwvO2wWcAgDN8m u23zb6FHWDqDPE9oUIAwAVhyZrBjip4N+x6c4ArhrhkUIALfvSdT8UFv96zQgDAF1HLAQIlwLEVPyHe8TkhgC5t4QM Q4AkdX4AAAAMUQCgwVi66FdRZ7TL/w033NBERZ6FALrVU9jyaW2f6QDgwgsvbCoas4xMV0AHRX83IUAHj1eG5QFhAC BHH310g834h8fQbvNm670r1QFQ8JjVsejPCwI0y6/Zfs36ZxXz6gTatm2bf//EE090S5YsafjSl77kN57U56ta/IdF X9LiX4wBgGjZl677Jiz+xTYB/MhHPuJfI8IQINriv9Xsf9vrxeDlAAxiAADAkAcAZv78+d6sWbPcjBkzmor2LAoBNM CzVs9QOPMjtuFTeqOvkGaRr7vuOl9YhkFAmQq+jkKAHh63yC7iQxkA6HhkHXMdG3VvpO/xrjXfavvWzK+Kv6j3AOi4 +OeiYwGAZvk1258+/npf941/+OGHfQjw5JNP/mX5wJ8L/3vuuce/VbioAODyyy93n/vc55qCgCoEAuFzukgIEFMQYB u+as8Xhb4mLP7l29/+tn+tsQ6BE044oREArF+/Pt5j7JJCAXKrAIDiHwAADPseABYEaFZfrJi3j0NW2CsE0MaAxtp5 w5kf3UpOxf2nP/1p3ymgt+Gg0GiZgH5/uBRgeJcD9DEESPpjuAeFYQAQ7sRuM/72voUzVphp47esuwBEeScAiv+elw NkHXf7vIIAdfuEXQBqDbcA4Mtf/nJTADBhwoTG+1VZAtBJABBDGGABgMIde20wuv7r+r548eJG0Hz99df72X8FAGEX wA9+8IM4rxsFAoAk1XFGCAAAAEY8AEgHAZrNCV122WWZIYCK/bT0zE9WsZ+m31mOgV8ygkb2/z0dAFjRHwYBVvyfc8 45bsuWLf6Yafd3bQCnNeBqA7f13ir24hrMd9b2X6QJhIvS4BBg3333HRQA6K0Kf51/KijTAUCVQgDXRQAQUwig67k6 yGyfGF3zL7nkksY1Xr73ve95Kv7XrfvLhpE69hYGxLu8o1homJ0jJ1wzAADA8AcAWcsDwlBALboKA5YuXeruvPPOQT M+6eJfMz8a/IWyHlsFwIIFC0o0+Gu9Tr/ovgFFf6YMg/wwAGi1T0M406v7v+sWcNoELrzNmwoBtXzHNaPXz64MBvNF qLC/6aab/PmiAMCCAd0i0Ip/fV7Lkiq5KWBe0Z/ztbIHALpGhLcStY4vu+5rbwAd1/TyDn1eP6O3zzzzTJTdQ8UCgL ywd+Q6vwAAAAFAR6GANnaSW2+91d/nWbN5os/Zms80LS2YOHGiO/3009306dN9aGBrgv/u7/6uxIO/YgV+dxsLjny7 b6sAIF386x7wmunTW7sVnO3yLtrsTUVdXF0AnRX/WccryVnvjdYhwOc//3lf9Nv5ZUWiin/rOtJGk1W9aL9zR4DgQh 5RCJAVAIiWfYUBwBe+8AV34403eir2dUeA8PurHgAUeW3gmgEAAEoTABQNBdKbC9oMjwZ/hx9+uN9RXgGA3UFAIYC+ R8W/NofS98Qzc5y0ntkvOEAsQ7tvXgBgxb/ty3D8xIM9BQCPP/64GzjvGh8C6HhpXwjR+9rsTT+rlu/YA4CsuzNkH6 vgeLIMoOPlAenPKURS8ahW8v3226+WF/TYAgBbLqRrSboDQNd2o6BYrwu6/isIsLsHbNq0KcJj3WkHQNLmNYM9RgAA QEkDABv8idZvaiAndqsnbfhkM3qa9bEAIB0CWBeAXHHFFY1W4ChCgLffaX2bpyI7RQ+e/RuJECAMANLF/7N3X+Nee/ guHwCcdNJJ7umnn/ZdAOkCLr2Le8z7AOTdmrFVYRbj7dzKRhuLKgCYN2+ebycfM2ZMrYv/sgcAditZCwB0HQk3eFXn l137zzzzTP9a8NhjjzUK/4ceesg98cQTbp999nFjx46tVABQdE+RkbwNLAAAIADoaPZOA3S9VQignZ3tVk96X5s96W sWAGjwZwNAFZWaAQqXAoRtwLGEAM07OWeHAMUGiK7NDPPIBQD/eNMFPgDQ24eu/Yxf/68QQHSM1MKtmTvdCcLu724b uFUjAHAtA4BGm6+L/97uZekKULikAOD88893o0aNogOgxP+tukZYCJAVACjwFQsAVPTPnj3brVixonEHmbj3eeg9BO B5DwAAogsAwhBAt3kSCwA04FPbpwp/vR92A4QhgAUBMQYAWYV+0tUAceQDgLD41wZ/d154oi/+5fllN7jHl17mg4B5 x77XHXv4gW7r1q3+WFkAYPd4tyAgxgCgk3bcMOghBOgPnUsLFy70s8J1vaDHcv60CwC054u6vRQC2DKA448/3t1333 0V2eCxlwAAAAAgogDAQoBly5Y1hQAWBNitnWydp9o+NfOjwV+4JjR09913x7UMICMEGLwRXFJ4kJiMUCt5GACErf8q 8EVBgLoAZMWXznBnTnm3/7zW+6r1VyFA2AFgm0Jqp/c4QoBuZ+aaf6bVrd3QWQCw//771/qCHtN5YyFAVgCggNeWfO n7FPzqWl+dAKC7EIAAAAAARB8ApLsBwvs8axCoEEBtnxr4mZtvvrnhW9/6VuPn4wwAkowgYHBx2fruASMbAISz/+HX LQgwas0WCwBefPFFf7y+9KUvuRtuuMFTEKC13NrpvfzHstPZ//zghgAAddMqAFBnl4UAeksAQAAAAAAiDgCyugDWr1 8/6D7P1gVg6z1bsfXjMQ0Ok5z32633L8vsnwUAWcV/1vHW99otvBQAPPXUU/7zF198cYNu5SZ2m7cYAoDirf8dBABc oFCTEEABou7cYMW/QkC7rlsQIAoAFPomlVr/PjgEaL6OEwAAAIAKBgD29gc/+MGg+zxrt2cFAK0eR4W/isYZM2ZEGQ C03xQwKeXaXw3ew/b/dsdbRb9CAGMBgI7f5Zdf7r785S/74x7TbR2HIgDg4oS6dQFcd911vvjX837BggU+BNCtXsMQ oB4BQNb1nAAAAABUKACw4t8+p2UAdqsn0a2e2g34tAGgieoADJr5dy02BSxnAFCk+M8LAb773e82in2b+dctwuLp5O jmPtzZx5YQAHVfBmDXET33VfzrzjBhJ0BdAoDsji4CAAAAUKEOgPBz8swzz3ibNm2q9I7eSZtgoPPi0pU6AEiHAGEA YEs4RO3/cYQ5SZfHqE0AMAL7OQBluo7omqCC/4orrmgKAMI9X6oZAuQt6yIAAAAAFQgA8gZx9jXdJ37s2LE1PkhJ6Q OATor/MAAQu3tDeMztlo72/oEHHljiwX63x6f1YD4s/gkCUMcAIH1NELteWGAYW8dXr0FikhsOAAAARBAAoMYn3p9H srfccsug7g9bxmF7OuhuAHLbbbf5fSBa7QVRhe6PpMA/zh9UNQTICgCs0A9DQbs+VCcAcLmBYNZzn+sBAAAgAECUIU A6ALAlABrcn3322e6SSy5x8+bN8xYuXFj5e7wTAAAuMwRI04av1QoAursucI4AAAACAEQdCNjgXgGAbg127rnnuvPP P7/Se0Ew2AfaXxvS+NsAAAAQAKAig/3Ro0f7PSDGjBnjRo0aVcsnJ8U/AAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAA AgAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAAAAgAAAAAAAEAAAAAAAAAACAAAAAAAAAABAAAAAAAABAAAAAAA AIAAAAAAAAAAEACgno679Gv8HQAAAACAAABVL/7v3fL7wiGAvs/w9wMAAAAAAgBUtAPAAgM5asYFHn9DAAAAACAAQI W7BmTeym0EAQAAAABAAIAqhwCiwj8MAvjbAAAAAAABACoaBKj4txCAvQEAAAAAgAAAFS3+LQDoZDNBAAAAAAABACIM AGTPW44uAAAAAAAgAEDVlwAQAAAAAAAAAQAIAAAAAAAABACoQgDARoAAAAAAQACAChf/4V4A4ef4GwEAAAAAAQAicP zEgwsFAOnin7sBAAAAAAABACoQAiRJ4qXb/20fAAIAAAAAACAAQIQBgLHi/8v3rHL/9uv/HrQBoBX/LAEAAAAAAAIA ROhXT97vKQQIA4CDP3RCIwSg+AcAAACACgUAFHb1dM3JE9x5553nHn/8cR8C6DxIBwBVL/6Tt/9xPvT575rwNwUAAA BKFwCosMta200oUA8WAITngToBLAQwVX6SEQD017xj3+vZnhL8TQAAAIASdwBwy7f6mDDhL10AouOtToCJ5y9ohABV L+KS4B/nQ28euvYzDfddNsN3mFgQwN9n5HE9BwAAqGAA0I9ZW/2s1n4TAtQrBFDBZnsCWAggVS/gCAD6U/w/c+dV3r /cc60bGBhwJ510klfHAKBswVJepxcAAAAiDQCs6E+v2+52wGcDRj0OB6O6NMuvIt/uCKAQQGxjQNq4UbT437326/68 Ofnkk33h//TTT7vbbrutdudPkvpHBwAAAAD6GgBY4R/eus3u326f72awaI+XtUSg6mvD6xoCcGxp++5EeDtJFfp6+7 3vfa+xt8TAede4JaufaIQAOteY/QcAAAB6DACyOgDCMKCX5QThUoC67A5fxxAgffs/jm38xf9QbPB5zjnnuEsuucTN nz/f/fSnP3WTJ09uUKGvWX8FAHqr4n/Pf/3ef96CpvhDgKQFAgAAAACMwB4A6Y6Ablv5s4qIMHCgSKyWU045pWX3R/ UllQsBsjp7uj2uKuS3bNniQwAFAPL973/fXXrppU0hgFGxb8tK7HOxhwBJgRCgzOcD12wAAIAKBQBZLfzWBdDtUoCs PQXqXSRWm2Z3w0KxfkVDdWdue9ng084DFfF79uxpdAKIAoALLrigEQDYBpJW7O9ac7t76aEl7v/+8/JGMBD1xbllCF DeYx9293DdBgAAqFAAkC7STa+PaYNH7hJQTSrgrLhLnz/1ONZJUNxVe2lAJ4HgUTMuaAoCwxDgjjvuaAQA559/vv/a v/36vxt0Rwl97tV/utM9duvcSgQArUMAV/oQgCVcAAAAFe0ACJcD8EdF0WUAYiFA/bo94ijm+lEEFt3g0wIAfX727N mN71EIIAoB0kuDbF8JdQFYCPCv9/59Be4KkDSFALEFRnRvAQAAVLwDgD8mugkB1NqtEOC5556r4VKAd6q7pKIhQCcb fCoACJeEWKiY3oA0FAYBYQjA86tcx78fnWEAAAAoQQAAdMtau1UkWABQr2Uf73QAJBUuAotu8HnRRRc1LQPIkl4yEn 4+DAHYF6KcQQDXPQAAAAIA1LgDIGuGuF7LAKo/C1x0g08FQtYFEBb44f4i6TuP2OajtmdA3Lv/J5U/F1gOAAAAQACA mrcJWwFnHQCsG67uMW61wafdwi8MAazID+8yYo+X/lx4a0D+7uU6/vZWx4y/CQAAAAEAalwcpDeSpPiv/nrwViGPCv hWa/7tNnPsMh/X8zsMAwAAAEAAgJoXh8z81+dYtzvONpOf3i8gvTyA86Xc7f1ZHT78vQAAACIOAGi3Rb9bhYEwBNh3 330b15m8DQRRnll+OnwAAAAqHgDEu+kWAGCoAgA6fAAAACq4BMBCANH78459r8cfGACqX/wXWZJB8Q8AAFChPQDCHb jNQ9d+pkGBAMsFAKBaAUB4R4awyGeZBgAAQIUDAAsBJp5yQWNQmA4E+IMDQHU7AKwLoN2ygCImTpxY878vr5kAACCC ACC9SReFPwBUvwsgHQL0uub/lCNG8/cFAAAocwCQtRSAPzIAVL8LwJYBhPsBhF0AYTBcZOPYJbNPpAuA11AAAFD2AA AAUM9lAAoBLAiwboBwWYB1BUyePLltQFztACAhAAAAAAQAAIB4QwALAsIAIOwICPeG2fjtBXQAEAAAAAACAABAjCFA elPA8A4BFghY8f+tBZe4008/Pbf41x4AVQ8AEpcQAAAAAAIAAEDcQUBY/OttVgAwYcKE2hb/7QMAin8AAEAAAACIZD +AcNM/CwX0vgr8vABAhX9dWv+zA4CE4h8AABAAAADi6QBI3wJQhb8oBFAAYNLLACwkqNWLMOcNAAAgAAAAVI0FASr+ tRxg1Kgk8+v8rQAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAACAAAAAAAAAABAAAAAAAAAAAgAAAAAAAEAAAAAAAAAACA AAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAEADwRwAAAAAAgAAAAAAAAAAQAAAAAAAAAAIAAAAAAABAAAAAAAAA AAgAANTxopQkHn8LAAAAgAAAQMUDgD179tQ6BEgcAQgAAAAIAADUIADYvn07AQDnAgAAAAgAANQhBNi8eTMhAOcCAA AACAAAVHnNPwEAAQAAAAAIAACUvHjvx5r/dABQ9Y0Bs4p9AgAAAAAQAGDETJw40avrLu3J2/84F/5izJgxbteuXX0J ANJr/vW+Hvvoo49u+li/s4rnQ14AEH6+LuefXWdMXa8zXG8AAAABAEZ0UL53796G9evX1yoISDL+1TUA0vsTJox3S5 cudXPmzHGHHz6u72v+9Xbnzp2Nj/U79Lu2bt3qf3er/7bhKPiT/wnOhD8OTQjQVPz/Mfh9/5MMaRgx0udXeJ2RuoQA SYt/vAYBAAACAIzorJwoBLj++uvd5MmTaz04r8usbFiMqTB//fXXM2fthyIAsM+98sormaFT+r9vKI//ULXttwoA2j 1+7OeiriFhwV+3LoC6X18AAAABACIpCjVwVwhQ1ydPXQOAqVOnZhbo69at61sA8NJLLw16fC0V0O/O+u/T14YrAMg7 7sMRALT6fKznos4tXUvq2PJft2sJAAAgAEAE1HatAkzFl7X+12kfAGu7rusAXcc63QGQXv+v91977bWuzgt7vAkTJr QMAHbs2OEmTZqUGQBs3LhxSAvI4egAKPL4VQwAAAAAQACAktDGa1rvrZZvzfqqUNuwYYN/e8ghh9S7PfdPSW0CAC35 CAMAnQPpAv3nP/951wHAyy+/3BQAbNq0adDjb9myxU2ZMiUzAFi1ahUBAAEAAAAACADQS+GnQl8bsIUz/0Zf+9xnP+ MGBga8KgcAeV/77W9/W4viKwwBwg6AsG1/9+7dPXUAjB07tvHx888/P+g2gPqeY445ZlDxv2bNmmFpH08vAyhDAFCl 4l/HVgGPujys22j8+PG1XArQ6jwDAAAgAMCQFX2StdO7Pq8B+5NPPun3AZg2bVrjtm2V+zv8MSncHVDlcyHc9FHdH2 FB3msAoO6SsANg7dq1jfNJb5966in3yU/MGPSz+trixYuHPwD4U7GNAXsJANJ7Dihsqurs/8yZM5u6i3Q+qOtI3Udl uv3jSHUb8XoEAAAIAFAKKggfeeQRXxzWcUPAOg3U05s+qvtDAZA+v//++/v3jzzyyJ4DAD1GGAAoZFi9evWIB0zpYx x2f9i/P/3pTz0/th4jKwCo4vmlwt+K/6wuI3UfpfebqOyLcYcdSAAAAAQAGPJugDQVfqauT6K6DtK17EOBgAKgXgIA 2bZtW24AoLf6PWXrMMmaqSUAKG7RokW+uLdOkqwif9y4cZXddLRIeEjxDwAACAAwIjRI123etNO7NntTu7eo6LNlAB YE1GGwTrvuXwIALf2wY6+3Ohe6Pb8sAFChnxUAlO286ufxb1XwV/W80jFX94gtKyE8BAAAIABAyTsBNFsrKvwsEAjX iledZmvDGdt3BvT1GNRbca73FQLoHND7Bx98cEeP8+yzzzZ+Jiz+7XeUNVTKK9Q7LepaFfxVLRDnzp3bYMc4S/prdV oCQBcAAAAgAABQSrYMQO8fdNBB7sorr+woANDP6P0VK1ZEuaFkL7P2dZjxTxf+6gCwTiKzfPlyv+Gjuo1sM0C93bx5 c0NVgoCky39cawAAAAEASkEzuCriRn1slPexj32sli29YXdA3bpDrBtAx7+TAEC38rOiv4zr/buZySUAyKdiXyGAdR Dlzf5n2b59u9uzZ0/UIUA/7xgBAABAAIARo6JPNBOsok7rxOu6rreOA/UwANA5UDQEePDBB5sCgFiLu7xb+XUaAHAt KbYMib8HAAAAAQBKEgTMnz/fjTpqlDvqqKNq+eSqc0Gn7g8FQDoH2n2vzpEHHngg2ll/l7M3RLcBQJ1o40czduzYxv t1KfJp8wcAAAQAACpB3R8q7osEACtXrqxcsdfpEoA6nysKCau+5r/b/QC4lgAAAAIAANEUdu2+p8y7/A9HCECRN7i1 v2pr/vvVTQQAAEAAAABgzT8AAAAIAAAAAAAAIADgjwAAAAAAAAFAN3RvZ/64AAAAAADUIADYvXt31z+vn9XGYaLHiv EWcr1s2JTe/ZnNnwAAAAAApQkAFi1a5G/dpILd3vYSABxwwAG+8F++fHkUAUA/C/ay3AaKjbcAAAAAgACgycyZM33R P3ny5Mbs/5FHHum/NmHChI4eS8W+ft5+zkKA8HfFFAB0Wrxnzf6PZACgW2/pFlx5t+dqFxDo/u6i27zF+gTpx9+fLg 4AAAAAUQUAKvD37t075AGACn77OT2OPp41a5b/ePr06f53la0YHKoAIOvxhrOYtAJ/8+bNDfr7v/zyy/7tzp07vW3b tvmPn332WW/NmjXuwQcfdA888IBbuXJl9F0ESY//uNgAAAAAiCYAmDhxoi/+VeRnFf/HHHOM/1gzvQoArOBTId9JC7 9+7qmnnhoUANiSgtmzZ/vfNzAw0PRz+vxwFYDtiv9eC/ZuAoChLjLD2X4dGxk7dmzjfXPwwQe7gw46yJ8HpmpLCCj+ AZYjAQAA1CIA0Fv7nIp+FePhwExvwwBARaJ9T9GB3rp16xoBgD2etZDb78xaCpD+7xvqAKBIMd6vAKDIkoBeC04G2Q CGm2342mqJkZYhaTlSFa9NRa7bhIkAAGBYA4Cs4l+mTJniNmzY0DQo0/uasQ87ANQi3kkAoAJfwUFWoGADwrDroN1/ 51DN/g9nAFBkQNjrrHMna/5D6tIQhTRr1651K1ascNdff71XhzX/f/rTnzxm/4HidF03es1Q55fCX13bJVx2VMVgki 4iAAAQXQAwadKkQbP71sIfBgCddgDo+8MOgDBQsM8peFAAUfS/tQ4BQL9CgKw1/7bW/6WXXvI2bdrknn/+eV/wh6rS +p/04R8XGKD1zL/u9pJeRmRLi6rekcT1AwAARBcATJ06ddDsvrXwhzP2NoNTtAANvz/9eGFIoACi7AFAN+vzi/z8UA UAWcsBrJjPEhb8se703+nxaDWI56ICdNb6X9flSlwzAABAdAGABl+vv/56ZnHezwAgq8sg/XtHIgBoVZwPRwDQ6X8r AJSFNnZVd5dCAFtGVHTZUVX2BOj2Ws01HgAADGkAYIV1uqgeP368W7p0qZszZ44bN25cozgPuwL6EQCEj6ffo9+n36 vfX+S/c6gGanmzv0MZALSbce73wNAG3IcfPi7za5r1114Mle8C+GP7wIVBOdB5B4BCABPuCWD7Aej6X8U9AVheBAAA Sh0A5BkzZkzTDL0KwKwZe9tYrl2xmf4+6wCwwtI+1u8t4wxOr7fpK1LUD+cg0P7eCl2yZuK038Pq1asbm/7VbZduBu ZA72bNmuU7AvKWG6U/X+kX5A6XIQEAAAxrABDOEufN+Nvu8kUCgPT3ZXUElH0AOBQBwEj+/yhs2bp1q3vllVd8QLNj xw63ZcsWHwx88hMzKrHpX7czdb/97W8p/gEAAADUJwBo1cKfFRIUCRLaPV6MszhlebxuTJgw3h8DbfyozRd1B4b0bR gr/UT5n4QZf2AIzJw5002fPt3Nnj3bX1PS13ot+6rDzH+v3WMAAAClCgDK8ngEAABQLuomMun2fy0/6uRWslUMAHgN AAAApQ0AOlnzP1yPE3MIwMAPQB0MDAz4bgAV+xs2bPBvdbcXbfhalj1fRnLJEecIAAAodQDQj1s09etxCAAAIA5aBq AlRlpqpGt/1t1e6hIA8BoAAACiCACKrvkfjsfA0NHtFqt6279OBuqcCwAAAABqHQCgesV+2po1a9zixYtr3ZZLAAAA AACAAACVCwD27t3r92TYuHGjW7VqVSMIIADg/AB6pbsA1P7FmPMAAAAQAKCsXQB1bfmn8AeGhkLGOl5bWFYEAAAIAA AAtew0qmvYSJcRAAAgAAAA1C4EMHXrCCAAAAAABAAAgFouN6rzUgCKfwAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAE AAAAAAAAgAAAAAAAAAAQAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAACAAIA/AgAAAA AABAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAAAAAAAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAgAAAAAAA AAAQAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAFA6hxxyiFfbv8E7V1wAAACAAABAtQOAjR s31jcEaL7qAgAAAAQAwOTJk736/g2St1UvAHjzzTfdD3/4w3qGAIOvvMhx2GGHeVwDOBcAAAABAGoQAOzdu7fGIUDi x/5VKwAIAAgAOnn+1zcAqObzHwAAEAAAmYP/1atX1zgASCpdAFgIsHz5ckKAiocABx54oFfbEKCnY0wIAAAAIgsAbP DX7QCQ9b4EAAQA1Q0AdIxrGQJkX4ErGwDs3r27q9cBCwDmz58fbwjQ03EOrwG8hgAAgEgCAA3+bADITB8nWicBwM6d OwkAKr4PQC1DgPyrcGUDgBtvvNHdf//9Hb0OWACgcyTaEKCn45wOAHgNAQAAESwB0IBPg79wFqhWYUCNBvv9Kv4XLV pU4w6ApPIBACFAXmFY7RBgyZIlHYUAFgDoejBr1ix39tln1ywEyAoAeO0AAAARBAAa9GnwZ90AteoIaP1XR2rAf9ZZ Z9U4AEhqHQDU6ljXKADoNgQIA4AZM2bEGwB0HQIQAAAAgAgDgHQI8OMf/9jrdl1o5UKACgUBKupCvQQAUYYAPR/XpD YhgM4PLfGobQiQey2odheArv233367e/TRR1te+8P2f10LLrzwQnfqqae6L37xi9XpAmh5jcgr/gkBAABABAFAGAJo 8Ke3GgDu2LHDvfDCC+7QQw8lBKhIUbdx40Zf1EmnYYAG/eeff75buHBhNQKALlp+6xoA1C4EaHmuJJUOAHT9/+pXv+ o2bdqUGwKHAYCuB5deemk1A4Dc6wMBAAAAiDwAsEGgCn8N/sSCAAsBKt8NUOxIRF/YWUFnQUA6DMgLBCwAuOGGG9wd d9xRvRCg7XFOat8FICr2CAGqGwLYa4CFwcuWLWu69ofFv64Duh7onNASgGgDgI5CgHbFPwEAAACIJACwQaBmfjT4u/ nmm/0AcOXKlf5zGzZsIASoSAggms3VID4MA1TwSVYQUIkAoJMQYNCxrncAULsQoO25Uc0QQJ1fuu7r+n/NNde4m266 yd15553+awqCKxsAFL7+EwAAAIAKBQDhcgAN/sIQ4Ec/+pH72c9+RghQoSUBYQjQKgjQoF8bfR133HHuU5/6lJs3b1 5mCJDENPgtONgvouohwC9/+ctBSwHq0QlQrxBA13Z1fKkLIAwB5N5773Xf+MY3/PdYEJQOAC677DIfACSx/l0KfiMB AAAAqFwAoLZPzfyEIYAGgPfdd5977rnn/EyQqWUA8PYgMKlQCNAqCFChFy4R0Mca9OeFAKFqLAloHwxUMQSwAODVV1 /1+0fY+WEBQPVDgKIhUXX+n3VNVwig0NdCgKuvvtpdeeWV7tprr/WvC3qN0HM/HQCEXQBHHHFEpa//dQsDAQBAhQMA CwHU9qkAQIM/rQn95je/6QMAbfo0d+5c98lPftIvCyAEqEYIkO4GEM38qvjbvn37IB/96Ef9wD8dAOxe+3V3yhGj3c DAgH+MyoQAbQqA9MA/eftfzOeGjqfoeL/xxhtNAUA6BCgiygAg6b4YjHVmWNd0LfuyEEDX/yuuuMJdddVV/tr/2c9+ 1n3gAx9w73nPexrngAUAl19+uQ8ATj/9dK9uIYBdB6rw/AcAADUKACwE0Ky/Zn5s8Kfi3wIAQoBqhQAq0LK6ATTzq+ JPYYA888wz7utf/7r7wx/+4FkQEIYAf/z37T4AeOihhyJpB+78IL7zI9khQGwFQFbBrmUfOjcUAOjYWxeABQC33HJL Uwhg7+cpdyiQU7T3OCMcYyiga7+u61r2pdcAhb+6/oteD3TtP+OMM9zJJ5/cCAH0WhAuA1Dxr/BYy4YqGwC49gEAIQ AAAIgmAFBRrzWfavu0wZ/RAPC8887zwhCgUksDOiwGq7BPQF4IYEGAugHuuusuX/i/733v87RUIAwBtmzZ4h/nO9/5 jvv84mXu5f/4fxGtCe6s+G8VAsRW/J911lmeNno0Kt7CAEDHX8fXAoAFCxa4OXPm+GM/bdq0RqGva0ZR5QgCkhEMAM oZBCgE0J4v6vqyzq/09f/cc89thAB6HZClS5f6AOCiiy5y07640D//xx4xUJsQIMbnPwAAIABoDMo1CNSaTw34NPNj g78wALAQQINEFf66lZSkA4G4QoHuZoTzZoZjagG2mdysEEDFnwKA3/3ud774/+WS9/u3e/bs8SFAGADMnz/ffeELX3 BXffv7fia5SiFAI/AJjnmrFuAyFgPhLLyWcRgVelrXLdrw0QIAdX7o2IsFBBdffLEPAFQIzpw5s6kLwAr88LHTdL7Y 9wx/V0DBwtwNZwhQruuErv/a88U6v9LXfy0F0Kz/Bz/4wUYIoKVj1gGgAOmw42a5937ohDj3BOji2LMEAAAAlDIAyB tk2wBcrdx2qycNAjXQs4Ffuvi3mcNjjz3WD/K0CdRXvvKVRhBgrD28HG2/ScuioGn83+Xa8OxaIo4gwAo5m+kNqfDT rL91AIiK/xdffNG3Beuc2bVrl38MLQNQCKAAYNea2ysTAmSdF61CgDIVAvYctIAnZIW5bfCmuz3YHgC27EPhj20Sed ppp/lCTyGAKAQ4+uijmzaIzCv87RqTNvTXhy4K8rzOjx5CgPxfVa7niILb8NofXv/1uqBr/6mnnupfJxQEKAT42te+ 5kMAPf8VAqgDQM9/QgAAAIARCAA0MAuL8VBY+Ie3etKGTyruwsJfgz8bAJ5yyik+AJg0aZI7/vjj/SBQIUC6wAgH+V kD/eEJB/Jv45Q7e9+nWcD2QUBSuhAgHQRkBQAWAmzevLkRAlgngN0N4KoTj3BbH7y5EiFAXvGXFQKUMdwJC27t8p9+ 3odBgI6/jm247CNc/mFLQHTc9b1hAJAOAcLrwMhtFNiu+G7z3M3aB6LDAKD173KlCwB0PU8Hv+H1Py8A0M9OfPc+np 7/Md4esKMQOOtcYQADAADKEABYCJAWFv0htXdqradafW3gZ4O/vABAg0QrIO1x8oKAMIAYrhnATguAfrYB5/2+pMQh gDZ805pvtX1r5leFny0BsABAe0boXEgHANpJPJpbA3YSAmQUhHkbApa1/b9VABiGABYAhMfc3g9DAAsA7GezZv1Hvh Oos+dl89dc8z4f6UCopwDQlTIA0B4vdk1Pz/6r6yMdANx6662NAEDPdwUAm+//X9EGAIVDAAIAAABQ5j0ANEDTOu1w xi+9BthoQG8hgNZ8WuGvwZ8NANMBwIUXXtgoHou2ApdyDXCnIUAHj5cVQJTtjgJhCGCt3mr7zusC0H4A+l59XT9rxb /OicMPP9ydc845lQgB2nUBpI9n4sq/F0RWEGDPVR3brGNudNzV7m2dAGEAkJ71L/veHy0DupaBUNFZ/7hegNIhgF3/ wwDgXe96VyMAUKeQXl90G8Ew+IsxAOgoBEgvAWDwAgAAyhQAhCHArFmz/DrtsGjPohBAgzwN+NLCAaCoW0Ba7QyuWa TrrruusQlYWWYCuw4BKrYTeFYIoGOqECAsCPW+PPDAA+6tt95qbCJoIYDe1+BfAYCOu4UA8RQFxUKAdOE4uBBIoigC wyDAugFsKYBt+JgOfnSsFQC0K/7jOOb5rfpFln9UqfjPCgGs60uyrv8K/fTaovPCQgCFx1LpECDjeA9+7jOgAQAAIx gAWAigWX2xwZx9HLLCXiGA2j2NBn7h4E+DPLWIq7j/9Kc/7QeLemsDwJBmk/T7y9gO3HEIUNHiPywIdas3zfgpANBM rxWEKv60/l8Fgc0Aq/D7xS9+4X/uc5/7XCMEUADw05/+1K1YscJ/XudM+cOA/GPfaglJ60IgjuAn7AawEEAbPlroE+ 7/oOMfbgBoP6vjqsfavfbr7pk7r4oq+Mm91WOBAKD5lIm/+FMIoLu9qNsrlL7+hwGAzgkLAfT1j3/84/F2BLTo/Gm1 xwMhAAAAKFUAEO4LoB38Q5dddllmCKDBXpoN/vKE60eNfmfpCrxhV/4TMOwA0PsKAfS+in3N+ooVfzYDrDs/KASyAO CFF17wu4DffffdjQ4Qfa82FVRIpPNHXytnUdAiACq43ju9NCB/prhMs55JZjeAjrsKfu35YJ0fdvxtyYDN+luhp8L/ j7943v3LPde6a06e4G677bZ4uj9yirrw1p+d7ucR4+7wdjtXPY+13Mukr/+2CeBHPvIRHxCEIYDOF32vvaZEFQYU7P zKPx9clNd/AABQwQAgHQSEFARcfvnlPgxYunSpv8+zBQGhsNhfvHixu+SSS5pkPfZFF11UsoFf+3X6SYHAoOjPxFIE hAGA7fRubMY/LP5++MMfNgrH0aNH+wBAFAroeP/qV79qBAA6B7SsQF0iWoby6KOPlrAY6Hxvh1YFfmwhgGbudSy1sa NYCKDCTh0gWvYRrv234x8Wdw9d+xlf/OvWcCeddJIX214Qed0A2TO+Se7FPNbbw6n413NYrwna68Wkr//f/va3/fXd OgROOOGERgCgZUC2d4woBLDlYqUPAwrs9dB5AEAYAAAARjAAyBr8ZxXumuER7fasDZ/U8in6nA3+0mxgpw3kVASo8F MXwMB515S8EChW4LcPCAYXALEFAFa0p4VrvtPF39q1a/3aYRUO//mf/9n4/G9+8xu/F4DOA71V4W/Ff8wBQLr4y2se yC8kyxcAnHLEaPfHf9/eCHV27drVtDdAeB7Y8Vdh97d/+7dNd4DQzL8K/6effjqiDoBiewPkdgqknuNVCAB0i9d0AK xlXxb+2t4y119/vQ+JwgBAz3WFAJIu/JctW+bFHAAkOWFR6/Avtc8AAAAgABjJX652TxXtomJNb7MK/JAGfxrETZ8+ 3dNgL5zdUQBw6EdnusNP+Zzb81+/L30L6OCivf0twwYXjvG2/4YBgKTv8R6u+bbiT+w2YCG1DOut1g1r7wCbVY5mD4 COZ/6zHssNCpJKe+6//XyV73znO/65HXYD6BhaGKDi0MIfHf+/+qu/cm+88Ubj2H7ve9/zod/jjz8eQfBX7Pmfd+vH rAAg5uI/KwTQsdTGsXZ7WAUA1u0VHvNwCYBeC77whS+4m266yb+v68H69esbhX8MG0QWC4CaC/6kRScJhT8AAChVAC Aq+q+++mo37YsL/XpvX8C/vR5UAzvbEMzWfGrmRwM5vVUAoPfHjh3bCAQaQcCfiwDZ8r9viiIAaHq/zeZfgzd9irfV Mx0AWNEfBgHhmm/N/Kr427hxo2/91+dsfX+4djgMBiZMmNB4X5tLln1pSOuB/zvFX+O86SAUKlOBqOOgWf2HHnrIfX 7xMl+86flv3QCiEEAbPtqeD/oZXRvC4y+a9VfRqLdLVj/hxRACZD7/czqCmgIeV90AIOz+sCU8YQCg67y9Dug1Yt26 dY0AwJ7/6g7ZtGlTdHcE6aQDZPDMfkLhDwAAyh8AiAr/l//j/7nDjpvl35/47n0agzYN8DTLY2s+9b5mfuzrGvSdeO KJbuLEiU0hwNqFsz0FADGEAHkFWusQwEW/3jMMAGzWP2S3erPjrYG9Zn6t+NPxV+uvzfRr8L99+3b/dvbs2e6uu+7y n9f3a2bR2B0m4gkA8gq9JHMWcFB7cM6/MoQAouf/Vd/+vg8BwmMdhgHa80HLPux42vFXYRh2AGk5gHX/RHlBLvDcTx //WDuA2gUAoo080wFAGPbaefDXf/3XbsqUKZ4FAT/5yU8adwmoTgdA1nW+9bUj5vMCAABUMACQsUcMuPd+6AT/VgFA Vgig9Z6SbvvU53SLQYUAn/jEJ5oGhxYC6G3M94nufOOn+AOAdPGfZsWfKATQpnFZIYBuLafP6/vmzZvn6Q4B+++/f+ kDgKSDn+0mBChTN4A2ahQr/vVW54Bt9Cja8yF9/LV0QOePPrfwE3/jtq38qg8BJKZbwqW7AfL2c8g/d+J+MQoDAOv+ 0bUh3QFgy75svb9CIz3X1eljHWOiz2k5gL73iiuu8Mq+J0zxAKCTfSNc9N0hAACgggGA7Qmwa83t7qoTj3Cb7/9ffr CmgZ+FACFr+9TgT4NA7RRuIYAGjFpaEHYDZBWQcRyk5lbP9Nru9jtHxxkAWPFvs7+61Zt2ew+PnxV/Jh0CWACwc+dO /zm1kaulWMX/PvvsU/olAEnGDG+7n81rB85eb16+PQHs+R/O2upc0K0ew7s9aNmHjredAz/96U8bIYDuCKDHeemhJf 5jXRtifO6HIUB6vXe7DUGz94YofwBgt4S0AEDH1G71Gq7/17IvdX4p/LUQ4MYbb/TP+XQI8IMf/KDxcx/+8IdLvR9I 8et54trdMSKvg4iBDwAABACubCFAOFDX4M8KgawZYA3wwhBAFAKobVQsBNBb21Va31ve+8LnFXn5Xys2aOxkZnn4Q4 AwAEgX/7pVXHifdy0BsZ3e9XMq/lQEpjsBVPCr3T/sAhgzZowbNWpUSY9xseI/awlApyFAebtdErf1wZubZnj1vq4L 6bs9aNmHjrcFQN///vf95xUgbF91q3v1n+50j906txECKBTU8/+WW26J8LmftL3bQ+tCv5zP/axrgYUArQIAXc91nV foq2Nr50o6BND71i2mY/+Zz3ymsSdInCFAkZb/pG0AyOAHAAACgFIXBB//+Mf9YM7We9tgT2s+NZjToC8MANIhgD4O 7xrwrW99K8IugHYDvMR1tqN8HAGAjpFm/8P7vKsYEDuG+lkVf+kAQPcCV/Evzz33XFR3Asi633v+DH7xACCOJS9J47 ZutjmkBXZhd4fe17G2TgBRN4ndXlBv//Xev2/cItSWGMQXAOS1/ncSAlQjANBxDO8CE4YAFgRo+Ui4Iag2mUxvCKru Ab0f3TKAFsFf7u0is7pKCAIAACAAKHtBoNkbFXThmk9t9mSzPBYCnHnmmZ7e12AynB2Sm2++ObLiv78hQFLSQb8FAG HxHxaD4X3edas3dQAoENCab/se2zRMBeGjjz7qP2cBwMMPPxxNAJDktG23X8OfHwLEuCO4hQDW3v+rX/2qZQggOv4X XHBBUwhg+wt897vfjajzp98hQDw7w1sIkBUA2G0jLQTQni8KASwAsGv/P/zDP/iv2+vDM8880wgAVPxrOUk5A4DWIU C77p92IUDZlwEBAAACgEYhoHt/WwCgjZ3CAMAGeZr5sWUBum2gFf333XefL/yt+NcAsGoBQLvPN+0bULKBXxgAhK3/ 4fFXwa8AwBf+513jb/OmUEAbvqk7wNaNq/hTIbh169ZGAFDu2X9XqPW/+KB9cAAQ8+3AdNxWrFjR6AT4zW9+4+/eEG 70aCFAGARonwd1/zz11FOeiv/49v9ofX4kGXuEtHvuu8gDgIsuusgd+tGZTUsBtOeLhQAKAHROPPbYY01dABYA6Nov CoRiDQCK7CFCAAAAACoTAGgTt7DNM73hk2Z+NPhT0W/S94SPPQAoWuxnDfzLOPCzACA9+5/VFm4UAOhWbwoBtOGb1n zbjK+KPwUAKhSffPJJv1a8HDv+d1Lg9aeAGHwP+fgCAM3Wht0db7755qC7Pdh5oc4PHXuxfR+MriGi2wnG/9x3medL ked+DIWfrgG6Hmgfj7D41/uHn/I5HwLa5q5aFqCwRyGAXhsU/uq6r+BI7f9PPPGE27Rpk9tvv/0iCoEyivjcY1f0dY CCHwAARBIAhCGAAgAN+DWgs9mdMADQjJDeavCnAtAGe7b5U7wBQLEugLxCsuwzPxYC5AUAeYGAAgDt9q4N36ztW8VA uviLYcDf/wCgAheot5f/KNRRASgKdKy7w64BKhQVENqxtue+PYY2g9QeAfo+FYJVCQBabxLnonn+53UBXHfddb74t+ Oowl/BXxgA6Jpv+73o56zrS+eAnQe664fuHBDTMW9/F5Aie4gkg5aMAAAAAoBoCgEV/3q7fv16//YnP/lJYzlAGAbY xk8a/Nm9n8PNn+IOAFzTrcDaLQcYdF/xEgcA4RKATs4L0W7vtuGbWr5j7fDoRwCQVO0i9ef/IRV3ev6rA8ACgLvuuq uxx4Pd7cGo88POgQMPPNB/fd68ef4xdCeI+MM/V+j+78X2jij3MoD0ciB/B4j/fZOXDgFszxfr/LLrf4zHO+mocE9y W/4Z6AAAgOgDgGXLljXN7Oo+z7rVk4p+CwLU9hnO/Frxr3Zirf+sQgCQ1fbbatO3shcANujvNABI3+fdAgBR8RfT3R 66CwCS3ACgCgWAdQForbdt7miBnjo9du7c2VT8a88HCwnCDgAFAOokKN9tIDsNiIJALyMIaNf+H1MA0Go5UDoESBf/ ce730Mu1IKlU9w8AAKh5AGADv7D4V1FgMzxGmz2Jlgio7TP8eVsCUN7Nnzqb3c0azLda81nFACAMAexWb7bhm4o+Y+ 3A1QwAnCuy4VesYYCOpXbv17G1AMD2BrD3FQSo8Le7PWjPh7D407FX8Z++JsT1vE9yw53B6/7jeu53cx3Q8Q07AOw2 r7bZqy37irEbqNviP+v5z0AHAABUIgCwjy0AUBgQBgFa5xvXms/u2rvTLf6DB4Tx/L+ld//v5LxIF//aL0JrvjXraz O/5d4IsNdj1r74j7kYsA3+8tb1t5vxVQBQ/uPf+XO/6HGN7fgXvRaEYXA6AAiXfcUX+nY6k5/f/k8QAAAAog4AkkHt zon78Ic/XJFN/ro/iHW+vZMVAAoA7D7vCgBUGGrZSMwzv/0MAKpwnKu1rp/nfD+f/+ni314L1CkSc9cXz38AAFDbAK DVALAam/z1eCBrOtujY33LLbd4ViTqVm/qAlFhGOea785nh5OI13x3c8zjX9ff3xCgzgGAiv9vfetbTa8BRsFgHQKA qnb/AAAAAoDcQWD8m/z1ryCoYxGQcJurWol9XT/P9/7uEZG+7Wf8GwF2vzwEAACg8gGAVGGTPwoCoHgAEPu6/n483z kXCAABAABqGQAAAAAAAAACAAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAAAQAAAAAAAA AAIAAAAAAABAAAAAAAAAAAgAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAAAAgAAAAAAAEAAAAAAAA AACAAAAAAAAAABAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAGA4HTXjggb+HgAAAAAIAIAKBwDzVm7zCAEA AAAAEAAAFQ4A7t3yewIAAAAAAAQA/BFQZcdd+jVf/CsEIAAAAAAAQAAA1CAA0Ft9zN8FAAAAAAEAUNHif89bzr8lAA AAAABAAADUIACgCwCI+znN8xcAAIAAAGgbAFD8A9V4ThMEAAAAEAAAmbOFCgCY/QeqFQLwfAYAACAAAAbNFFrxT8EA VOf5bcEez2kAAICSBgAM1DCkJ3OSeK3a/zkHgbiFz2ULAnheAwAAlCgAsIGazcLyh8dQFP9fvmeV+7df//eg4p8NAI FqdgGEry/8TQAAAEoQAISFvxVl/OExlAHAwR86gQAAqEkIwAafAAAAJQsAQvzRMRRU9IcBQLoLgPMPqG4AwDIAAACA Eu4BAAzFzL8Kfpl4/gIfAqS7TigMgOoGAOwDAAAAQACAGgUAouLf3loIwKw/UK8ggL8FAAAAAQBqGAaoIyC8KwCA6h b+tsyHvwkAAAABAGoYBKgLQAgAAAAAAIAAADUJA/g7AAAAAAABAAAAAAAABABVXCvKQQdG9nnI3wEAAAAgABiyQiO8 LRwFCDByz0megwAAAEBNA4B+r89uVWBwr2igHAFAtyEAz10AAACADoC2BQa3igLiXYpjP0P3AAAAAEAAMKj4b9UFwF 4AQBxBwFEzLvAIAAAAAICKBwATT7mgqwBAbf6tCgUCAKB8+wHo/fTXVfzb9xRZPqAlRXLwh07w7GNuBRl/FwgAAABq EAB0OnAPQ4D0AJNlABQTKG8IkHUMLQAo0gWga8WX71nVoABg4vkLmoIA/ublXaYFAACAmgYAKvxD3YQAFgCE7HMEAN Uq/Ckm4i8G8zbntAAgPL7tOnv+7df/7an4t24AAoC4lmoBAACgJgGABukq+q1g7yYACIsBPUa4JIDZ4moWEe2WfaDc xzIMAMLnqQUA6YAgHe6lgyAV/eoCsBCA4p8AAAAAACUNANID+14G7+nH4oBXq208HQJwm8f4QwB16IRdOumAJ13sh+ dAVgiQ3hOAv3f5Oz8AAABQoyUA4cZdDNiRV0DkzQRTUMS/pCMMc8IuAAsC7H37nvTXwxAgvRSAv3V5Ap9uurMszOHv CAAAUJEAAOhXOzniDQKylgFYd4CExWP4NftcuClguBkgf+NydQBkdW+0CwAs0CEwBgAAIAAAAQABQIW7A9LFYqsAgJ n/OPYCSHd2pG8JGRb/CnMs0Gn6/Nt7x3CsAQAACABQ4SUAefsD8HeqdndAGASkOwLSS4r425U7BLDjFx7HvGMfbu6o z9vdYvqxZwwAAAABAFDSoiG9Zjh9+0f+VtWfObZjnnU+IK5jad0b1gWQ/l77eri5o31NAYA99wkAAAAACABQ0fXD4W 7xbAJYv06A9PuIe3lHXgePnucq/O17bSmALe8IuwAIAAAAAAgAUOFWcJO+fRyAOJ/TFu6lAx67A0C4DIBNAAEAAAgA UOMwgL8JEP+SgFZ7eYR3AQAAAAABAAAg8kCPvwcAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAEAAAAAAAAAACAAAAAA AAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAAAIA/ggAAAAAABAAAAAAAAAAAgAA AAAAAEAAAAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAAACAAAARtjEiROb1PEFOvzHOQ EAAAgAEPXAPkkSr64De84FIP/6sHfv3iZ1CQGSFv84PwAAAAEAohvch4P69evX1yoIYFAP5Js8eXJTwV+3LoCkzT/O EQAAQACAqNt6RSHA9ddf7wf/DPAr/v/fY9hT166RulDhr+tAHVv+09cHzgcAAEAAgMqGAhr0KwRg0O9qEQL08rN79u ypdQhAcQgAAAACAJTa6PGjfdE2derUxixuXdf/1/7C02MAsH37dgIArikAAAAgAEAZjRkzxi1dutS9/vrrbufOnW7X rl1uw4YN/u2oQ0bVuu2f86O7EGDz5s2EADX4/zzmmGPclClT3KRJkxrh4fjx42vZHWTHnOsGAAAgAECpizUV+nPmzG ma+Tf62vvPfL8bGBjwqjyIb1XI1TkQaFXIZ3WKEADUowicOXNmU1io8FAhosJEhYp1Dg4JAQAAAAEASlvcyb7j9s38 mmb4nnzySb/+f9q0ae7oo4+u7fr/qg3siy7zaBcApNf8pwOAqi8nyTonqlwAqvC34j8rNFSYaF+r+jWh00ARAACAAA Clpw0AH3nkER8C1HEjwCoGAJqh7UeRlrXm3zpHLCyyj8s0K9zPY5kXAISfr8q5s2jRIn8sReFg1vkzbty4yoY+Ra4F FP8AAIAAAFHNCKftv//+DXV9Ilap+NeGj2rT1kxtVudHr2v+9Vbt4Paxfod+19atW/3vrloAkFX0ZX1chfNHhb8CwT rcErQO1wIAAEAAgBrT4H7dunXutddecz//+c/d7t27PS0BsGUAFgTUYXavqut7dey0Vjtr1n4oAgD73CuvvFKa86bf bfvtAoCqzAzPnTu3QR0eeaFh+mt16wYiIAAAAAQAKEXh100nwD5H7uMpBLBAgKUAcQ3wJ06c6Ol97daeVaAr/OlXAP DSSy8NenwtFdDvbvXfNhwz/nnHbzgCgE4+X8bCXyGRBYNm+fLl7qmnnvLnj20GqLc6J0zsQUDS4z9efwAAAAEARrTF n79Hfai43rt3b6PIttn+dIGuzo9uzg17vAkTJrQMAHbs2OFvF9fuv2842raHIgAo8vitPl/2QlHFvkKAI4880sub/c +i8Ce9WWSdAkCCAAAAQACAKB188MHuoIMOcqM+Nsrb92Oja/ekjHH2Px0A6NZt6QJdyz66DQBefvnlpgBg06ZNgx5/ y5Yt/p7xWf99KhAJAKpbIBI+AgAAEAAgUldeeaWnpQBr1qxxAwMDtV4KUPbCTUVXXgdA2LavGd5eOgDGjh3b+Pj555 8fdBtA2zk+KwDYuHHjkC4DIADoHwU9Rsfc3q9LkU+bPwAAIABAbYOA+fPnu1FHjXJHHXVUbfcE6LV4HI4AYP369U0F 9qhDRjUV5L0GAFr3HXYArF27tnEbQL3VGvFDTz00t0Nh1apVwxoAFC3aewkA2u05EHsHgJ7zVV3z3+u+ALw+AAAAAg CUti2Xv0U9jnU6BHj/me/3XRy6pZvu7KD3tdljrwGAHiMMABQyrF69uvFxuvhXF8lQbwLYLgTotXArEgBUsf2/ymv+ 67ZUCAAA1DQA0CZPtf+jc/KhggGA7twQ3r9dSzf0uUceeaSnAEC2bduWGwDorX5PVgCgzy1evHhEAoB+ztzWNQBgzT 8AAEAFAgC1Anf78/pZtYaKHiu21vB+FQK0g6JsVPyHt29UADBt2jT/OQUAeqsQoJvHDu8CoKI+KwAY6WKwSADQ7fO1 VcHPdQAAAADDHgBo8K+NwLK+tmjRIj+At/s899IFoADggAMO8IW/7g9dlgCg1SB8KGYCCQAQAyvO9b5CAAv/dLeHTh 7n2WefbfxMWPzb7yjrTHBeod7Lbd76ubcAAAAACAA6ZrcBC9t/zcyZM33Rr6/Z7L/u8ayv2YxeUSr29fP2cxYChL8r 6+dmz549LIP8di24WTN3vfyeooUABQLKwJYB6H3d6lGbPHYSAOhn9P6KFSsy2/1j6v7pNLxjxh8AAAClCwCy1tn2Ow BQwW8/p8fRx7NmzfIfT58+3f+urJ/N+++rQgBQpDCgaEAZ1m1bN8Coj43qKADQRn5W9Oet94/mottFMEcAAAAAgFIE AEWKf7sVmAbt4a3AVMh30sKvn9PtvtIBgC0p0Ey/fl/WfeNb/XcOR/Hfao3wcKwFZskAyiAMANQNUDQEePDBB5sCgF g3f+v2+R/LLSEBAABQ0wBARb+K8XCn5vS9wMeOHdv4nqIBwLp165ruB67HC28HpsfLWwowFCFAXmHdKhToVwDQLhAY 6RCAnbqRZ9+Pjfaz+vPnz2/7vaOOGuUeeOCBaGf9iz6X+/W9AAAAwLAHAFOmTHEbNmxoKv70vmbsww4A3d+7kwBABb 6Cg6xAwYrNsOugDgFA0WJhJAIA3atb9+zOu593u4BAxZ/E3PLdj793FYs/dero2BYJAFauXFm5IKnTJQC8aAEAAKC0 AcCkSZMGze5bC38YAHTaARDeDiwdKNjnFDwogCAAGPllAFbgb968uUHH8OWXX/ZvFQCJ7vOuj7XZm2h2WG3fmvmtQv GX9PivqhehIkuAyrzL/3CEABT/dBcBAACUJgCwwjpdVE+dOnXQ7L618Icz9ioIOwkAwu9PP14YEiiAKPLfOVSzvEUC gG4G90V+vl0AMNIDdgU4ok4Oe9/oVm/a7V1Fn6nizC/FP5AfCkmrjiF1Fam7qIoBQJHnPdcGAAAwogFAXsH3+uuvZx bn/QwAsroM0r+3TLN7wxUAMCsHICZazmXU2aVuMQW8usZL2EVUxesMoSAAAIg6ABg/frxbunSpmzNnjhs3blyjQAy7 AvoRAISPp9+j36ffq99fpsHccAQAIz1I7GTNf2ifI/fxNNu/du1af5937fRuO8bXZc0/A33Ufeb/gAMOGNQVZJ1CVQ 8YKfoBAEDUAYCMGTOmaYZeBV7WjL0VjO2Ky/T3WQeAbRBnH+v3lrEYLLosoNOOgl73FRiONf+21v+ll17yNm3a5J5/ /nlf8Ieq0vqf9OEfFynUsfW/rt1HPO8BAED0AUA4MMub8bdZ4yIBQPr7sjoCyj4AHIoAoJT/n8GA3Ir5LGHBX7XbvB U5RhT9wF/MnTvXt/4rBDjyyCO9ol1EVdgToJcQkOsHAAAoTQDQqoU/KyQoEiS0e7xYi8EyPB4AjGQHgEIAE+4JYPsB qJOoinsC0C0EAABqEwCU5fEIAIauE2Dfcftmfk2z/sccc0zluwBY9w8UN2vWLN8RkNc9lP58la8LBL8AACDaAKCTNf /D9TgxhwAxDAJtXwZtzpg1kNdO36tXr25s+le323pR/AMAAACodADQj7Wa/XocAoChp00Zt27d6l555RUf2uzYscNt 2bLFBwOHnnpoJTb967a1l/W7QLOZM2e66dOnu9mzZ/vuoPR1QXd7qdPdAJj9BwAAUQcARdf8D8djYPiMHj/aH6+pU6 e6SZMmuSlTpvjBfR2fdMz4A60pHDTpriF1E6XvJlOnJQBcOwAAQHQBAAAArQwMDPhuABX7GzZs8G9ff/11t3Tp0tLc 6nWku4cAAAAIAAAAlaFOIXUMqXNIs/7jx4+vbdcQSwAAAAABAAAAAAAAIABA+U2cOLF2t/9jTS8AAAAAAgBUvthPW7 NmjVu8eDFrejk/AL/7f+1fmDkPAAAAAQCqEgDs3bvX3w5w48aNbtWqVY0ggACA8wMQXSPqck2gKwgAABAAoFZdAHUd 3DPIB1oHhXW9VhASAgAAAgAAQO1CAFO3sJAAAAAAEAAAAGrZLVTnpQAU/wAAgAAAAAAAAAAQAAAYeocccohX27/BO1 dTAAAAgAAAQLUDAN3NobYhQPMVFQAAACAAAFDdAODNN990P/zhD+sZAgy+qgIAAAAEAAAIAAgAAAAAAAIAAJGHAMuX LycEIAQAAAAAAQCAqgcAq1evrmcIkH11BQAAAAgAAFR3GUAtQ4D8KywAAABAAACAEKD6XQCEAAAAACAAAFCDAGDy5M kEAJwbAAAAIABA7FTc1arAG4QCLx0A7Ny5s74hQO5VlnMEAAAABACoQACwd+/eGocAia/tKPCyA4DahQAtr7ScIwAA ACAAQOQBgAq8+oYACSFAgS4AufTSSwkBOEcAAABAAABCAEKAqncB1CYEaHvF5RzJcthhh3ksJ+JcAAAABACIJARQ4U cIwCDeQoBf/vKXg5YC1KMTgBCgm6VE9Q0AuHYAAAACAEQ2gF+0aFGNOwESQoCMAODVV191GzdubIQAFgD0OwQo32aU Ra68yRCcfyPz/3vggQd6tQ0A3nk1JQAAAAAEAKh+8X/WWWfVOABIahEAWJFd5Nja923fvt298cYbTQFAOgQoot3vGZ 5zLumg0E46CAGKKHfniYr/3bt3dx0E2DGcP39+nCHA4FfVHgIAQgAAAEAAgCGerQ31EgBEGQL0YfBehxDAijQd3/DY ZhXsM2bM8OeSAgAtA7AuAAsAbrnllqYQwN7PkxcM6HwbvnMtr0jLKdoLX4F7U4ZzzQKAG2+80d1///0dhQDheVWZAK Cj60j6vCIAAAAAJQ0AbLanl9bPqPVUNJYrAFCBpk3bpNMwQAP4888/3y1cuLAaAUDHx7UeAUBWCGDhj+gcMMcdd1xT AKClAFu2bGkEAAsWLHBz5szxxf20adMahf61117bkeE/z7KKtZELAMp0nlkIsGTJko5CADundO2YNWuWO/vss2sWAu SdUwxOAABACQMADfis9bPWAUAFQgBr07YgIB0G5AUCFgDccMMN7o477qheCND2GCe1DQGs60MUAOkckE996lONAOCZ Z55xd911l2cBwcUXX+wDgHPPPdfNnDmzqQvAivvwsdNG9vwqGAK4oQ0Bynh+dRMChAGAOkeiDQC6DgEIAAAAQERLAD TAU9tnuP6zVmFATzPH5VwKoBlaFVhhGKAN3SQrCKhEANBJCDDo+NYrALBjrvPBbu9nhbmOv8ybN6+xB8DXv/5194c/ /MH97ne/a5xPp512mjv99NN9CCAKAY4++mgfANg51KrwH/lzq7MQYNCnewgB3nno8p1bFgD8+Mc/drfffrt79NFHW7 4epMOkCy+80J166qnui1/8YnW6AFzSw3nEAAUAAJQwANBMj2Z8rBugVh0BPbePlzMICEOAVkGArfdWy7dmfVX4ZYUA xx5+YLWCgIhnafvdCWAFXDoIUDH/0Y9+1Bf/73vf+5rY+aSvn3HGGf57wwAgHQLY49v5VI5gKV2MtynY3eBAoNNzqu wbxYUBgF4XvvrVr7pNmzblBsNhAKAOEh3/SgYAua8JBAAAACCyACAdAmjgJ73sCF39QV9cIUCrIEAD+HCJgLVy54UA cuaUd1doSUD7YKDqIUBeEGAhgAUAv1zy/kYAYO+HIYAFAPazebP+pbvdX5sgoKkZILwmvB0EFAkABj9+ec8JCwE0+6 8AQJ0Aen1YtmxZ0+tBWPzreKuDSMdfSwCiDQA6ej0o0kXCAAUAAJQwAAhDABvsafC3Y8cO98ILL7hDDz2UECDiECDd DSC2sZtavNNU0FkhFwYAD137Gff40sv82yg6Arp+RtUnAGgVBFgBr/NBhX66C8Ds2bPHd5BYJ0AYAKRn/a85eUJJz5 3WQUDS4nwq0kEQW0Go1wNd//VacPPNN7trrrnG3XTTTe7OO+/0X9NrQmUDgA66iAgAAABAtAGADfps1kcsCLAQoPLd AB2vHY8jBNBAPasbQHcO0D3eFQaINnuz9d5iQUBYxA0MDLiTTjrJS6IY4GbM8reRVQTax+G/qgcBdr7YUgAV+nobFv 8WDigAaFf8/+NNF7g7Lzyx5OFRfmGXFwIkhfaRiOt80bVe131d/8MQQO699173jW98w3+PnSPpAOCyyy6rfgDgCAAA AEDkAYAN/LTmU50AGvRp8Ldy5Ur/uQ0bNhACRFr45YUAFgSoG0C7vIfrva2920IA3QZOj/P000+72267LZIAICjsOi j+i4QAVe8ICLsBLAR48cUX/VsLAvR28+bN7pRTTmlaOmI/q3NEj/Xs3dd4CgHK2wXQfn+ArBAgLyxImkKF+M4Bhb4K AXT9txDg6quvdldeeaW/y4M6AvR6YHs+hAFAbboAXD33DwEAABUKAMLlAJrtCUOAH/3oR+5nP/sZIUDEIYAV8+kQQM W9AgDt9B6u8bZZ3zAAePzxx93Aede4JaufqFwI0CjwwjXeGQFA5S8qbxfu6W4Atfmr4NcMsM6LBx54oFH825IBm/VP /N8sccdPPNi99vBdvvgXBQFxbCqZ3Q0QbgCY2ylQkcJPIYDCXwsB1Bl2xRVXuKuuusrNnTvXffazn3Uf+MAH3Hve85 7GbSAtALj88svjDgB6DAEIAAAAQFQBgDZ80gxPGAKo9fO+++5zzz33nB8YmqzHOOWI0Q1JbIOgjlvF4wsBbG+AkG4F mF7rbbO+KvxUAO7atcs/hor/Pf/1+/iObVIwAMiZ4a3LoF4F+rxj3+uLdR1vhT9iIYCKfoVDb731VtPaf4VJ+v5zzj nHnxvqFFEAINo74vllN0QUALTvBsjrEqnKOaLXAnV+KfzV9f+b3/ymL/5FnQAKAXT8Tz755EYI8MlPfrIaywA63UeE AAAAAMQaANjATxs+KQBQ26dmfjT4UwCg2z1p4KeBngaH6RBARf/ahbMbCAHKGQKkg4CsACBs87YQwDoB1MotNtNbhR CgyDrvOoUA1rZv3QAKgMK9AUxY/Otc0Dmit+edd56nPSO0f4Q2kVzxpTP8Y0d3ziRF1/u/c4olLv59I/RaoM4vXfvt +m8hgF4HdHzPPffcRgig1wVZunRp/AFADyEAAQAAAIgqALCBn2Z9NNNjbZ8a/FkAkBUCWDH4f/95uW/7/fX6/0MIUP IQ4JZbbnELFixwF198sTvttNN8CBDe8k0BgFq+NesbBgDbVn7V7Vpzu3vpoSX+eFcqBEgd/zoHAJq11+y9wp6wG0Dn iYUBum1c2PYvKvjVAaAlI9o3QiGAHke3kVTYpHXkMYZHWXtE5J0T+QFAXF0Cei1Q55dd/634twBASwE06//BD36wEQ IoQK5EANBlCEAAAAAAogsAVNSr8NNA3WZ80jM/EoYAIRWIKg4VAEydOtWdfvrpcQ34O/jmzJnjjEKgrCHAnDlzPB2j vC4AtXzre/V1/ey/3HOt277qVvfqP93pHrt1bmWWA7TrAqhTAKDZes3a290f9Hy3bgDRufCLX/zCF4D6+Pdb/tH9+x PL3MJP/I0b+OCH/VIR7RehIEA/r2UFelwFADqXdG3RBnJlP3eai/jBywDanRP5AUA8QYCu6Vb0h8W/BQBnnXWWO/XU U31YoCBArwtf+9rXCAEIAQAAQAwBgA3wNZjTXgAa7KkTID3zE4YAag/VIFGzgZIOBEQFpgUBMbT8dhMC5N1LvIw7yI chgNp4FQKE9323Hd+12ZvWe9smghYCqPBXd8e/3vv3EQYAxUOAojO+VaPZes3aq3jXLL5m81XMKxAINwqU0aNHu6tO PMIHQwr/1DGgfSJss0hR8R8uHfj/27v3YC2qM9/jjSJqUCsTTaJCGITBkAuWJpaWiiYQEqPGK4yKNySK91Ejx1sFpK Ix8R5RR2YsRAPWjFrxcgwIcQbEUBClBEaMmFRQ5+SPk6lJqlInU/knSaVPfis+r+vt3f2+/V723r1Wf4t8am/2DbO7 d+/1/Naz1lIAEEII0H4mv5NCPklDPDJOz28957PPfhX/7QIAfW543R4Da/puAoCmjUUBAACqFgD4O3/b7t8a0GmAlz fzIxr4yWGHHZYeeOCB7vinb3zjG40gwPhngld3IJgzs9fNSDFJcsf4VRvs2/WYMmVKOn36dBcAaK2/zfir0Ldj3myz N90TmvXNtnwHGwAUhD1FxwHWcTNABQCu8H//9AfN7muWX7P9mvW3668wSF0hWhri7w8hOlN+06ZNjWPjxAKAqocA/Q juWgWDIYQAKuLV6aXCPhsA6Pmv50c2ALjlllsaAYACRgn1WdHR74OCEyMSBiwAAKAKAYA/i+cX/kYDcx31pAKwaOZH BaICgPHjx6dHHHGEG/wpBPC/jtjXt3+vakVg4SC9m5FiwUZhVQoC/A4Ava5BvF7XtT788MMdO+bNNntTmGMt33rbOe ec0xjYBx0AJOWuY3EhF28IYEWbnf6g4l6z/Jrt16z/H99Y5d7/yxcedEtCtPRHf9+2bZtbE66vs9tuu7m3KQTQyRIr V650HnvsMeeuu+5ykoi+l81BUdLu8VD5AjEbAlj46wcAH/rQhxoBgDYXVQCgYwTtHtIJM5IND0O47qVDgOzRoblBEA AAwBAGAHlFv1/4+7N0okG8dnlWoWeFvxX/RQGABohWONrXKQoChj4MaLWOt8eRedJe/r83vAGAHHLIIQ024++f8W47 vVvLd1QdACWvWx2K/uJb+6/XWQGAZvk1228bfIqWgmhZiG0K6QcAKgxNXvEX9n3UPgBI0jg6R/wQwJ79ouI/GwDo+F gFAOoo8kMAPwjwA4FoOgFynhft8kUGMwAAYNACAA3IskW/FXiiXZ6vu+66JioCLQTQbs/+rI/N/GQDgLPPPntAAZk1 PF0BHRT93YzSOiwoh7MrwAIAtWD7QYB/3RTcZI95U9u3Zn5V/GnWN+g9ADou/nno6Fprll+z/br+eUW8OoA2b97sXj /qqKPShQsXNlx66aXu1Am9PbaiP/ucydtDIPSjARUCaM8XPfN9fvGv3xV+AKCQwEIAfylASMV/Q1q8WWirwDBpeu74 IREAAMAgBwBm3rx5zowZM9Jp06Y1Fe15FAJogGezPT5/8Ce25jO74ZdPXQRXX321KzD9IKBKs74dhQA9fN0yu4kPZg Bg67Ct4PeLf7suNmjX2u+8UwCCPAmA4r+rAECz/Lru2fBHr+vIuCeffNKFAC+88MJflw/8pfC/++673UuFigoALrro ovS0005rCgJiCAT8n+UyIUBoQYBt6qo9XxT6Gr/4F9sE8LOf/awLCPwQINjiv9Xsf9uOoYHLAXieAACAId0DwIIAze qLFfP2d58V9goBtNGTsbZef/Cn8+RV3H/ta19znQJ6aYNCn5YJ6N/3lwIM7XKAPoYASX8M5aAwGwBY0e8HAVb8n3rq qe78dw3YtQGc1oCrDVwzwdbyrcIvtHPdO2n7L5P/1G05QN71trfrflCXj98FoFlhCwAuu+yypgBg7NixjddjWQLQSQ AQQhigrh877UUbvqrjy/jFv9x3333u+W4dAkceeWQjAFi9enW41zlNSnWPtQoAKP4BAMCwBADZIEADOt+FF16YGwKo 2M/KDv7yiv0s/ZvVGAQmw2j4/n/7AUCrJRp+sacj4LQLvNaB+zu9a7ZXs75hzeD2M5BJGNTnhAC77rrrgABAL1X469 5TMZkNAGIKAdIuAoCqhgAq/lfMn9UIAPQzb78TjMJfPe8XLFjQ6DK79tpr3ey/AgC/C+CJJ54Is+OjRACQZJabEQIA AIBKBQB5ywP8UECtugoDFi1alN5xxx0DBn3Z4l+Dv/PPP79J3tdWIXDNNddUaADYep1+2X0Dyn7OcA/2WwUA2eJfx8 AptNFL2w3eNnoTrfdWQRBWF0BnxX/e9UoKWr4xkAr7G264wd0nCgAsGNARgVb86+1ajhTjvgCFRX/B+6oaAPzsyTub QgA9F7R8zDaJ1e8Ae+bb8+Pxxx93VPyvWvXXUyP07LEwINw9HsotG8pvIuN5AQAAhjkAKBsKaG2n6JxnHfWkWT3R26 ztM0tLC8aNG5cef/zx6dSpU11oYGuDv/71r1d4EFiuwO9uY8HhbfstCgCs+LclGUeM28fRQP+5555rnAeva6YlIaLX td5bn6tZ39ADgLyNGfOvlXctmdUrFQL8/d//vSv6rThU8a+XKv6t20inTMT6wP7gRADvIR5ACGABwK9W/1MjANDPu+ 3zogDAlntZAKC9Aez6+vR2fY5erlmzJsj9Q8oFAEWdXsOz7AsAABAA9C0UyG4uaIO8M888Mz3ggAPcsXIKAOwEAYUA +hgV/1ofqo8Jpx00aT2zX3KQWIW2XxX4fgCQLf5fuutKN+OnAODoo49OX3zxRdcFkL1W2Y3cQt4HoOhUhlbXKtQd3Y dzeUD2bZpNVuGoWeTddtutlg/zKgcAukbZZQB+ACB6tvsBgJ7/119/vaPfBzoRwP/42AOAMsEwAQAAAKh8ACC2E7Ra ODWoE9vtWWs+bWZPAz8LALIhgHUByMUXX9xoCQ5iMPj+K613ei6zWdTAWcCqBAD/csNZLgDQy6VXnezW/ysEEF0jze KqUNMmkHbEm63hjiMASFsGAI1BfhrH8W7DSRuKKgCYO3eum0keNWpUrYv/qt5DFgL4AYBtGKqCPtsBoGe/UZeYCn6F v/p9YacHrF+/PsDAp9MOgKRNYMwzAwAAVDwA8M9zVgigzZ1st2e9rvWeep8FACeccIKj11VcahDoLwXw24FDCQGaN3 PKDwHKLQlI27SZD00A4Bf/2uDvjrOPcsW/vLL4uvS5RRe6IGDuYR9JDztgz3TTpk3uOlkAYMe8WRAQYgDQyWDcv8aE AL0/T9RZogBg5syZ6YgRI+gAqPC1UgCgZ4UfAOg54p/uoo+z4Nee/c8++2yj8F+6dGn6/PPPp7vssks6evToqAKAD5 4hxSHAwM4AngMAACCQAMAPAbTTs1gAoIGeZn40+NPrfjeAHwJYEBBiAJBX6HfWBTB8ewL4AYDf+q8CXxQEqAtAllz6 l4H8pL3d2zXbp4G/QgC/A8D2g9Bmb2GEAO1b/1t9XqsuAEKAzug+mj9/visI6/owD+W+0fNZzwkLAYoCAHV8WQCg5/ +sWbPSJUuWNI6PDXuzx/ZLvDpZYgQAAFDpAMAGgYsXL24KASwIsN2drdVTMz8a/Om8aL8t1HfXXXeFtQwgJwQYuBt8 UjoESIZhPbkFAP7sv/9+CwKMZmfFAoDXXnvNXatLL73Une8uCgLUzq3N3qp/HTud/S++ZgQAvQcAu+++e60f5qHcM2 UDAC31Ughgz3g9/++///5ITnnoJQAAAAAIPADIdgP4Rz1pll8hgGZ+NPgzN954Y8O9997b+PwwA4AkJwgYWGC2Pj1g +AKAvOI/73rrY20DLwUAK1eudG8/77zzGrSbu9hO7yEEAOVb/zsIAHhAIfJlGxYC5AUAeu7bfi/6OHUCKASIJwDotM OLAAAAAAQeAOR1AaxevXrAUU/WBWAtn63YJnIhDRCTgtfbrfcf7llADcr91v+y11sDfWMBgK7ZRRddlF522WXumodx GkDn6/7TgqUezPyjjloFAFrWZSGAXhIAEAAAAIDIAgB7+cQTTww46kkbPikAaPV1VERq5njatGlBBgDtNwVMKrUG2A bvZYt/u06a+bcA4LHHHmsU+zbzrw3Cwghxut2BO38wTwiAuoYAWgag4xut+LdnhVgQIAoA1PGVRLX+PS8EaN81BAAA EHQAYMW/vU3LAGy3Z9Fuz+0GfdoA0ITVCpsOGNQlLQrFKgQA3RT/eSGAHwBY94ao/b/a17HX47faBABDvJQDGO4ugK uvvrqx9v+aa65xe4F8/etfbwoB6hEA5D3LCQAAAECEHQD+22TNmjWOznmOeWfvpE0wUMVznm23/16uu0IA27jRv+52 moO9rjPeqzfgT/pwTYoH837xTxCAuiwDsGeKft5V/OtYWL8ToC4BQP5yLgIAAAAQSQBQNJiz9+22224BnvNctWKzis FHMiAAsA4OW86h0wBEZ7zb0V8xhz9JiT88uBBrCOCHinoeqOC/+OKLmwIAf8PXOEOAtCAEIAAAAAARBACo+Q3oDeT9 ZQAq/k866aT0/PPPT+fOnevojPfYj3kjAAABwMDng7HA0J4VoS336nVJUVIYDgAAABAAINAwQAN7beSoAEAbg+mIyJ kzZ0a9DKRsCMB9gphDgLwAwAp9f1mQhYTxBADFS4Lyfv55JgAAAAIARBcEjBw50i3/GDVqVDpixIha/nAy0AfPg+YN Qo1CwrgCAEJBAABAAAAAIATIxfcGAACAAAAAAAAAABAAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAA AABAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAAAAAAAACAAAAAAAAAABAAAAAAAAIAAAWjr8gm85fC8AAAAAgAAAkQcA 92z8PSEAAAAAABAAIGYHTzurEQDk4XsEAAAAAAQAiKgLwF7OfWSzo1BALxUQ8D0CAAAAAAIARLokYMdvUkIAAAAAAC AAQIyFv98JoKLflgcoBGA5AAAAAAAQACCimX+/0Le3sUkgAAAAABAAIKIAwNr+s3sC6O0sBQAAAAAAAgBEugzANgP0 AwA6AQAAAACAAACRhQHZAMDeRggAAAAAAAQAiITN9vt7ANgRgQQAAAAAAEAAgIhm/xUCWNFP8Q8AAAAABAAIzBHj9i kVABg7CpDTAAAAAACAAAARhABJkjj++n/j7wPA9w8AAAAACAAQUABgrPi/7O5H0//41f8M2AAwezwgAAAAAIAAAAH5 5QsPOgoB/ABgn08d2QgBLABg9h8AAAAACAAQqCuPGZueccYZ6XPPPedCgLwAIPbN/5L3/3A/AAAAAKhdAMAsb71YAL Bw2fMuBBg38xoXBFgIYGL+ISMA6PP3NOH7CQAAAFQ+ALBZX0KA+hg79q9dAGLLAfwQwDYGjD0AIAToj7mHfcSJ/b4B AAAAoggAsuu9Y58BxgchgF1rPwSQ2As5AoDeLb3q5Ib7L5zmlpdYEMD3BwAAAOhzAOC3a/fSup39PLoC6sHf9M9CAJ vFpYhDu+J/zR2XO/9291XphAkT0qOPPtqp471DVwkAAAAGNQDIbthmR7hZ4a6XLA1AJ9eZoh+dFP9vrvi2C42OOeYY V/i/+OKL6a233lq7+yjJ/OEeAQAAwKAEAH4IoOLf2KyuXu91aQBnwcft2GOPdddXL+v5PUgyL9Gu20hFv3WL6OXjjz /e2FhywhlXus0lLQTQnhLM/gMAAAB92gPAH5j7YYCd5d7roN8PAOqwQ3xdQ4Dzzz+/xt+DhACgxHPAlopMnDixQYW+ Zv0VAOiliv8d//1793YV/7axZJz3SxJEAMAzGwAAIKIAoGhZgA3Ye+kCyIYAFirQFRDn7O6OHTvq/cMX6bXt7XuSpB s3bmzcI/PmzUu///3vpxdccEFTCGBU7GszQLG3hR4CJIXFf/WDo+w+HzzvAAAAAg4A8jb/swGfvySg14Gf32FA8R/3 PgD1Xg6QRrUcoJd9PA6edpYzfvx4V8QrHDr11FNdp4goADjrrLMaAYCdHmHF/vblt6WvL12Y/p///UAjGAj5XkgKi/ 8k6vsAAAAAFQwAbNbfDwNsLwBDKyk6mSl8+eWXa329k0iuabdHfKr41+flhQC33357IwCYOXOme99//Op/GnScpN72 9r/ekT57y5zAA4AyIUD8nSAAAACo0BIAPwjIDvT7VfyjPmu9rcsjuwcEwl3eUTQbXBQIWABgH+uHAKIQINuBpCLf1v 1bCPDv9/xDJKcCfBACJBF1iQAAACDwPQAo1tAtze5mC/96rR1OahMKZEOAogDArv+sWbPSbdu25W46mu1AyoYAsdwb SeDXnN8NAAAAkQUAQC+09l8hgLX/+10B9SgekuALvU6WBrS6rhYA+N0gecuN/P1G/Pf5IQA/W9UKfQgCAAAACACAAQ Vip+vGEd5yj6IjPhUE+SGAFfj+5qJ5x45akRn+7v9JtCEAJwIAAAAQAAC5M8R8P+oRAmSP+LQj/PwQwD7GPs4PBPIC AMP3unrXnL09AAAACACAGrb9c61bHfGpAj5vzb//dz8Q4J4J55rzMw4AAEAAADSKBL4P9SsKcx9K78/k5+0F4Bf+3D NhXM9OPgYAAAAEAADq9mDyQoDsRoAUkdVc6589/jH7d1uywfcMAAAg8ABAA/VwN98CEPrsMoa3+M8e85gXCLQ7CQIA AAABdQBYCCB6fe5hH3H4JgNAvQKAbKHPHgAAAAARLgHwd+I2S686uUGBALt0A0BcAUD2iMe8TRop/gEAACLcA0AF/r hjz2oMArOBAN90AIgnALBj/rJdACzdAAAAqEkA4A/+7IxuvtkAEG8HQHYpQK/GjRtX8+8vvzcBAEAAAUDeUgC+0QBA CNCJYw8cyfcXAAAghAAAAFCf4l87/Nsu/yYbAvhdYWVOjVk46yi6AAjQAQAAAQAAoGqz/34IkLcBoH8SwMSJE536Bg BJyeKeAAAAABAAAAAqGAL4GwJaCGDvz24Mu+6+a+gAIAAAAAAEAACAEEOArOwJAXppxf+915yfHn/88YXFv/YAiD0A SNKEAAAAABAAAADCCwH8GX9/WYBYKOAHAGPHjq1t8d8+AKD4BwAABAAAgED2BLCiX5v+2RIAva4CvygAUOFfl9b//A AgofgHAAAEAACAsDoBjN6uwl8UAigAMNllABYS1OqXMPcNAAAgAAAAxMaCABX/Wg4wYkSS+36+VwAAAAQAAAAAAACA AAAAAAAAABAAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAA ACAAAAAAAACAD4JgAAAAAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAACApgdSkjh8LwAAAAACAACRBwA7duyodQiQ pAQgAAAAIAAAUIMAYMuWLQQA3AsAAAAgAABQhxBgw4YNhADcCwAAACAAABDzmn8CAAIAAAAAEABgmIwbN86p6wZtyf t/uAfGtS3e+7HmPxsAtPt38v7bQroH8r5uJ/8W9ycAAAAIANC3wm/nzp0Nq1evrlUQkOT8qes94BfZo0aNSrdv396X ACC75l+v62sfcsghTX/Xv1n2v2+w7oHBKLqLAoCy/16M96aFOkMR7oTw3OF3EQAAIADAsAzERSHAtddem06cOLGWAU DdBubZAnvs2DHpokWL0tmzZ6cHHLB/39f86+W2bdsaf9e/oX9r06ZN7t/O++9TiDBUAUDyR+8tfxqcEKCp+P+T9+/9 MYk6ALBnjB86Dma4E9Lzht9HAACAAADDNkhX8a8QoK4/NHUalKsQ94sw/f2dd97JnbUfjADA3vbWW2/ldhzov2vdun WDWiTmzcj3c91+qwCg3deP5X7UM8Uv+OvWBUDYCAAACABQGZp5VfE1efLkxhKAOu0HYDOvdRyI6zqr68OKMN0DeQX6 qlWr+hYAvP766wO+vmb59W/nBQCPPvrokAUARQXZUAQArd4e+r2pwl8hQB1b/usYLAIAAAIAVJTWXqvlW7O+Kvw007 t27Vr3ct999633zNyfk9qFADbbny3Qf/azn3UVCtnXGzt2bMsAYOvWren48eMHFP/Lly8fkqIxGwL0OwAo02GQFxRQ NAIAAIAAAH0r/FScaQ22P/Nv9L7TTjk5nTBhghNzAFD0vt/+9rfRF2G61rbvg15XAJQt0H/60592HQC88cYbTQHA+v XrB3z9jRs3ppMmTWr6XG0UuGDBAgIAAgAAAAAQAKAfhZ/kbfamtx966KHpCy+84IrDKVOmNHZuj+778Kf2669jL8Rs 3we/A8Bv23/zzTd76gAYPXp04++vvPLKgGMA9TG636oQBFUlAIiNrq9CHnV62HKjMWPG1HIZQKt7DQAAgAAAw1oYPv 300644rOPGgHXcrEtLP/yCvNcAQEtL/A6AFStWNMIkvVy5cmX65S9Nq841/3NSqmjvJQDI7jmgTpOY76np06c3LS/S PaFlR1p+VHQEZJ2WG/G7BgAAEABgWLoBsnbfffeGuv4Q1XGQrqUf6v5QAKRrr9cPOuigngMAfQ0/AFDIsGzZssp1l/ hLP+zPn//8554DAH2NvAAg1vtLhb8V/3nPFy0/yu45Ee0v4w6XIAEAABAAYNBoEK6d3rXZm9Z7a8ZXVPjZMgALAmIc rCcd/KnD/aA9H3TN1f3RSwAgmzdvLgwA9FL/TtUCgLzrTgDQefeQnivWTZL33Nh///0jPnWk/XOD4h8AABAAoFKdAC rYRAWgBQK2HEAD/Ni/HyrY/KKteUCfRB0AaN8HC370Ute+23DJAgAV+nkBQNUKwH6GP60K/phDJV13PSPq8JygewgA ABAAAAiaFed6XSGAAiC9vs8++3T0dV566aXG5/jFv/0bVZ39LSrUOy3oWhX8MReHc+bMabDrnCf7vjotAaALAAAAEA CgslTE7bXXXumIz49wPv/5z9dyRs/vDqjL/3dbBqDXdQ9ccsklHQUA+hy9vmTJkiBPk+hl1r4uM/5+67+KfnUA2FIi 88ADD7hNH7XcyDYD1MsNGzY0hB8EJB0vK6JbAAAAEACgklT4iYrB5cuXu1bxurb11mnAroLMugEU/nQSAOg+saK/iu v9u5nFJQBoTcW+QgBbQlQ0+59ny5Yt6Y4dO4IOAfp5agQAAAABACoRBMybNy8dcfCI9OCDD67t+t46tfD6AYACoLIh wMMPP9wUAIRa2BUd5ce90v+wKeblAAAAAAQAAIJo7dZLLf3QrL4CoHafo4DooYceCnbWP6+1O7uTPzO6xbT5oxk9en Tj9boU+bT5AwAAAgAAwdPSDxX3ZQKARx55JLpCr9MlAHW/X9QlFO+a/+6DAO4NAABAAAAgmKKu3cdUeZf/oQgBKPDy W/tjW/Pfr+VEAAAABAAAANb8AwAAgAAAAAAAAAACAL4JAAAAAAAQAHTDdgKvL9pUAQAAAAA1CADmzJmTvvnmm11/vj 5Xm4eJvlaIZ8j3smFTdvfn4dr8iXW3AAAAAEAAkDvrr6ObVLDby14CgD322MMV/g888EBTAKCjxao669+vgr0qx0Cp 8NfO29qBu2h37nYBgY54k1DPeO/X958dvAEAAABEEQBMnz7dFf0KAWz2/6CDDnLvGzt2bEdfS8W+Pt8+z0IAe//UqV Pdv1W1IKBoxr7Twi9v9j/79YaymLQC3z+TW9//N954o3Fmt2zevNn9/aWXXnKWL1+ePvzww+lDDz0UxRnvSY9/eNgA AAAAIADICQBU8Nvn6evo7zNmzGgKAPSyDgFA3tcbjqLSn+3XtZHRo0c3Xjf77LNPutdee7kZfxPbEgKKfwAAAADRBw Aq8Hfu3Jlb/B966KHu7yr4FABY0aeisJM1/Pq8lStXDggAbEnBrFmzCjsA9L7haAfv94x9mQBgMNrMWfMPoJK/qHg2 AQAADG0AMG7cOFf8+zv8q+hXMe4PzPTSDwA0S2wfU3agt2rVqkYAYF/P1pDbv6ngIe/z9d+o/9bBnPUtEwj0OwAoCh j6uWa9kzX/PoU0omu0YsWKdMmSJem1117r1GHN/5///GeH2X+gc7bha6tnjJ5JejbFGACUeVbwPAEAAMMWAPjF9aRJ k9K1a9c2Dcr0umbs/Q4ArRHvJABQga/gIC9QsAGh33XQ7r8zhgCg026EXkKAvDX/ttb/9ddfd9avX5++8sorruD3xd L6n/ThDw8YoJie60a/M9T5pfBXzxvxn0Exzv7zLAEAAJUNAIqK6vHjxw+Y3bcWfj8A6LQDQB/vdwD4gYK9TcGDAohO /nv7WfxXNQDo1z4B/uybFfN5/II/1J3+S/2QlBzE81ABys/867SX7D4itrdI7G3/FP0AACC4AGDy5MkDZvethd+fsb cZnLKFp//x2a/nhwQKIKoeAHSzNr/M5w92AAAAQ9H6X9c9AXhGAwCA4AIADb7eeeed3OK8nwFAXpdB9t8djgCgVXE+ FAFAN/+93Q60Dzhg/9z3adZfSzGi7wL4U/uwhQE9UJ42dlV3l0IA20ek7L4jsewJ0O0zg2cNAAAYlgBgzJgx6aJFi9 LZs2en+++/f6Mo9LsC+hEA+F9P/47+Pf27+veL/nv7uQdAuw6Adi37/QwAyhSb/RwcWgCj73neQFzLPZYtW9bY9K9u m3RR/AO9dQAoBDD+ngC2H4Ce/zHuCcD+IgAAoLIBQKuietSoUU0z9JoBzpuxt53l2xWb2Y+zAtRmlu3v+nerUAR2sz Fgp+vN+3G0YC/0vd60aVP61ltvueuzdevWdOPGje46fPlL06LY9K/bgfpvf/tbBuVAj2bMmOE6Aor2G8m+PepfyB28 HQAAYNACgDJt4kUz/na8XJkAIPtxeR0BVR8ADkYAMNz/n8aOHeO+79r3QXsvaAPGvFMYov1B+WPCjD8AAAAAAoBWLf x5IUGZIKHd1wtxFqcqXw8AqmDChAnp1KlTnVmzZrlQMfus17KvOp0GwPMfAABEEQBU5esRAABAdWgpkS/b/q/9Rzo5 SjbGAIDfAQAAoLIBQCdr/ofq64QcAjDwA1CHLgC9nD59uiv2165d617qtBdt+DrUe74M5+8LNv4DAABBBgD9OKKpX1 +HAKC/tBlkrMf9dTJjxwME6D8tA9AeI9prRM/+otNeYn++2DOGZw0AAKh8AFB2zf9QfA30XuxnLV++PF2wYEHtBuPM yAEAAAAgAEDUAcDOnTvdUox169aljz76aOGRkAQAAAAAAEAAgIi6AOra8k/hDwAAAIAAAACAHugYwNr/MuY+AAAABA AAgDrQcqM6dhllu424FwAAAAEAACD65UYWAtRx2RH7jQAAAAIAAEDtQgBTt44AAgAAAEAAAACoVQhQ101HsyEA9wMA ACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAAgAAAAAAAEAAAAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAA AAgAAAAAAAAAAQAAAAAAAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAA AAAAAgAAAAAAAEAAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAiMS+++7r1PZ78MHTFgAAAC AAABB3ALBu3br6hgDNT1wAAACAAAD1NnHiRKe+34PkfXEGAO+991761FNP1TMEGPjURQsf+9jHHJ4F3AsAAIAAABEH ADt37qxxCJC4MX+MA38CAAKATp8D9Q0A4n0OAAAAAgCgMehftmxZjQOAJPqBv4UADzzwACFA5CHAnnvu6dQ2BOj5Gh MCAACAgAIAG/z1MgBkvS8BAAFAnAGArnMtQ4D8p2+0AcCbb77Z9e8BCwDmzZsXZgjQ83X2nwX8HgEAAAEEABr82QCQ mT5usrIBwLZt2wgAarAPQC1DgOIncLQBwPXXX58++OCDHf0esOJf90g0AUBH1zlb/PM7BAAABLAEQAM+Df78WaBahQ E1Guz3KwC46aabatwFkBAC1LYLIO4QYOHChR2FABYA6HkwY8aM9KSTTqpZCJAXAPC7AwAABBAAaNCnwZ91A9SqI6D1 dxyZAf+JJ55Y4wAgqXUAUKtrXaMAoNsQwA8Apk2bFm4A0HUIQAAAAAACDACyIcAPf/hDp5d1oVGFABEFASrqfL0EAE GGAH1Y71uXEED3h5Z51DYEKHwWxN0FoGf/bbfdlj7zzDMtn/1++7+eBWeffXZ63HHHpeeee248XQAtnxFFxT8hAAAA CCAA8EMADf70UgPArVu3pq+++mq63377EQJEUtStW7fOFXXSaRigQf/MmTPT+fPnxxEAdNHyW9cAoHYhQMt7JYk6AN Dz/5vf/Ga6fv36whDYDwD0PLjgggviDAAKnw8EAAAAIPAAwAaBKvw1+BMLAiwEiL4boNxVCL6ws4LOgoBsGFAUCFgA cN1116W33357fCFA2+uc1L4LQFTsEQLEGwLY7wALgxcvXtz07PeLfz0H9DzQPaElAMEGAB2FAO2KfwIAAAAQSABgg0 DN/Gjwd+ONN7oB4COPPOLetnbtWkKASEIA0WyuBvF+GKCCT/KCgCgCgE5CgAHXut4BQO1CgLb3RpwhgDq/9NzX8//K K69Mb7jhhvSOO+5w71MQHG0AUPr5TwAAAAAiCgD85QAa/PkhwA9+8IP0Jz/5CSFAREsC/BCgVRCgQb82+jr88MPTr3 zlK+ncuXNzQ4AkpMFvycF+GbGHAL/4xS8GLAWoRydAvUIAPdvV8aUuAD8EkHvuuSf9zne+4z7GgqBsAHDhhRfGHwCk BAAAACDCAEBtn5r58UMADQDvv//+9OWXX3YzQaaWAcD7g8AkohCgVRCgQs9fIqC/a9BfFAL44lgS0D4YiDEEsADg7b ffdvtH2P1hAUD8IUDZkCie/896pisEUOhrIcAVV1yRXnLJJelVV13lfi/od4R+9rMBgN8FcOCBB0b9/K9bGAgAACIO ACwEUNunAgAN/rQm9Lvf/a4LALTp05w5c9Ivf/nLblkAIUAcIUC2G0A086vib8uWLQN87nOfcwP/bABw7IEjnQkTJr ivEU0I0KYAyA78k/f/hHxv6HqKrve7777bFABkQ4AyggwAku6LwVBnhvVM17IvCwH0/L/44ovTyy+/3D37TznllPQT n/hE+uEPf7hxD1gAcNFFF7kA4Pjjj3fUNSR1CQHsOZD9wyAGAABUOgCwEECz/pr5scGfin8LAAgB4goBVKDldQNo5l fFn8IAWbNmTfrtb387/cMf/uBYEOCHAH/6zy0uAFi6dGk65dz5ASwN6PwifvAp+SFAaAP/vIJdyz50bygA0LW3LgAL AG6++eamEMBeL1LtcKCgaO9xRjjEcEDPfj3XtexLvwMU/ur5L/p9oGf/V7/61fSYY45phAD6XeAvA1Dxr/BYP/9v/N //F1YI0IcgMPvzTwgAAAAqHwCoqNeaT7V92uDPaAB4xhlnOH4IENXSgA6LwRj2CSgKASwIUDfAnXfe6Qr/j370o46W CvghwMaNG93X+d73vpf+/YLFbvAfzt4AnRX/rUKAqg/4swX4iSee6GijR6OizQ8AdP11fS0AuOaaa9LZs2e7az9lyp RGoa9nRifURTL0YUDJwnzIAoBqhQEKAbTni7q+rPMr+/w//fTTGyGAfg/IokWLXABwzjnnuOL/Y4fPSEcfOCHeLoA0 KfXzTwAAAAAqHQDYQFyDQK351IBPMz82+PMDAAsBNEhU4a+jpCQbCIQVCnQ3I1w0MxxSC7DN5OaFACr+FAD87ne/c8 X/LxZ+3L3csWOHCwH8AGDevHnpmWee6WgmOaYQoBH4eNc8lBZg+9m26ysqwI0KPa3rFm34aAGAOj907cUCgvPOO88F ACoEp0+f3tQF4Bf3RaxrxDf4AUCHxXg6uCFAfphUnU4A7flinV/Z57+WAmjW/5Of/GQjBNDSMesAsPb/j3zqyDD3BO ji2uf9/DOAAQAAlQ0ArDiwwbgG6BoEaqBnA79s8W8zh4cddpgb5GkTqG984xuNIMDY4L7aa4EHDsq7XRueX0uEEQRY IWczvT4Vfpr1tw4AUfH/2muvubZg3TPbt293X0PLAEQBwPblt0UTAuTdF+1CgCpdW7/g1iZ/2SDANnjTaQ+2B4At+1 D4Y5tEfuELX3CFnkIAUQhwyCGHNG0Q2a7wH/qlAK07OFqFAAPe3EMIUPxvV28/AP/Z7z//9XtBz/7jjjvO/Z5QEKAQ 4Fvf+pYLAfSzv/fee7sOgLB+/vsbAjCAAQAAwx4A+ANtf/DtF/7+UU/a8EnFnV/4a/BnA8Bjjz3WBQDjx49PjzjiCD cIVAjgf528Qf/wFvoDZwQLB+V9mgUMKQjwZ3PbBQAWAmzYsKERAlgngJ0GcPlRB6abHr4xihCgqPjLCwFCaP/P/tz7 QYCuv66tv+zDX/5hS0B03fWxfgCQDQH858DwPgPKFuM5H5O3D0SHAUBIYaACAD3Ps8Gv//wvCgD0udoQdNzeu7if/w 0P/q/gQoCOQuC8e4XBCwAAGO4AQAMzfwDuzwb6Rb9P7Z1a66lWXxv42eCvKADQINEKSPs6RUHAcMwA5s72D9Fa4FCW CfghgDZ805pvtX1r5leFny0BsABAe0boXsgGANpJPJijATsJAXIKwqINAUPYDyAvCLAQwAIA/5rb634IYAGAfW6rWf +qdv60/plNm/f5yAZCkQSAfgCgPV7smZ6d/VfXRzYAuOWWWxoBgH7e/RAgxACgdAhAAAAAAKoaAFgIYIP9ojXARgN6 CwG05tMKfw3+bACYDQDOPvvsRvFYxTXApdt/Ow0Belj/W8VZYz8EsFZvtX0XdQFoPwB9rN6vz7XiX/fEAQcckJ566q lRhADtugCaX1oIUO3CLy8IsJ9VXdu8a2503bXe2zoB/ACgGrP+vT8bWhWCZToIQjsOsCgEsOe/HwB86EMfagQA6hTS 7xgdI+gHf0EuAegkBMguAWDgAgAAqrQHgAZo2qhNZsyY4dZp+0V7HoUAGuRpwJflDwBF3QLSamdwzSJdffXV1d4FvJ MQoA87gCcVLQztOuqaKgTwC0K9Lg899FD6m9/8prGJoIUAel2DfwUAuu4WAoRTFJQLAbKF48BCIElDWf5hQYB1A9hS ANvwMRv86ForAGhX/IdxzfOK9tYhQKsAIOTiPy8EsK4vyXv+K/TT7xfdFxYCKDyWqEOAnOs98GefwQwAABimAMDvBt Csvthgzv7us8JeIYDaPY0Gfv7gT4M8tYiruP/a177mBot6aQNAn2aT9O9XZS1wTyFAROeAFxWEOupNM34KADTTawWh ij+t/1dBYDPAKvx+/vOfu8877bTTGiGAAoAf//jH6ZIlS9zbdc+EUhDmXftWS0haFwJhdAT43QAWAmjDRwt9/P0fdP 39DQDtc3V99bXeXPHtdM0dlwcV/BQe9VgiAGi+ZcIv/hQC6LQXdXv5ss9/PwDQPWEhgN7/xS9+MdyOgBadP8WBDyEA AACoUACQDQK0g7/vwgsvzA0BNNjLssFfEX/9qNG/WY1BYDKMqn/z+R0Ael0hgF5XsW9HfVnxZzPAOvlBIZAFAK+++q o7JeKuu+5qdIDoY7WpoEKiahcELQKgkuu9k5z9J6p+H1jhnu0G0HVXwa89H6zzw66/LRmwWX+7rir8//TzV9J/u/uq 9Mpjxqa33nprON0fBUWdf/RncfjT4oEeYAAg+jnWci+Tff7bJoCf/exnXUDghwC6X/Sx9jslu0Sg0s+Bkp1fxfdDGu TzHwAARBgAZIMAn4KAiy66yIUBixYtcuc8WxDg84v9BQsWpOeff36TvK+tEGDCGVdWaMDXyTr9btb2Zz4uDS8AsJ3e jc34+8XfU0891SgcR44c6QIAUSiga/3LX/6yEQCcc845blmB7iGFA9Uc/HezjKN4eUe791ctBNAmbrqW2thRLARQYa cOEC378Nf+2/X3i7mlV53sin8dDXf00Uc7oe0FUdQNkD/jmxQ+yEM9Hk7Fv36G9TtBe72Y7PP/vvvuc8936xA48sgj GwGAlgHZ3jGiEEA//3rf4sWLnSoHAGWf/+UDgA+CgG4OnQEAAAQAQxIKaIZHtNuzNnxSy6fobTb4y7JBnTaQUxGgwu +AY09Ld/z378Oa/S0o8NsHBOEWABYAWNGe5a/5zhZ/K1ascGuHVTj813/9V+Ptv/71r91eALoP9FLLRLQPxTPPPFPB e6Gb4j+/QSANLASwAOBP/7mlEeps3769aW8A/z6w66/C7jOf+UzTCRCa+Vfh/+KLLwbUAVBub4DCToHMz3kMAYCOeM 0GwFr2ZeGv7S9z7bXXupDIDwD0s64QQGyfGCv+K78sIC2/2WN+B1DRzz2FPwAAqFAAoHZPFe2iYk0v8wp8nwZ/GshN nTrV0WAv2+KpEGC/z01vdABs/McbKjv4SzJ/yhwZNrBwDLcF2A8AJHvGu7/m24o/sWPAfGoZ1kutG9beATarrMLfiv 9QA4CkVItvMmBGuZvTJocyANDPqnzve99zP9t+N4CuoYUBKg4t/NH1/5u/+Zv03XffbVzTxx9/3HX9PPfcc+7nfuGy 54MIAVr9/Bcd/ZgXAIRc/OeFALqW2jjWjodVAGDdXv41F38ZwJlnnpnecMMN7veCngerV68OKAwqGwClmVn95hAgf3 8QAACACgQANmt/xRVXpFPOne/We7vi/f31oBrU2YZgtuZTMz8a0OmlAgC9Pnr06EYg4BeEK+bPcsWAAoCqhgD+oL3x epvNvwZu+hTuus9sAGBFvx8E+Gu+NfOr4m/dunWu9V9vs/Z+f+1wMGt/O575/6D4a9w3JUKhqu4DoFn9pUuXpn+/YL Er3vTz75/aoRBAGz7ang/6HD0b/OsvmvVX0aiXKv6t+yeUAKD59fyOoKaAJ403APC7PxQA2EavFgDoOW+/B0S/J1at WtX0DFB3yPr1693bjjrqqGBOiOikA2RgEJCmeZtEhnxPAACACAMAFf0q/j92+Az3+t577+3agv3BnWZ4bM2nXtesj7 1fMz0a4I0bN64RAtju7xYCWACg16s2CMwbxKdt2rmTUgVkeAGAzfr77Kg3u54a2Gvm14o/XX+1/mrG2AqALVu2uJez Zs1K77zzzooP/MsGAEWF3sBgKKQZQF0b/fy/8X//XyMA8K+1HwZozwct+9D7/OuvwtDv/tHGcVoSICEtBRhQ1Lf42c 9e/1bPkJADANFGntkAwMLeL33pS41r/7d/+7fppEmTHAsCfvSjH7n3ffrTn276vVDV/UA6DQDa/S5IIrgvAABAhAGA Bv+jD5yQfuRTR7qX4/beJTcE0HpPsQBAgz8VAHqbjhhUCKC3+SGAin4r/KvaAdC+SErTTjZ8C/EUgLwAIFv8W8Hohz +2EaRCAG0alxcC6Gg5+xwdL1mt+6B88d/uc8uEAFUsAuzaaJ8GseJfL3UP2EaPoj0fstdfSwesg0Rvn/+lv0s3P/LN dPvy29LXly4MJgTIdgO0+tlP2+wHEnoAYN0/ejZkOwBs2Zet91dwpJ/1sWPHNjrGRG/TcgALAC6++OJGR4A+torLgc oHAJ3sG1HUacLgBwAAAoBhDAFEewJo0H75UQe6EEADNA38LAQw2TWfGgRqp3ALATRg1NKC7JKAUGb+8tZ1Jy3WfIYc AhQFAFb82+yvjnrTbu/+9bTiz2RDAAsAtm3b5t6mtcVG+wRIlQOAJGeGt93n5i0HSArWm1etCNA1sp9/O9vdQgAd9e if9qBlH7redg/8+Mc/bmwkqffrVIAtj96Svv2vd6TP3jInwE0Bm0OAzn7uww0A7EhICwB0Te2oV3/9v5Z9qZBX+Gsh wPXXX+9+5rMhwBNPPOE+xwIA3UchBgDN1zZ/qUi7EIAAAAAAVCIAyBYBGx78X40iQIO/bOtmds2nHwKIQgC1jYp1A1 S//bNdgZgWrvksc3xUlQsDFfh+AJAt/t9c8e2mc97VAWI7vevzVPypCMx2AmjduIp9vwtg7ty5zsyZM9Pdd9+9sl0A rYr/vCUA3YYAVewG2PTwjU0zvHpd4WD2tAct+9D1tgDo+9//fiMA0PPDuoj+/Z5/aOooCvNnPyl92kPIv4z0824hQF 4AYPeInut6ziv01TPf7pVsCKDXLSy24t8CgDBDgNbBYbslY1X/+QcAADUMAPyWYHv9i1/8ohvM2Xpvf82nBnEa9PkB QF4I4AcBFgaEVwjktwCXDwCqWSS0CgB0nTT775/zrmJALAAQFX/ZAEBngav4l5dfftm9TZuKqfjfZZddKr0MIO+89/ zBe/cBQJX3BbBj3ez62kaPfneHXte1tk4AUQBw1llnNT7WL/zVFRTWz3671v9OQ4DqBwTtAgBdQ/8UGD8EsCBAy0f8 DUG1yaS1/oceALT6uS88LjKQDiAAAFDjACCvINDAXQWdv+ZTmz3ZLI+FACeccIKj1zWYtIGhf2ygWEERbgjQfuan+7 XlwxcA+MW/Xwz657zrqDd1ANiGcf6GYaKC0I79sxDgySefdH8fNWpUOmLEiMpe26Liv/UAvn0IEOJmYBYCWHv/L3/5 y5YhgFgAoJBH9DZbEmR7DNx88801CQGq/7PfKgTICwD8TSL1PNeeLwoB7Dlvz/5//ud/bvxuWLNmTeNzLASo7j4ArU OA5p/dciEAHQAAACDIAEBnf1sAoI2d/ADABnqa+bHzn3VsoBX7vhtvvDG99957A24HTtqs9Ww/+E8qOOC3AMBv/fev vwp+BQCu8H//nHft9q4N3+xaqvATFX2bNm1yb9u8eXNTB0BY1zZ/4J5dI96qWMyuHQ/u4fSX//AlS5Y0OgF+/etfu7 0b/I0eLQTwgwAV/1oCcvLJJzeK/8cee6ypkyD0n/0kZ4+Q0H72Ow0AzjnnnEYIoFBYIYACHgsBFADonnj22WcbIZEF AHY/WQBQ5edBqwCg0y6ApKM9ZwAAAAFAxQIAtXD7bZ7ZDZ8086PB3/33399Ehb/4M0GhFgHtQoBWiovH4Q8AsrP/eW 3hYue8qytAu71reYDtGWEzvyoGLAR44YUX3Hrx6qz5L1Pg9W/GeOA58mEFACrY/O6O9957b8BpD3ZvqPND113XX8t/ 9NKK//AK/1Y/+2nu/VIUBIQWAOkZoOeBQhwr/vXygGNPS/f73PTGtVQIoIBH11ohgH43KPzVM1+t/88//3y6fv36dL fddmu6p6r//M9p5c99Zielfg/kBYoMfgAAIAAIIgRQAKABvwZ1NsPjBwD2UoM/zRT6haNR62d4AUC5LoAyhWTVZoAs ACgq/ovCAAUA2jVeu73bWm+b+VVB4B//V+3ir1/Ffxp00ddq+Y+uq2Z/RWGO3q7ODnsG6JorILTrrBBA13/lypWObQ Cp54eWgcQSABSt/c8L/kJq/bYugKuvvrqx+786fxT86aV/tKu6AGy/F32eQgAFAPb8134fOjUge5Ro1a95+1NAyu4h Uv29HwAAAAFAbiGgwbterl692r380Y9+1FgOkKWZH5vpsTOgbQOwsAOAtGBmN79IyFvzWcUAwG//7+Se0DnvOurNNn zTDLHavjXza4VfKAUeAUDxdVZxp59/XV8LAO68887GJo922oNCAC37yAY/er+d/lC9PSC67+wou8Y/tLXf/jKA7H4g FgYoBLAgwEIA2whQAYD//A9x49eko+K9/fOfwQ4AAAguAJDFixc3tXCKznnWUU+a9dd6T1GHgGZ+rPjXx6kwtN2fww wA0gFnOqct2/3zC/8qDghtwN9JAGD3hc5511Fvet3f8C2cACAlACjZCaDraxs8imb5t23b1ggCjJZ9+Ndes8HVO/2h l6Cos5b/0ArBoueBO/7xH29osADA9gPIBgD2/LffAWEGACkBAAAAqGcAYMW//V2DO8lr89eaT7V9amBogz/b9VnFf4 gBQGebOSW5AUAVOwB6CQDsXrAlAP6Gbzbzq+JP6hQAxFYA6FpqAz9dWwsA/GBQQYA2etRpD3ppXQJ+AFDdPSA6+fkv mOFvsd9HVX/mu30e+CGAvxeAf9KL7fdiz/4QN37sVwDAIAcAAEQTAFhxb4O8bFGfFwzYMVAqJGIJALIFfruLXdUAoJ vi37/W2eJfLd/W9l394i8Z1OI/hkLANvnL/owr5Mn+nOt6JxGuey5q7y9aLhSyVs8EXVub/fd/H2QDAL3NOr9CXPKV dPUMoQMAAABEtAQg7222U3iZ451sCYDEdhHLDPRiHRDaYF8BgB31pjXj4bd9M/vf6jmw5557Ntb3h7nBX/9+7utW6G WDIP38+8W/v+mrhb+xPffbLRGpeucXAAAgAOh4AGgz+lnhHvnVewFQ10GervfNN9/cuO4qBsPc8K0/M8R1uBfi2OCv v8+Auv7sWwBw7733Ngp/f88X/V6oUwDA7wYAABBlAOAP8mygF+oa/34GAHUuBBKOvKqVODb4G/zunzr87Fv3j/97wK g7KO4AIG1b/BMAAACAoAMAv+DzQ4A6FoEM8FDnACD0Df768bPPvZDm7vsS5iaAAAAABAClB35cVAAAAAAAIg0AAAAA AAAAAQAAAAAAAAQAfBMAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAAAAAAAAQAAAAAAAAAAIAA AAAAAAAAEAAAAAAAAEAAAAAAAAgAAAAAAAAAAQAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAA AAAAAACAAAAAAAAAABAAAAAAAAAAAgCgIg6edlYD3w8AAAAAIABAxAHA3Ec2O4QAAAAAAEAAgIgDgHs2/r4RABACAA AAAAABACJ0+AXfcsW/hQD6O98XAAAAAAQAfBMQcQAgBAAAAAAAQACASIt/2fGblC4AAAAAACAAQOwBgIp/hQAEAAAA AABAAIDIlwAQAAAAAAAAAQAiLf6N7QFAAAAAAAAABACIdPbfAgB7nRAAiCvg4/sBAABQ0QCAARsG/UZOEifvBAD7O/ cgEH64Z/i9AgAAULEAwAZo/qZsfNMxGMX/ZXc/mv7Hr/5nwPp/lgEA8Zhy7nyHYz4BAAAqEAD4A7HsbI0N1vimYzAD gH0+dWRTAGAhAEUCEN9SAH62AQAAhikAyK6z9tdq0qqJwaSi3w8ArDCwAIDZf4A9AQAAADAIAQDFFoa6+JdxM69xIU C284T7EYg7ACDkAwAAGMYlAAzCMNTt/yr+7aV1ADAzCNQnBGApAAAAwDAEAMBQF/8q+O112wtAb7O/830C4u8AIAAA AAAgAEANAoBskW9LAYQAAKjXXgB8LwAAAAgAUOOAgO9DNYozvg/gPgMAACAAGNLZIQaIwND/7PV7gzZ+lgEAAAACgN zZICtAtEaUnaKBsGdmOW0EAAAAIABoki0QbMZQm0VRNAB0FAAAAAAEAAGvzS5z/jtFA0AAAAAAABAARFIYFLX6c1Y0 EMeyAH6GAQAAAJYANIr8vELflgEQAgDVCOumnDs/93392uQv75hIDP+15/kLAABAANAw7tiz+hIC+IWEv/6fwSdQzQ DA7+Lx9+so8zNrxf4+nzrSsdcJAap33VnCAQAAQADQFAD0OmC3Qt+KCWb9mUFEGIVgNrg7eNpZbQtGPS8uu/vRBhX+ 42ZeQwBQ4WvPzzAAAEDNAwAV/r5+FosUjXEWEFzT8JfrtLqGVvy3Khj9n+//+NX/OCr+rfCn+I9r/wcAAABEEABokK 6i34qCfgUAiG/mv91JDwgrAPCX6/jFYZnZ/+z9oL9r1l9dABYC+EsC+L4TBAAAABAAVCQAyM7WM2BHUaFnWN4RR6jj 79FhL634z15f/3Py7omiEIDnCUsBAAAAUKElAH7LLoN1lO0AIASIpxj0r6UfAPhLPvxCP/t5RSEAAUC1rzk/uwAAAD UMAIBOuwHY4yHOboDsLL8V+OoOEL/gt6UE9j57m20MSPFf/SUgZTZ5JBwGAAAgAEDNi0XaievXHWDFvs0c+8W/f3Qg BWM41zUb6OV9vDZ3tEDH8H0EAAAgAEANCoei2UQCgPos//D/zjKQeEIAyfs4O+FBrKvDQgCCHgAAAAIARFww5J0dTw FYr+UffvFP90fY19Nf1iHZj9PH2Ky/9nQQ//12ggwhAAAAAAEAIlw37B8V5+8cTxFY370C+N6EHej4+zv4H+MfEym2 saO934UC7wcAhAAAAAAEAIh0xtAPAygAgTiWd2QDAH9/B+sEUAjgz/6LPQsIAAAAAAgAEGHBQOs/EGcQYD/PfmePCn //desCsA4AlgEAAAAQAKAmhQPfByC+ECD7s237ANgyANsMkBMfAAAACAAAABGGenYCAAU/AAAAAQAAAAAAACAAAAAA AACAAAAAAAAAABAAAAAAAAAAAgAAAAAAAEAAAAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAEADwTQ AAAAAAgAAAAAAAAAAQAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAABAA AAAwvMaNG9ekjr+g/T/cEwAAgAAAQQ7okyRx6jqg514A2j8ndu7c2aQuIUDS4g/3BwAAIABAMIN6fzC/evXqWgUBDO aB9iZOnNhU8NetCyBp84d7BAAAEAAgyHZeUQhw7bXXukE/A/saPHB6DHzq2jlSJyr89TyoY8t/9jnB/QAAAAgAEF0o oMG+QgAG+2ltQoBePnfHjh21DgEoDAEAAEAAgEobOWakK9omT57cmMWt6x4AtX/o9BgAbNmyhQCAZwoAAAAIAFBFo0 aNShctWpS+88476bZt29Lt27ena9eudS9H7Dui1q3/3B/dhQAbNmwgBKjB/89DDz00nTRpUjp+/PhGeDhmzJhadgjZ Nee5AQAACABQ6WJNhf7s2bObZv6N3vfxEz6eTpgwwYl5EN+qkKtzINCqkM/rFCEAqEcROH369KawUOGhQkSFiQoV6x wcEgIAAAACAFS2uJNd9981932a4XvhhRfcHgBTpkxJDznkkNruARDbwL7sMo92AUB2zX82AIh9OUnePRFzAajC34r/ vNBQYaK9L/ZnQqeBIgAAAAEAKk+bAD799NMuBKjjZoAxBgCaoe1HkZa35t86Rywssr9XaVa4n9eyKADw3x7LvXPTTT e5aykKB/Pun/333z/a0KfMs4DiHwAAEAAgqBnhrN13372hrj+EMRX/2vBRbdqaqc3r/Oh1zb9eqh3c/q5/Q//Wpk2b 3L8dWwCQV/Tl/T2G+0eFvwLBOhwLWodnAQAAIABAjWlwv2rVqvRnP/tZ+tOf/jR98803HS0BsGUAFgTUYXYvpvW9Os 7Rzm3XtdNa7bxZ+8EIAOxtb731Vu594/+3DVXB3++2/XYBQKuvH9I9NWfOnAZ1eBSFhtn31a0biIAAAAAQAKASM/zd dALsctAujkIACwRYCpAEVfzv3LmzUWRrt/a8Al3hT78CgNdff33A19dSAf3b7f77BnvWtuj6DUUA0OrtVb6nrOhXSG TBoHnggQfSlStXuvvHNgPUS90TJvQgIOnxD79/AAAAAQCGtcWf70d9ZAtsm+3PFujq/Ojm3rCvN3bs2JYBwNatW91x cXn/fQoHhioAGKwOgDJfP9QAQFTsKwQ46KCDnKLZ/zy6vtnNIusUABIEAAAAAgAEaZ999kn32muvdMTnRzi7fn5k7X 4gQxvIq+jKBgA6ui1boGvZR7cBwBtvvNEUAKxfv37A19+4caM7Mz4vAFi3bt2gLgMgACB8BAAAIAAAunDJJZc4Wgqw fPnydMKECbVeClD1wk1F1+rVq3M7APy2fc3w9tIBMHr06MbfX3nllQHHANrO8XkBwKOPPkoAEEgAoKDH6Jrb63Up8m nzBwAABACobRAwb968dMTBI9KDDz64tnsC9Fo8DkcIMGLfEU0Fea8BgNZ9+x0AK1asaBwDqJdaI77fcfvlFv8KkQZ7 E8CiIr1d0d6Pr13mzPgQC0j9zMe65r/XfQH4/QAAAAgAUNm2XL4X9bjW2rjRP77t4yd83HVx6G062UGva7PHXgMAfQ 0/AFDIsGzZssbffXrbggULhiUA6HVdd6cBQIzt/zGv+a/bUiEAAFDTAECbPNX+G86Nhwip0PdPb9DSDf396aef7ikA kM2bNxcGAHqpfycvABjOoqyfM7fdBgCs+QcAAMCwBwBqBe728/W5ag0Vfa3QWsP7VQjQDoqqUwAwZcoUV5wrANBLhQ DdfC3/FAAV+nkBQNWKwX62b7cq+HkOAAAAoFIBwE033eQG8HbOcy9dAAoA9thjD1f463zoEAKAwZgJJABACKw41+sK ASz802kPnXydl156qfE5fvFv/0ZVZ4KLCvVejnnr594CAAAAIADouv1XR4Fl3z59+nRX9Ov9NvuvM571PpvRK0vFvj 7fPs9CAP/fqtrMfqtZwG6LAAoBhMiWAeh1HfWoTR47CQD0OXp9yZIlw97u388wYLA/FwAAAOhrAKANtlT8+xuADVYA oILfPk9fR3+fMWOG+/vUqVPdv5X9vFmzZg3ZDP9wBADtCgOKBVRl3bZ1A4z4/IiOAgDt5G9FfxXW+/f0wO3i55IAAA AAAJULALI7bVvxb0eBadDuHwWmQr6TFn59no77ygYAtqRAhb7+vbxz4/P++wY7ACgzY9+PVuBOjgPjpsdw8gMAdQOU DQEefvjhpgAg1M3fuv35D+lISAAAAEQcABQV/yr6VYz7OzVnzwIfPXp042PKBgCrVq1qOg9cX88/DkxfL28pQNF/52 AX//0qAIo+p8rHgbFTN4rs+vmRblZ/3rx5bT92xMEj0oceeijYWf9Olw0R4AEAACC4AGDSpEnp2rVrm4o/va4Ze78D QOd7dxIAqMBXcJAXKFix6XcdDHYIUIUAoGyxMNQhgK6FzurWmd1F53m3CwhU/EnILd/9+H7HWPypU0fXtkwA8Mgjj0 QXJHW6BIBfWAAAAKhsADB+/PgBs/vWwu8HAJ12APjHgWUDBXubggcFEAQA1ekC2LBhQ4Ou4RtvvOFeKgASnfOuv2uz N9HssNq+NfMbQ/GX9Pgn1gdQmSVAVd7lfyhCAIp/uosAAAAqHwBMnjx5wOy+tfD7M/YqCDsJAPyPz349PyRQAFH1AK CbwX2Zz69SAJA3YFeAI+rksNeNjnrTbu8q+kyMM78U/0BxKCStOobUVaTuohgDgDI/9zwbAADAsAUAVlhni2oNzN55 553c4ryfAUBel0H232313zmYA7bhDACGY9DIrByAbmk5l1Fnl7rFFPDqGS9+F1GMzxlCQQAAEEwAkGfMmDHpokWL0t mzZ6f7779/o0D0uwL6EQD4X0//jv49/bv696s0mBuKAGC4B4mdrPn37XLQLo5m+1esWOHOeddO77ZjfF3W/DPQR91n /vfYY48BXUHWKRR7wEjRDwAAgg4AZNSoUU0z9Crw8mbsrWBsV1xmP846AGyDOPu7/t0qFoOddAqUXQvcj6MFh2LNv6 31f/31153169enr7zyiiv4fbG0/id9+MMDCnVs/a9r9xE/9wAAIPgAwB+YFc3426xxmQAg+3F5HQFVHwAORgBQyf+f 3oDcivk8fsEf2zFvZa4RRT/wV3PmzHGt/woBDjroIKdsF1EMewL0EgLy/AAAAJUJAFq18OeFBGWChHZfL9RisApfDw CGswNAIYDx9wSw/QDUSRTjngB0CwEAgNoEAFX5egQAg9cJsOv+u+a+T7P+hx56aPRdAKz7B8qbMWOG6wgo6h7Kvj3m 5wLBLwAACDYA6GTN/1B9nZBDgBAGgbYvgzZnzBvIa6fvZcuWNTb9q9uxXhT/AAAAAKIOAPqxVrNfX4cAYPBpU8ZNmz alb731lgtttm7dmm7cuNEFA/sdt18Um/5129rL+l2g2fTp09OpU6ems2bNct1B2eeCTnup02kAzP4DAICgA4Cya/6H 4mtg6IwcM9Jdr8mTJ6fjx49PJ02a5Ab3dfyBY8YfaE3hoMl2DambKHuaTJ2WAPDsAAAAwQUAAAC0MmHCBNcNoGJ/7d q17uU777yTLlq0qDJHvQ539xAAAAABAAAgGuoUUseQOoc06z9mzJjadg2xBAAAABAAAAAAAAAAAgBU27hx42p39B/r eQEAAAAQACD6Yj9r+fLl6YIFC1jPy/0BNOgEgNr/YuY+AAAABAAIPQDYuXOnOwpw3bp16aOPPtoIAggAuD8An54VdX k20B0EAAAIAFCLLoC6DuoZ3APlAsO6PjMICwEAAAEAAKB2IYCpW2hIAAAAAAgAAAC17Bqq81IAin8AAEAAAAAAAAAA CAAAAAAAAAABAIA+2XfffZ3afg8+eKICAAAABAAA4g4AdLRjbUOA5qcqAAAAQAAAIN4A4L333kufeuqpeoYAA5+sAA AAAAEAAAIAAgAAAACAAABA4CHAAw88QAhACAAAAAACAACxBwDLli2rZwiQ/4QFAAAACAAAxLsMoJYhQPFTFgAAACAA AEAIEH8XACEAAAAACAAA1CAAmDhxIgEA9wYAAAAIAADEFgBs27atviFA4ZOWEAAAAAAEAAicCrtazfAOQHHXKgCoXQ jQ8mnLfQIAAAACAAQeAOzcubPGIUDi6jqKu9ZdAHLBBRcQAnCfAAAAgAAAIQcAKu7qGwIkhAAluwBqEwK0fepynwAA AIAAAAQABACRhQC/+MUvBiwFqEcnACFApz72sY85LCfiXgAAAAQACCAEUMFHCMAA3g8A3n777XTdunWNEMACgPhDgD JPX+6V7FKi+gYAPD8AAAABAAIavN9000017gRICAFy7gnZsmVL+u677zYFANkQoIx2/071NqNMOggBymh/7w3Xfbfn nns6tQ0APvhtSgAAAAAIABB/oXfiiSfWOABIahMAFBXbeQX7tGnTXBeAAgAtA7AuAAsAbr755qYQwF4vUhQM6L7TPT c0911RsV1QtJd+Cvfmg39u+AKAN998s+sgwIr/efPmhR0AdB0E+M8NAgAAAFDhAMAGfL3O/gSrp0FfdVq1fb0EAEGG AH0YvNclBLBCzTb0syJc119mzpzZcPjhhzcFAFoKsHHjxkYAcM0116SzZ892xf2UKVMahf5VV13VEbvXhuZ+yxZqbQ xBAFCFwtECgOuvvz598MEHO/p94N9T0QQAHT1H8u4pBiYAAKDCAYAGfjb7U+sAINAQQEWaZme1Y7t0GgZoAK+Cb/78 +XEEAB1fz/oEAH7BZkWbBT+ie+C6665zvvKVrzQCgDVr1qR33nmnYwHBeeed5wKA008/PZ0+fXpTF4AV9/7Xzhq++y w7496HACDttfgf/vvCfhcsXLiwoxDA7idd0xkzZqQnnXRSzUKAolCJwQkAAKjoEgAN9DTz47eA1ioM6Kl4rE4IYGu0 LQjIhgFFgYAFACr6br/99vhCgLbXNKllCCDa5M+6Aaww1z0gc+fObewB8O1vfzv9wx/+kP7ud79r3Ftf+MIX0uOPP9 6FAKIQ4JBDDnEBgN1HrQr/4b2/kvLdAO9/0oA39xACDHfLfz9DAD8A0LKRYAOArkMAAgAAABBgAKDBngZ91g1Qq46A nmeQq7UUQO3ZKrL8MECFnuQFAVEEAJ2EAAOua/0CgKJugGwQoGL+c5/7nCv+P/rRjzaxe0vv/+pXv+o+1g8AsiGAff 2hbfnvTzdAXtGfGwQE0vLfLgD44Q9/mN52223pM8880/L3gN/+r2t89tlnp8cdd1x67rnnxtMF0PL3QLsQiQEKAACo YACQDQE0+JNeNoWKKgQIMAjwQ4BWQYBt9qb13mr51qxvXghw2AF7xhUEBNiiPdjdAHlBgIUAFgD8YuHHGwGAve6HAB YA2OcWzfpXcbf/VkFAUzOA/0x4Pwgoc18N/PpppQMA/T745je/ma5fv77w94AfAGj5iK59lAFA4e8BAgAAABBoAOCH AJr50UvN/mzdujV99dVX0/32248QINAQoFUQoAG8v0TA1nEXhQBywqS9I1oS0D4YqMvRXnlBgBXwKvB132S7AMyOHT tciGSdAH4AkJ31v/KYsRUNlFoHAUmL+6pMB0EoRaGFAHr+KwCw3weLFy9uCgH84l/XWh1EuvZaAhBsANDR74EyS0gY oAAAgAoHADb4s4GfWBBgIUD03QBdryOvbgiQ7QYQ29Vd67uzVOxZEecXb0uvOjl9btGF7mUQHQFd/0TVMwDICwIsQL KlACr09dIv/i0cUADQrvj/lxvOSu84+6iK3z/F+wMUhQBJqaUk4dxDes4r/NXz/8Ybb0yvvPLK9IYbbkjvuOMO9z79 Log2AOigi4gAAAAABB8A2OBPbZ+a+dHgT4PARx55xL1t7dq1hACBhQAaqOd1A+jkgHfffdeFAaKd3m2zN7EgwC/iJk yYkB599NFOEsQAN2eWv428GWD7u/+nDkGA3w1gIcBrr73mXloQoJcbNmxIjz322KbuEftc3Sf6Wi/ddaWjEKC6XQDt 9wfICwGKwoKk6T5MgwoAFPoq/PVDALnnnnvS73znO+5j7JmSDQAuvPDC+AOAlAAAAABEEgD4ywE04PNDgB/84AfpT3 7yE0KAwArAohDAggB1A+iIN3+zN1vbbSGAzoDX13nxxRfTW2+9NZAAwCvAOij+y4QA0T9Y3i/cs90AavNXwa8iUPfH Qw891Cj+bcmABUaJ+74l6RHj9kl/9uSdrvgXBQFh7CuRP9PrbwBY2CkQeAGoWX6FAHruWwhwxRVXpJdccok74lEdAf o9YBs++gFAbboA0nrvHwIAACILALTmU4M8PwTQ7M/999+fvvzyy26AaPK+xrEHjmxIQhsIdTxbHEYIYMV8NgRQca8A QMe8+Ru8Wcu3HwA899xz6YQzrkwXLns+uhCgMbubU9z5AUAdHiwq0Oce9hFXrOu66/qLhQAq+nV//OY3v2la+6/7SR 9/6qmnuvtDYZECANHykVcWXxdQANC+G6AoKIqh+NOzXZ1fFgJoWdjFF1+cXn755emcOXPSU045Jf3EJz6RfvjDH3bX 3w8ALrroorADgB5DAAIAAAAQVABgIYDWfCoA0MyPBn/f/e53XQCgHZ81APzyl7/slgVkQwAV/Svmz2ogBKhWCGB7A/ h0FGB2ozdr+VaBp8Jv+/bt7muo+N/x378P75omJQOAgjbfug3qVaRb2751A+ge8PcGMH7xr/tCYYFennHGGY6WjWgJ ifaRWHLpV93Xtg6BYO6dpOx6/w9utSQNd+mIfgfo+a7OL4W/ev6r+Bd1Auh3gJ4NxxxzTCME0O+EKJYBdLqPCAEAAA AIPQCwAaAGfhrs2cyPin8LAPJCABvU/5///YBr+/3V6n8iBKhgCJANAvICAH+Nt4UA1gmgddwSVhHXOgQos8lbnQb2 FgBo1l6z97refjeA7hcLA7RzvN/2Lyr41QGgrhEtHVEIoK+jkyR0v6mVXO3jod0/ectEiu6L4gAgjLXi+h2gZV8Kfi 38tRBAz3+FO6effnojBNDvA1m0aFH4AUAPIQABAAAACDIAUFGvtb4aqNugLzv4Ez8E8G1+5Jvp60sXugBg8uTJ6fHH Hx9WwdjBB+cWjzmFQNVCgJtvvjm95ppr0vPOOy/9whe+4Io6/7x3BQC6B9Ty7QcAurbbl9/mrq/CnqhCgMy1rHMAoN l6zdrbBpD6ebduANH98vOf/9y1g+vvv9/4L+l/Pr84nf+lv0snfPLTrltES0YUBOjztaxAX1cBgO4/PwSo8j3UXMQP XAbQ7r5oHQBUPwTQsi8Lf+35b78DdO016//JT36yEQKoeyyKAKDLEIAAAAAABBcA2ABfgz/tBaDBnjoBsoM/PwTQDJ EKf80GSjYQEIUAFgSE0PLbTQhQdJZ4lTaR80OA2bNnO7ouRV0AWu+tj9X79bn/dvdV6ZZHb0nf/tc70mdvmRPNcoB2 XQB1G9hrtl6z9ireNYuv2XwV8woE/I0CZeTIkenlRx3o7g0FROoY0FIR2y9CVPz7SwcUAFgIUOVugHIz+Ulnz5aAdo 7Xs9ue+9nnvwKAE088MT3uuOPc7wsFAfp98K1vfYsQgBAAAABUPQDwd/623b81qNMgL2/wJxr8yWGHHZYeeOCBbgfo b3zjG40gwPhngle3YMyZ2ev4qgz8GgNDgWp1AqiNVyGAnetuhb/t9K7N3mwTQQsBVPhrace/3/MPAQYA5UOAsu3esX YBaNZeAYAr/N/fAFKz+5rl12y/Zv2twNf9oGBI3SH+EhHRsXKbNm1qFPtiAYCFAOpIqeK91I/grlUw2HxvVTMAUFGf ffbr90K7AECfG95SoYHXrtvnf5oSAgAAgIoFAP4snl/4++c8a7dnrQMvGvypRVwBwPjx49MjjjjCDQAVAvhfx86U94 OASs32Jy1m77tcC1p8PvjwBwF2DaZMmZJOnz7dBQC6xjbjr0Lfzni3nd51DdXynV3vHWwAUHB9kxYFWx03A7RrbBtA qrjXLL9m+zXr/8c3Vrn3//KFB11XiJaG6O/btm1zbeH6Orvttpt7m0IAbS65cuVK57HHHnPuuuuu4AvF3MKx8f8naf d4qHQHgJZ56bme/R2g57+eH9kA4JZbbmkEAAoYJdTr21EYXHBcZMKABQAAVCEA8It+v/D3Z+lEg3ht9KRBnBX+Nvgr CgA0QLQZZvs6RUHA8IUBrYu9rkbnSXv5/97wdQDodQ3i9bqK/cMPP9yxM95tp3d1cth6b73tnHPOaQzsgw4AknLXsP g+qckD5/0CTgGAZvk1228bfIq6QdQZYvtC+AHAhz70oYZseBRb4Z8XACRp2OFRNgSwZ78fAOjaWgCgzUUVAOgYQbu+ Ol5WQrz2pUOA7NGhuV0gAAAAQxwA+DP+KshV3Blt9HTdddc1UbFnIYA2fPIHfjb4ywYAZ599dlPxmCcbBgxHq3+Zgr 2jkVsHX6/sJmKDHQDIIYcc0mAz/v61s2PebL13VB0AJa9VHYv+oiBAs/ya7desf15Bpw6gzZs3u9ePOuqodOHChQ2X Xnqp23hSb483DEgKjwMM9WhAPwSw4Ff0/M8GAA8++KALANRR5IcAfhDgBwLRdALkPC/a5YsMZgAAwKAGABqUWdE9b9 48Z8aMGem0adOaivY8CgE0wLMBn88f/Im1fWY3/PJpNvnqq692hi4ESMrN+HcTAiTdG+oQwAIAXYe8a62iX10b2TPe teZbbd+a+VXxF/QeABW9NiEEAJrl12x/9vrrde0a/+STT7oQ4IUXXvjr8oG/FP533323e6lQUQHARRddlJ522mmNIG Ds2LGN10Of+U86CAEsCAghFFAIoA1fFfj6/Oe/gmI/AFBIYCGAvxQgpOK/IS3eLLRVYJg0PXf8DhEAAIAhCACyNKsv Vszb331W2CsE0FpPY229/uBPR8qpuP/a177mZor0Um/PY4PBoQsBkt71tfjPzhgmQx4A+Dux24y/vW7XxK6TNn7LOw UgyJMAKP57Xg6Qd93t7QoC1OXjdwGoMLQA4LLLLssNAGIIAbIt350EAFUOAexEF234qo4v4z//xTYB/OxnP+sCAj8E CLb4bzX737ZjaOByAJ4jAABgyPcAyIYC2sHfd+GFF+aGABrsZfmDvzz+5lHiF//+soTh2Q8gGSZF/w1DHwBY0e8HAV b8n3rqqenGjRvdtdLu79oATmvA1QZu671V7IU1oO+s7b9M8wcPpYEhwK677jogANBLFf66/1RM6oQAK/71dnUjxbYn QMvyP+f9Vfz/oK4fO+pVvx+03Mtkn//33Xef+51iHQJHHnlkIwBYvXp1uNc3Lbd0rFUAwLMCAAAMewDQqjtAAz216i oMWLRoUXrHHXc0ggCfP/hbsGBBev755zfJfl1rC67WJnKt1+mXXTpQ7nOGt+XXDwBa7c/gz/Tq/HcdAadN4Pxj3tTq rZbvsDoBygYAna33RjEV+DfccIO7X1T0WzCg4l+vq/i3sFH7TMT4wPaL/uwzoMohgIr/FfNnNQIAXcPs7wB1ftnzX8 94LS+79tpr3ey/AgC/C+CJJ54Is3OoRACQtFhqRggAAAAqFQCUDQXU3ik66km7PWtWT/Q2m/nJ0tKCcePGpccff3w6 depUN2C0EKDag8ByBX4nAUE2BKhaAJAt/nUGvLo29NKOgrNd3kWbvakgCKsLoLPiP68oSwrWe6N1CJDd/M86BnQPKS zU8iEdGxjrQ7voZz6EAOBnT97ZFALouaC9Y+yEGAUAFvja9X388ccdFf+rVv31yEg9eywMCHH/kFbP+SRnrf/AFWQ8 LwAAQEUDgLKhgE8zPxrYaW3omWeemR5wwAFuZ3kFAHaCgEIAfczXv/511yKqjwltAJi0CAjKDBSHc91vUQBgxb8txz hi3D6OBvrPPfdcOuGMK10IoGun/SBEr2uzN32uWr5DDwCar1mrws27jszq9UT7iaignDt3rismR40aVbuHeQgBwK9W /1MjANDPu20aqmtme71YAKDnv3V3+PR2fY5erlmzJsj9Q8oFAEVLurrpMgIAABjGAEBsMyjN4minZ7ENn9T2aZt6XX /99Y0AIBsCWBeAPsefCQxiQPj+K603eyqzXnR4uwD8ACBb/L9015Vuxk8BwNFHH52++OKLrgsge43yZnRDDQHyiv92 QU1ox7lVdc8A3VsKAGbOnJmOGDGilg/0qgYAuj7ZZQB+ACB6pvsBgMJfPf9Fxb5+R/gfH3sAUKYrjAAAAAAEEwD4Rz opBND6TtvwSa+r5VPvswDghBNOcPS6ikt1APhLAUxIO4A3r+dMWqz1bL8UYDiKyVYBwL/ccJYLAPRy6VUnu/X/CgFE 10druNWmrRMg7Hx3a++OIwBIWwYAjUF+GvbZ7lWie2n+/PnpLrvsUtsHepXvIQsB/ADANgxVQZ/tANCz3miJmAp+Pf MVBNjpAevXrw9wuUenHQBJm24xnhkAACCwAMAPAbTZk1gAoEGeBn8aBOp1vxvADwEsCAjpLPCBxzp12wUwcEnAUAcA fvGvDf7uOPsoV/zLK4uvS59bdKELAuYe9pH0sAP2TDdt2uSukQUAdsa7BQEhBgCdDMb9gIcQoH8BwO67717rB3rV7x 39zCsA0LPCDwD0HLHTXmz9vz3nLfh99tlnG4X/0qVL0+eff96FPaNHj44qAPjgGVIcAgzsDODnHwAAVDwAsMGgneds IYAFAbbBk832aPA3a9Ysd2SUPzPku+uuu4LtAkgz7Z5Jpsgsf3RUOiwBgN/6rwJfFASoC0CWXPqXgfykvd3bNdungb 9CAL8DwDaD1E7vYYQA7Vv/W31eqy4AQgDEvFxDzwkLAYoCAC33sgBAvwP0/F+yZIl7ZkjYRz2239+lkyVGAAAAwQUA 2W4Af7dnzfJrAKjB3/33399w4403Ntx7771BLwPI2/U5r8hsfXrA8AQA/uy//34LAozWZosFAK+99pq7Tpdeeml63X XXOQoCtJlbuAFApx0DKQEACAByAgDtCaAQwAJehb967idRFL+9BAAAAACBBgB5XQCrV68esNuzdQHYrE8Rtf+HtASg eClA8RrzKq0BtgAgr/jPu876WNvASwHAypUr3dvPO++8Bp3lbme8hxIAlG/9LxkA8HBCjUKAvABAoa9t9qqPUyeAQo B4AoBOl3cRAAAAgAgDAHv5xBNPDNjtWWs+FQDkfb4V/zb7H2oA0H5TwKT1xRzCdcAalPut/2Wus4p+DfSNBQC6Xhdd dFF62WWXuesdxmkAna/7LxsA8HBCHeQFAKKffe3pYiGAXtYrAEgJAAAAQPwBgBX/9jYtA7ANn0QbPrUa+FkhqRnkad OmBRcAJLmhQGcDv6EsIm3wXqb4LwoBHnvssUaxr+sm2iAsjACn2x24868pIQDqGgJoGcApp5zSKP61DMieCxYEiAIA LfdKolr/PnBdf/PPPwEAAACIuAMgO6uvM55FRz2VOdrLlgBIWO2wrYOBsoVm1QOAbAjgBwDWuaH2/zCuXy9HcLUIAI ZwDwegKl0AV199deNZoP1gFAJ8/etfbwoB/AAgzi6Aouc4AQAAAIgsACgazNn7dM5zeEc99b/dvGoD906Lfz8AEDu1 IbuPg72+5557Vnig38s1KR7M+8U/QQDqFgD4z/3DDjvMsRCgLgFANgho98wAAAAIKgBADW+8v4xib7755qYBv7+Bo5 YC6CQAufXWWxvHfsX1PSju3uBUANQ1BPBDRRX8/lIA/d1Oe7GgMNZlAEVLAYb6qFcAAEAAAPS988NfAqDi/6STTkrP P//8dO7cuc78+fPT3XffPfofRgIA1D0EyOsqsmeFdQz5G76GttyrlyVF2eKf5wIAACAAQNBhgAb02sBRAYA2BdNa4J kzZ5ba/yH2EID7BHUIAbIBgF/o+8uELCyMJwAoXlaUfQbwbAAAAAQAiCoIGDlypNv3YdSoUemIESNq+YPJAB9IB2wS 6lNYGFcAQDgIAAAIAAAABAG5+N4AAAAQAAAAAAAAAAIAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAAAQAAAAAAA CAAAAAAAAAABAAAAAAAAAAAgAAAAAAAEAAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEACglg6e dpbD9wIAAAAACAAQoMMv+FaTosJ/7iObnbyPAQAAAAAQACCAAOCejb9Pd/wmHVDgq/C3t+t1fRwhAAAAAAAQACCiLg C9tFl/Ff/2d0IAAAAAACAAQKTBQLZbgBAAAAAAAAgAEHkgoCUBFgAQAgAAAAAAAQAiLP5V8BMAAAAAAAABAGoQANiG gXpJ8Q8AAAAABACIOACw4p8OAAAAAAAgAECExb9/MgBLAAAAAACAAACBOWLcPm2Lf5/tAcAyAAAAAAAgAEAEIUCSJA Na//09AOgAAAAAAAACAAQYABgr/i+7+9GmDgAr/tkEEAAAAAAiDAAo8urjly886CgEsADgP371P00hAMU/AAAAAEQY ALDTe71ceczY9Iwzzkife+45FwJYALDPp45sCgFivh+S9/9wP/T5+5rwPQUAAADoAEClWACwcNnzLgQYN/MaFwRYCB D7/UAA0J9nhn+fzD3sI45CAIIAAAAAYIgCgH4WcPo6U86dz4WJzNixf+0C0PW15QB+CBB7EUcA0Ptzwd8gculVJzv3 XzjNdZhYEMD3CgAAABiEAMCK/n63cNvXIwSIt4jLCwGEAg5l7p01d1zu/NvdV6UTJkxIjz76aKeO90/i/eE+AQAAQN 8DgGzRb7NyvYQAfgdBXdaE17mQU+GvWVuxjQFp40aZYFAv31zxbXffHHPMMa7wf/HFF9Nbb721dvdPkvnDfQIAAICe AwC/CPeLc//4NjvHvZcAwP9cf7aPCxQfin50c89YeKR7Ri8ff/zxxt4SE8640u0vYfeTlpUw+w8AAAB0EADkFebZ1n 8r/C0M6FcXgH8snP92Llj4jj322PT88893L+uwAeBAiSfO2fp+fJ1TTz3V3Sfz5s1Lf/zjH6cTJ05sUKGvWX8FAHqp 4n/Hf//evV3Fv+0tEc99kgy4b6oaAPCcBgAACDgAaDWzn7ccoJcQIDv7b/Q1/ZdctHhCgPp2e8QZAPTriE8V8voaCg EUAMj3v//99IILLmgKAYyKfVtWYm+rQwgQ6/UHAADAMC4BaDeY87sBbOa+H50A2a/NsoC4KADYsWNHTbsA/lrcJXQA DDB+/Pj04GlnNZ4h1gkgCgDOOuusRgBgG0hasb99+W3p60sXpv/nfz/QCAbCLPrLhABxd4AAAABgGAKATmd+rFDvZ7 HudwNwweIpEo26Aeq7HCDeboC8a17mdA8V/34nkUIihQC33357IwDw75//+NX/ODpRQkX/2/96R/rsLXMCDgCy3RBp MMU/AAAAahIA+CGA4ZuLIioE/dMe2PixHqFPmSM+/dl/dQOokFcIIAoBss8Z/d3W/VsI8O/3/EMkG0wmjRAgye0OCC fs42cAAAAgsgCA9k90EwLY0hHdO5wKEGenRzYgzD4n7O9W/FsYNGvWrHTbtm0DNh/NHkGaFwKwTKRawQ8/DwAAABEG AEA3BaIVfAQAcc76lz3i0w8A/O6Q7Iy/v9yoKATg+8++AAAAACAAQIVo7b/Wd9d3n4f413R3csSn3Qt+ga+Pt8/xC3 7/fRYAhL/7fxLddaf4BwAAIAAABhQLvR4hiepf43ZHfNoRfnmbivonjGSDAbtn/KMB+Z5XY4lPdp8PvjcAAAAEAAAb AdZoPwB/eUDeqSF+CODP+Gf3AOB+CWeJj4U8fF8AAAAIAEChMGA2F/UpEPOueTYEyNsAkHul+iGP/Uzzsw0AAEAAAB QWD4CFALY8wA8MuFeq9/ObDWX8t3HdAAAAIgsANEAPd/MtAEAvxX+rIx79fT74ngEAAETSAeCHAHp97mEfcfhGA0B9 Zv+LPo6lAAAAAJEtAbAduP0duZdedXKDAgF26QaAuGf/sx/HPh8AAAA12QPADwMo/gEgrgCgzMaM7AEAAABQkwAAAB BnAGDH/DG7DwAAQAAAAIi8/d86APp5POO4ceNq/j2mWw4AABAAAAAqGAD0OwQ49sCRfJ8BAAAIAAAAVQsBbBmAvx+A HwTY36XMkbELZx1FFwBdAAAAgAAAAFClEMCCAIUAFgT43QDG9gmYOHGiU98AIClZ3BMAAAAAAgAAQEW7AawLwA8BLA jQ2z590qXp/tNnp+vuu4YOAAIAAABAAAAACD0E8It+m/nX20Yf9FlX/N97zfnp8ccfX1j8aw+A2AOAJE0IAAAAAAEA ACDsJQF2PKCxTgA/AEhyCty6FP/M/gMAAAIAAEAUHQAq+v1N/ywU0Osq8IsCABX+9S7+E4p/AABAAAAACKcDIHsUoA p/UQjwd189x4UAMmLEiAFfo8wpAfVZBgAAAEAAAAAIkAUBe+02wnUAfOPko2sdAAAAABAAAAAAAAAAAgAAAAAAAEAA AAAAAAAACAAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAAAAAAAAQAAAAAAAAAAIAAAAAAAAAA EAAAAAAAAEAAAAAAAAgAAAAAAAAAAQAABA/x5KSeLwvQAAAAAIAABEHgDs2LGj1iFAkhKAAAAAgAAAQA0CgC1bthAA cC8AAACAAABAHUKADRs2EAJwLwAAAIAAAEDMa/4JAAgAAAAAQAAAoOLFez/W/GcDgNg3Bswr9gkAAAAAQACAYTFu3D inrju0J+//4R4Y1/j7qFGj0u3bt/clAMiu+dfr+tqHHHJI09/1b5b5bxuKe6Cf90RRAFD23+P+BAAAAAEA+lb47dy5 s2H16tW1CgKSnD91vQesyB47dky6aNGidPbs2ekBB+zf9zX/erlt27bG3/Vv6N/atGmT+7fb/fcN5j3g/vdH7y1/Gp wQoKn4/5P37/0xafvfF1PgNBThTgjPHX4XAQAAAgAMy0BcFAJce+216cSJE2sZANRtYJ4tsFWYv/POO7mz9oMRANjb 3nrrrdzgSf9d6iIYqgBgMNr2WwUA7b5+TPejPWP80HEww52Qnjf8PgIAAAQAGLZBuop/hQB1/cGp06BcRbdfhE2ePD m3QF+1alXfAoDXX399wNdXka9/O+9+XLdu3aAWiU0dAAXXfigCgFZvD/1+1DPFL/jr1gVA2AgAAAgAUAlqu1YBpuLL 2v/rtBeAtV3XdRCua62uD78DILv+X6//7Gc/6+q+sK83duzYlgHA1q1b0/Hjx+cGAI8++uiQBQCD1QFQ5uvHHACo8F cIUMeW/zoGiwAAgAAAFaSN17TeWy3fmvVVobZ27Vr3ct999633rNyfk1qGAHpd90C2QP/pT3/adQDwxhtvNAUA69ev H/D1N27cmE6aNGlA8b98+fIhKRqzXQBVCAAoGgEAAEAAgL4VfSr0tQGbP/Nv9L7TTjk5nTBhghNzAFD0vt/+9re1KM B0vW3fB78DwG/bf/PNN3vqABg9enTj76+88sqAYwD1MYceemjT5+qkgAULFhAAEAAAAACAAAC9Fn2St9O73q5i7IUX XnCF4ZQpUxrHtkX3ffhTUro7IOb7wd/3Qd0ffkHeawCg7hK/A2DFihWN+0kvV65cmX75S9MqEwap+6NM0d5LAJDdc0 BhU8z3l+4ldXhomYctNxozZkwtlwC0CpoAAAAIADCsReHTTz/tCsM6bgpY54261P2hAEj3wO677+5eP+igg3oOAPQ1 /ABAheGyZcsqFzD53R/2589//nPPAYC+Rl4AEPP9NX369KblRboftOxIy4+0DKmOzxK6OwAAAAEAhr0bIEuFn6nrD1 FdB+la9qHQRwFQLwGAbN68uTAA0Ev9O1ULAPIKNQKAzgt/K/7zni9afpTdcDLaX8YdLkECAAAgAMCg0SBcx7xpp3dt 9qZ2b1HRZ8sALAiIcbCedPCnTgGAln7YtddL3Qvd3l8WAKjQzwsAqnZf9fP6tyr4Y72v1Dmi625LSfKu7/777x/xqS Pt7xuKfwAAQACASnUCaLZWVPhZIGDLAepwVKBma/0Z27oFAVac63WFALoH9Po+++zT0dd56aWXGp/jF//2b1T1Xioq 1Du9/q0K/ljvJRX+CgGE7iF+twAAAAIAAAGxZQB6fa+99kovueSSjgIAfY5eX7JkSZAbSvYya1+HGf+sOXPmNFjIky f7vjotAaALAAAAEACgsjSDqyJuxOdHOJ///OdrOaPndwfUrTvEugF0/TsJAJYvX94o+qu43r+bQo4AoLj1X0W/OgBs KZF54IEH3IkPWm5kmwHq5YYNGxrCDwKSjpcV0S0AAAAIAFBJKvpEM8Eq6rROvK5tvXUcsPsBgO6BsiHAww8/3BQAhF rgFR3l12kAEPt9omJfIYAtISqa/c+zZcuWdMeOHUGHAP08MhIAAIAAAJUIAubNm5eOOHhEevDBB9d2fW/dWnitKFP3 hwIg3QPtPkf3yEMPPRTsrH9asDdEtwEA2t9jMS8HAAAAIAAAEBx1f6i4LxMAPPLII9EVdJ0uAajjPaKTH8zo0aMbr9 elyKfNHwAAEAAAiEaZ7o8q7/I/FCEABd9f75N41/x3HwRwbwAAAAIAAEDUrf2xrfnv13IiAAAAAgAAAGv+AQAAQAAA AAAAAAABwCB9YZ3z3MtaUB0PFfY3N+ntonBzAgAAAABCCABUwOuc524+d+rUqe5zFQRYGBDiMXLdFvJ5G0ARCgAAAA AAKhMAaNZfuzerYLeXvQQAe+yxhyv8H3jggaYAQEeLVXXWvx8Fe1V2gmbdLQAAAAAQAAwwffp0V/QrBLDZ/4MOOsi9 T2c6dxMA2OdZCOC/X/9W1YKAohn7Tov3vNn/7NcbikBAhb923tYO3EW7c7cLCHS+u+iYt1B/QPrxvaaDAwAAAAABQM EeACr47fP0dfT3GTNm1DIAyPt6Q1VQWoHvn8mt7/0bb7zROLNbNm/e7P7+0ksvOcuXL08ffvjh9KGHHkofeeSR4LsI kh7/8LABAAAAEEUAYMX/oYce6v6u2V4FAFb0qZDvZA2/Pm/lypUDAgBbUjBr1qzKBQD9nrGvSgCQtxxA10VGjx7deN 3ss88+6V577eXuARPbEgKKfwAAAAC1CAA0w79z587G31X0qxj3W8H10g8AVCjax5QtNletWtUIAOzrWRu5/ZsKHrKf q3BgKFvCi4q8wQgAigKGfrWas+YfQCV/UfFsAgAAGPoAYNy4ca7494/4mzRpUrp27dqmgZle14y93wGgNvFOAgAV+A oO8gIFGwj6XQc+/Tfqv3UwZ36HIwAouz6925nnTtb8+9ShIQpoVqxYkS5ZsiS99tprnTqs+f/zn//sMPsPlF/mpaVc Rn9v9YzRM0nPplgCgE6fFTxPAADAsAYAfnE9fvz4AbP71sLvBwCddgDo4/0OAD9QsLcpeFAAUea/s44BQLchQN6af1 vr//rrrzvr169PX3nlFVfw+2Jp/U/68IcHDJDP9okxer7rd4Y6v/S8Ef8ZFOPsP88SAABQ6QCgqKiePHnygNl9a+H3 Z+xtEFe2CPU/Pvv1/JBAAUQn/739LP7LBgDdtOaX+fx2SwF6GTz6s29WzOfxC/5Qd/rv9Fq0GsTzUAHKdwHoqNfsPi K2t0jsbf8U/QAAIMgAQIOzd955J7c472cAkNdlkP13hyMAaFWcD0UA0M1/LwBUIQDoZHPY2PYE4PkMAACCDADGjBmT Llq0KJ09e3a6//77NwZnfldAPwIA/+vp39G/p39X/34VOgDatez3MwAoM1PUrwDABtkHHLB/7vs06699GKLvAvhT++ 8zA3qgs2UAav1XCGD7iJTddySWPQG6XqrFswYAAAxXACCjRo1qmqFXEZg3Y2+by7UrOLMfZx0AVlza3/Xvtvrv7ece AO06ADrdF6DTlvNOjxbs1wDRvtcKXPIG4lq3u2zZssamfzG265YNWhiQA513ACgEMP6eALYfgMLfGPcEYH8RAABQ6Q CgXVGdPQYwO+NvO8yXCQCyH5fXETAcg79OBl+DEQAM102ioGXTpk3pW2+95cKZrVu3phs3bnSD8i9/aVoUm/51O1D/ 7W9/y6Ac6NGMGTNcR0DRfiPZt0f9C7mDtwMAAAxqANDJrHFey3+ZwVvex3S6hKDKA7mqfL1OjR07xn3/temjNl7U6Q t5RzBG+4Pyx4QZfwAAAAAEAGUDgKp8PQIAABh+EyZMSKdOnerMmjXLhYrZ57z2fKnTaQA8+wEAQHABQCdr/ofq64Qc AjAABBArLSXyZdv/tf9Idk+ZugUA/A4AAABBBAD92KW5X1+HAAAAqtkFYKZPn+6K/bVr17qXOupVp7202vA19kCAAA AAAAQRAJRd8z8UXwP9p80gYz3yr5NBOvcC0F9aBqA9RrTXiJ79RUe91iEAIAAGAABBBQCIp9jPWr58ebpgwYJaz8gx MAcAAABAAIDoAoCdO3e6vRjWrVuXPvrooy2PhCQAAAAAAAACAETSBVDXln8KfwAAAAAEAAAA9EBHAdb+FzL3AQAAIA AAANSBlhvVscso223EvQAAAAgAAADRLzeyEKCOy47YbwQAABAAAABqFwKYunUEEAAAAAACAABArUKAum46mg0BuB8A AAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAEAAAAAAAAAACAAAAAAAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAA AAAAQAAAAAAACAAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAA AAAAEAAAAAAAAEAAwDcBAAAAAAACAAAAAAAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAQiX333dep7ffggycu2v jYxz7m1Pd7kLyPewEAABAAAAg0AFi3bl19Q4Dmpy4KTJw4Md25c2eNA4DE1f4EAAAAgAAA0Q/8hVm/eAOA9957L33q qafqGQIMfPJGac8993RqGwD0fH0JAAAAQEABgA3+ehkAMstX75m/+oYAcQ/8CQDqEwC8+eabXf8esOfAvHnzwgwBer 7O/nOA3yMAACCAAECDPxsAMsjnButk4L9s2bIahwBJbUKABx54gBAg0ueD/Q64/vrr0wcffLCj3wNW/Os5EE0A0NF1 zhb//A4BAAABLAHQgE+DP38WqFZhQPF3GgQABADvveeucy1DgJo8FywEWLhwYUchgAUAN910Uzpjxoz0pJNOqlkIkB cA8LsDAAAEEABo0KfBn3UD1KojoPV3G20CgG3bthEA1GAZQC1DgBo9F7oJAfwAYNq0aeEGAF2HAAQAAAAgwAAgGwL8 8Ic/dHpZFxpVCEAQUDj418C/vl0ACSFAbbsAkmgDAD37b7vttvSZZ55p+ez32//1HDj77LPT4447Lj333HPj6QJo+e wvKv4JAQAAQAABgB8CaPCnlxoAbt26NX311VfT/fbbjxCAm69p8H/iiSfWOABIah0A1Opa1zAA0PP/m9/8Zrp+/frC ENgPAObPn59ecMEFcQYAhc9/AgAAABB4AGCDQBX+GvyJBQEWAkTfDVDuCkRR1Pl6CQCCDAF6vqZJbUIA3R9a5lHbEK DwORBvCGC/AywMXrx4cdOz3y/+b7/99vS6665zAYCWAAQbAHQUArQr/gkAAABAIAGADQI186PB34033ugGgI888oh7 29q1awkBIggBVNStW7fOFXXSaRigAmDmzJlu5i+KAKDja1vfAKB2IUDLeyXOEECdX3ru6/l/5ZVXpjfccEN6xx13uP cpCI42ACj9/CcAAAAAEQUA/nIADf78EOAHP/hB+pOf/IQQIJIQwAo6CwKyYUBRIGABgAb+KgCiCwHaXuek9l0AoqKP ECCJLgBQx5e6APwQQO655570O9/5jvsYuweyAcCFF17oAoADDzww3md/SgAAAAAiDADU9qmZHz8E0ADw/vvvT19++W U3E2RqGQC8PwhMIlgKoNlcDeb9MEAFn+QFAe0CgCSUAXBnP3kEAJkugNqEACVmhGP6/6tnukIAhb4WAlxxxRXpJZdc kl511VXu94J+R+hnPxsA+F0Axx9/fHr44Yc7MT7/2z0H/D8MXgAAQKUDAAsB1PapAECDP60J/e53v+sCALV+z5kzJ/ 3yl7/slgUQAoRf4PkhQKsgQMWejvzSoP4rX/lKOnfu3JYhQOIGxEn41zopJ/YQ4Be/+MWApQD16ASoXwigZV8WAuj5 f/HFF6eXX365e/afcsop6Sc+8Yn0wx/+sLv+fgBw0UUXuQBAvzemnDs/feP//r909IETahMC+AEAgxYAABBMAGAhgG b9NfNjgz8V/xYAEALEGQK0CgJU6PlLBPR3Df7zQoBjDxyZTpgwwX2dygcBnQz4SxYA9gMbQyFgAcDbb7/t9o+w+8MC gPhDgLLFYDxLAfRc17Iv/Q5Q+Kvnv+j3gZ79X/3qV9NjjjmmEQLod4G/DOCcc85xAcDHDp+RfuRTR4a1LKCj38oEAA AAIJIAQEW91nyq7dMGf0YDwDPOOMPxQ4ColgZ08MFJ3scHGgJkuwFEM78q/rZs2TLA5z73OVcAZAOAP/3nFhcALF26 tDETGEUIULIAiCkA0PUUXe933323KQDIhgBlBBkAJJ3fCyGvEVcIoD1f1PVlnV/Z5//pp5/eCAH0e0AWLVo0YAmAOg C2L78tnOVBPYQALAEAAABBBgA2UNcgUGs+NeDTzI8N/vwAwEIADRJV+OsoKckGAmGFAp1P61sI8MGnhjfwt1n9vG4A zfyq+FMYIGvWrEm//e1vp3/4wx8cCwL8EEABwPe+97307xcsTi+/7/tu+UC1i4Durnv2emeLgKYf4ECKfZ+um+4NBQ C69tYFYAHAzTff3BQC2OtFqh0UFBTtPa4N787whwDa88U6v7LPfy0F0Kz/Jz/5yUYIoKVjCgD0sy977713Om7vXdLL jzow3fDg/4o+BCAAAAAAQQUANvBWAWdHPWkQqIGeDfyyxb/OhJfDDjvMtXlqE6hvfOMbjSDAWFFY7RnADwZxjXF/lz PC+TVEGEFAUQhgQYC6Ae68805X+H/0ox91tFTADwE2btzovs68efPSM88801EhGcZMYGfFf5kQoGrFQFHRbT/P2ujR aBbXDwB0/XV9LQC45ppr0tmzZ7trP2XKlEahr+6hTqiLxJ49g/+c6LAYH6IAoPleqsZ+AP6z33/+6/eC7pXjjjvO/Z 5QEKAQ4Fvf+pYLAfRzrqVAYiFAEtpSiR5CAAYtAACgkgGAP/j3C3//qCdt+KQ1n37hr8GfDQCPPfZYFwCMHz8+PeKI I9wgUCGA/3VsZrh6QUDR4LuLwX/ayeA+qXwIYMV8NgRQ8acA4He/+50r/n+x8OPu5Y4dO1wI4AcANhMon/nMZ1wRsO nhG6MIARoBkdf9EVIAkP1ZVwFuNOOrHd5FGz5aAKDOD117sYDgvPPOcwGAWsKnT5/e1AXgF/dFhufZUOY4t/4/A0J7 NigA0PM8G/z6z/+iAECfq59zFf8muF+6ne4R4l9LZv8BAEBVAoC8ot8vBuyIJ6P2Tq311ADfBn42+CsKADRItCLAvk 5REDD0YUD+TP1QzQDm/3vVDQFsptenwk+z/tYBICr+X3vtNRcW6Tpv3769cSqAzQbaLGAYM4Gd7/2QFwJUOeSxn0Vt 8pcNAuznVqc92B4AtuxD4Y9tEvmFL3zBrflWCCAKAQ455JCmDSKrU/gPDAFK/fwnLTo/eggBqh4KqojXHi/2TM/O/u taZwOAW265pSkACPqXbichAAEAAACoYgCggVm26C+a+TMayFsIoDWfVvhr8GcDwGwAcPbZZzcCgCrO/JUe9HcaAnQx 61flAsCfzW0XAFgIsGHDhkYIYJ0AVvSHVxB0FgCEGAIUdQD5QYCuv66tv+zDX/5hS0B03fWxfgCQDQH8IHD4u4FKdA AlBcVddh+ILoLAELqBsiGAPf/9AOBDH/pQIwDQ80G/Z3SMoP9zH2oYUDoEyHb/MGgBAABVCQCM1mfLjBkz3Ppsv2jP oxBAgzwN+LL8AaCoW0BarQfWLNLVV19d7bW/nYQAEa39LQoBtOGb1nyr7Vszvyr8bAmABQA6PUJdIdkAQGeKh1kMtA kBcgrColMBqr7soygIsBDAAgD/mtvrfghgAYB9bnVm/cvvAdL65zT1n8wDA6FIlgLlhQDW9SV5z3/9nOv3i+4FCwEU HkvUIUBOsJMM+L3DQAYAAAzjHgAWBGhWX2wwZ3/3WWGvEEDtnkYDP3/wp0GeCkMV91/72tfcYFEvbQDo02yS/v3h2/ 27jyFAn3b+TipcHFoIYK3eavsu6gLQfgD6WL1fn2vFv+6RAw44ID311FOjCAHadQFkZwOTNKl8MZAXBFgBr2ubd82N rrs2DbROAD8AqM6sf29BQKtCsEwHQajFoEIAnfaibi9f9vnvBwAKCSwE0Pu/+MUvhtsR0OLnvfgaEwIAAIAKBQDZIE A7+PsuvPDC3BBAg70sG/wV8dePGndc1BlXVmBAmAyjcG5APwRQd4dCAL8g1Ovy0EMPpb/5zW8amwhaCKDXdY0VAKgD xEKA0PcEKGwJL2wJDuP6+0GAdQPYUgDb8DEb/OhaKwBoV/yHcd3zC7pWIUCrACAJvAi041x12ouWe5ns8982AfzsZz /rAgI/BNA9oo+13ylRHAuYtA4Ain/2CQMAAMAwBQB5ywP8UOCiiy5yYcCiRYvcOc8WBPj8Yn/BggXp+eef3yTvax9w 7Gnpjv/+vRsEbvzHGyowGGy9Tr/svgHlPycNLgAQHfWmtb8KADTTawWhij+t/9eA32aAVfj9/Oc/d5932mmnNUIABQ A//vGP0yVLlri36x4K4mSAgi6QVte6dUtwte8HXZNsN4CFANrw0UIff/8HXX9/A0D7XPtaf/r5K+m/3X1VeuUxY9Nb b701iOteeNRjiQCg+ZZJBj7UAwoAdKSrfidorxeTff7fd9997vluHQJHHnlkIwBQ+Gd7x4iFAEEEAWlS+vlfPgAgBA AAAMMYAGRppievcNcMj2i3Z234pJZP0dts8JdlAzwb7OlYuP0+N911AIgCgGqEAN2FAp0W+yEN/PM6APS6BvB6XcW+ Zn3Fij+bAVbBoOUgFgC8+uqr7r666667GntB6GO1qaCWi4QwI5wbApRc751dGhBSCJDtBtB1V8GvPR+s88Ouvy0ZsF l/+7lfetXJrvjXz//RRx/tBNP9UdDenbQoDov29aji0ZBlAwAd8ZoNgLXsy8Jf21/m2muvdfeDAgC/C0AhgNg+Maby XSEdLPEoDIxafj6DHAAAMMwBgGid9xVXXJGec8457nUN3PMK/OzmghrETZ061dFgLzu4s9dXzJ/lWACg16s0AEzSvL Pc228UFlKrdzcBgO30bmzG3y/+nnrqqUbhOHLkSBcAiIoIXeNf/vKXjQBA95eKgGp3AnSzn0Px/RFSCKAjHP/0n1vc tdTGjmIhgIo7dYBo2Ye/9t+uf/bnXjP/KvxffPHFQDoAynUD5Bd8SdvnSmjLACwE0DIubRxrx8MqALBuL7vmjz/+uK Pif9WqVe5tZ555ZnrDDTe43wtaQmAfu3jxYqfqIWC5ZR75uWCaGxRn3w4AADCMAYBmdaecO9/R6woANECz9aAa2Fkb sK351MyPPkYvFQDo9dGjRzcCgVZBQNVmgPwBetOAvU3L78BNn8IPAywAsKI9y1/znS3+VqxY4XYRV/HwX//1X423// rXv3Z7ASgA0EttGKnugGoWAd0U/8WFQNpyyUC1OgD0c28s1Nm+fXvT3gD+fWDXXy3en/nMZ5pOgFBBqOLxueeec90/ C5c9X/kQIBsAli8E3/97znMkxC4gCwD8a64AwDZ6tQBAz3n7PeCzol90T6xfvz5dvXp1o/APZTlI+dCv+BnSzSmzAA CAAGBIAoA3/u//Sz92+Az3+t577+1mA/1BnUIAzQLamk+9rkG+P+g76qij0nHjxjVCAJvpzQYBlfym5wUAHRVxcbR8 +gGAZM9499d8W/EnKhqyhYDN/GkHce0dYLPKzzzzjDuSUi9DWA5SfuY/72ulBYVAtUIAXQcV9EuXLk2/973vuQ4fCw LsuukaWhigAtHCH13/v/mbv0nffffdxrXXrL8CAL1U8W/7gIQSAOR1AhUd/ViHAEC0fCcbAFjY+6UvfanR9v+3f/u3 6aRJkxwLAn70ox+5j9PviBgDgHLLBsJcFgYAACIMAGT0gRPSj3zqSPdy3N67uABAL/3C3UIArfcUCwBs8Ke36YhBhQ B6m4UAYWz+VqZISjts8w4vCMgGAFb0+0GAv+ZbM78q/tatW+da//U2m933dxHPhgNW/IcYABQVfza4L7M8JKnk/Z24 LqC/X7DYtXBbJ5B/fKdCAG34aHs+WKeQf/395UD6GtpBXksCJJTnQHPxnj+j2xTwDPj41oFiKAGA/czrmZDtALDrbI W/7hn9rI8dO7bRMSZ6m5YD6GM//elPB3A6RKcnPZTtFiEAAAAAFQoARBu3bV9+W3r5UQe64t8PADTwsxDAggB/wycN /vRS64MtBNCAUXsK5HUDhCcZsLYzKTlgDCkE8AMAm/X32VFvdi3V4quZX7/4U5u/ZowtBNiyZYt7OWvWrPTOO++seA FQNgAomulNWt4bVW4D1vVQJ9Dl932/KQDwr7UfBmjPBy370Pv8668C0ZaQ6G3zv/R36eZHvumeLa8vXRjEMyCvcG/V BZQXFoR8FKBtBGkBgK6nHfXqr//Xsi/N6iv8td8D119/vft5z4YATzzxhPuciy++2L1UUFDVZ0D753n+86LMvjGNoJ AwAAAADHcAYEXAhgf/VyME8AMAv4j3N3yyNZ9+CCAKAdQ2KuF3AyRp8WZOSQchQBJsAJAt/v3uEL/4E4UA2jQuLwTQ 0XJ6uzYZ0/IACSUASDr43HYhQBXbxHVdtDxD1N1hS4Fsfb/uAdvoUbTnQ/b6a/mAf/qD3qdTAbY8ekv69r/ekT57y5 xKPwPyrktzd0fcy4DsOWAhQF4AYPeKnut6ziv01TPfugGyIYBet8DYDwDCDQFaX/MyYVGoS0QAAEBkAUDRWn39/Ytf /KIbzPktvrbmUwM5Dfr8ACAvBAi7G6D1ALB8AJAEFwBY8W+zvzrqLa/4V/FnsiGABQDbtm1zb5s7d647GnD33XcPIg DI29W7XCGQFhYCVSwCdG2sE0jsGtvPre4FHfXon/agZR+63nYP/PjHP24KAPR1LEz493v+wb0e5MO5oAsoqVkAYPeE PdP9EMCCAIVG/jIg7S/hPzNiDgCKjpNs12UCAAAIACpXGKgI0Nnw/ppPbfZkszwWApxwwgmOXtdg0gaGfggQZjdAmV meJOggQNfLDwCyxf+ffv6Km9HVmm7tA2HHvNmsr4o/FYHZTgCtG9esv98FsMsuuwSxDKCo+C9aK95JCFDVn/VND9/Y 1Olhs7t6XcuFsqc9aNmHrrcFQN///vddAHDWWWc1PsbfXDTsLqCk1GkPMYQARQGA3wWgPV8UAthz3p79//zP/+x+L6 xZs6Zx3a3DpNoBQLsQoLPQsGjZEAEAAACofACgHb8tANDGTn4AYCGAZn5sWYCODbTCIU91j4PrLgDoNARIAgsArJ1b 68N1zrsKAtHb/c0DVfxZACC26Z9CAAUA8vLLLwezD8CAI/9yB/FJVyFAlX/e/UJP19Gur/3c+t0del1hj3UCiO4JdX mI3q7isPqbwJX92R8YDMS2IWhRAODvD6EgVyGA9nyxEEABgO6JZ599tikA8JeZhBwANBfunQUAVe7+AQAABACFAYDO hfbbPLMbPmnmR4O/+++/v8mNN97YcO+99wZYCCSlQ4Ayqt4B4Bf/dg9o5l/F/4svvujOeVcHgBUE/rFhRoXfpk2b3P t174gCgCeffDKIACBb/OcFAL10AQTzcHo/BLD2/l/+8pctQwDJBgAqElUganPQODqAug0BwggD9HOvZ4CCOyv+Dzj2 tHS/z01vKuh1LXVNtdRLIYB+Nyj81TP/+eefT9evX5/utttujY/XxoFS7QCgKAQov3Qo/9QIAgAAABBIAOCHAAoANO DXwM4G/34AYDT4yx4BlxVuK3BS+vzn0Fp/LQDwW//t+qvgVwDgCv8zrnTnvOuoN+32btdUbd9W+ImKPoUA2vBv8+bN wXQA5LX+t9okrkwXQdGsYCghwJIlSxqdAL/+9a/dNfU3esyGALr+KiBPPvlkVySKtYHffPPN0SwD8ou8siFAEsCzQM +Aq6+++q8z/3/5ed/x3793L1fMnzWgC8D2e9HnKQRQAGBLfXRigB8aKACo/rVvt/dHp3uApC2eGQAAgACgwkWAAgC9 XL16dfqjH/2osRzAqOVTFBBo8GczPjbos6PDwhgEFg340pwZnvyZn6KisYqDQAsAsrP/2dZwUfGvgkBdATrqTcsDbO M4K/5V/KkosHX/8sILL7g149XaALBVgdevToK06b4JbX24/dz63R3vvffegNMe9Hct+1Doo/BH118vrfB/7LHHmpYR hBoAFJ/2kLY9Ei6EAMhfBmBLgMQPAPwuAAsBbCNACwDs2f/pT3+66XNCuNblAoA0bXf0HzP+AAAgigBg8eLFjUGhzn nWUU/+bs9q+7Szom0AaMdA2U7QYYYA/kxfmhMGNA8KizZ+quKg0AKAvOK/aJ24AgDtHK+j3myjN5sB1syvCoKVK1fm Hh9Y1QKv9wI9/G6QvOutQk/BzjnnnOMoyNHb1dVhAaBCH7u+CgEU/uj6i4p/e5+eI6NGjYomAMhrFW+19CeEotBCAA sANv7jDQ1FIUCrACC8pR+dPAvaBwCEAAAAILgAwAZ7Vvz7Mzt5hZ1e1/ut+Bcr+sMNANIBg7t2FzZvEFjVAMBv/y97 P7y+dKE75912e1cRoDXf1vLtBwAhFHgEAMXXWrO8Kt4V8FgAcOeddzY2eNRpDwoBtN+Dlghknw16vx0DOWLEiAiWAa UdnQIQUkGYDQD8EKAoABAFANrrxf8dYc//sDo/CAAAAAABwIDZf/EHdyr4sruIa3Bo77dZoBgCgLzZvLxBXt77qxoA dFL8+/fEs7fMcee827W3Dd+s7Tu8tt/+F4qxhAD6GVbAYyc8iGb6t23b1ggCFABoz4fsdVcooOK/msdAdhMUpYVt/0 mbQDCUfUH854Gup1/8Z++LbACQ/f1goXB4IUD3P/Pt9w0BAAAEABUvALKz/D5b6+sX9/771RZux0CFuw9AuRn/Mh0B MQQAdo39s96zxb9mflX8SZ0CgBjXAut6ah2/rq8fAlgQYCGAaM8H/2dc17+a+z90EwLmHPPWJgSI4R4omsW3ECAbAF gngN5nz//YnvutwiE6AQAAQNABQN6gzwp6n7/xn78cwAZ/2ffHUvS3GuiFsASgm+K/qBBQgWgbvlnbd7WLvyTt3+Z8 8QYAdo394t9a+/W6TnnQUY96acsEonxoF/1sF+4LEvkvMS8AsKNetXGkHwT4z3+9HnsAkPc7IJYgCAAA1DQAaBUC5L WJ2uBPA0NbLhDbzH+7wV0dZoJ0Xe2oN60ZD7/tu/e9ImK73v5MsN/a7xd8Cnzine0t8zOd1OyeT5pOebBCPxsO6/kf ZwCQHwyVCYgBAAABQJDFQJld3v3BYF0vdh0GgHYfaLf3MDd86+/1jvn/Yyyt/Vzj/gZDfreXT+FvXZ7/BAAAACDKAA AAgDLhcJJQ/AIAAAIAvhEAAAAAABAAAAAAAAAAAgAAAAAAAEAAAAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAE AAAAAAAAgAAAAAAAAAACAAAAAAAAQAAAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAAB AAAAAAAABAAAAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAABABA7w6/4FvpwdPOcvh+AAAAAAABACIOAOY+stkh BAAAAAAAAgBEHgLcs/H3hAAAAAAAQACAOnQBWAigv/N9AQAAAEAAwDcBkS4BUAAgBAAAAAAAQACAiAMA2fGblC4AAA AAACAAQOxLAAgAAAAAAIAAAAQAAAAAAEAAAIQcANhJALYHACEAEN/POD/TAAAAQxQAMPBClWf/LQDw9wTgngXi6vBh k08AAIAhCADKzqjaDI0+lm82hqM44DhAIL6fb076AAAAqFgHQN5AjW84Bu1GThInu/6fAgGIr7snD98jAACAYdwDgA EahrL4v+zuR9P/+NX/pPt86shG+78CAAsB6AAA4lj3n30bP98AAAAVCACA4QwAVBBYAMAeAEDcwQBdPgAAAAQAqAkV /XkBgI/iAIiz+LcuH37GAQAACABQkwBAxs28xgUBFgKw/ASoz+w/P+cAAAAEAKhB+78V/3rdDwFsY0C+T0Ccxb9199 DlAwAAQACAGgUAfsFvIYAQAABxo/gHAAAgAECNAoDscgALAex1vk8AAAAAUIMAgHXg9QwBKP7r4+BpZ/HzDQAAANQ9 ALC1oXYmPEUCEF/xz0kPAAAAQEUDgMGelbUiIHsUHMUBEHcIoJd8P6oXwvJ9AAAAoANg0Gb6/QEnR8EB9QkB+D5U87 nMsxcAAIAAYFAGm34A4L9kIAoAdAAAAAAQAEQ22LQQwF5q7X+2MwAAAAAAAAKAYTLu2LP6FgL4SwIo/oFqh3Z5y3b6 +pBLEk6EAAAAAKoWAPRzkM7afyCsNeJFe3l0U+z7R0HaS0KAaoY+AAAAqFEAoMLfxyAdqG/xL90e2alnx2V3P9qgwn /czGsIACp83QEAAFCjAEADchX9tmafAACoTxGYLQR76dqxz/uPX/1Pg4p/K/x5rlTn2rMsCwAAoMYBQPaoPgbqYGlH PYrATmaCWx3zlw0UrP1fXQAWAvhLArgGwxv8dHrtAQAAENESAH+GjsE5ys4cWwFBERFuAGAzwdkjO/OK/1bdAnY/ZL 9mXgjAM6Y6AQA/wwAAADUMAIBeQgBmEsNvBW93ZKcCgGxx7197Kyrt8/0ZZj8EIACoZghQ5mfYOjj4HgIAABAAoMYh AEc9hr+cI3sdswWhdQD4xb297hf7FgL4mwjaxoAU/9X62fXDmnZLArSfA9cPAACAAAAUjw2EAPFcy1bLAPwi3+8YsE IyLwBgeVE1wzv/Gtrb8mb+1b1hHRzWBcA1BQAAIAAARSTfi5p0DGTbx/P2FEA4HTxFHQB6m7+Pg50cY6fHEAIAAAAQ AKBGhYS/npz9AOrZMcBeEGGHOX4XjzoCsh0ACgD8Qt+KfwIAAAAAAgDUbBYxGwJQBNL9gTD3gPCXbvgfY23/NvMv9r NOAAAAAEAAgBq1EFsRUbSDPIBwOjqys//+KQ629p8lAAAAAAQAqFnB4Lf8M/sPRPxL6i9Fvn8KABs7AgAAEACgZgGA tQvnHRsHAAAAACAAQEQhQN7rAAAAAAACAAAAAAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAgAAAAAAAAA AQAAAAAAAAAAIAAAAAAABAAAAAAAAAAAgAAAAAAAAgAAAAAAAAAAQAAAAAAACAAAAAAAAAABAAAAAAAAAAAgAAAAAA AEAAAAAAAAAACAAAAAAAAAABAAAAAAAABAAAAAy7cePGNanjL2j/D/cEAAAgAAAARFn479y5s0ldQoCkxR/uDwAAQA AAAIjCxIkTmwr+unUBJG3+cI8AAAACAAQ3s5ckiVPXll7uBSCfCn+FAHVs+c8GANwPAACAAABBF/9+O+/q1atrFQQw mwcAAACAAAC1mv33KQS49tpr3Ywfrb01eej0GPrUtXsEAAAAIABA8KGAin+FALT7prUKAXr53B07dtQ6BKjD/XLooY emkyZNSsePH59OnjzZXe8xY8bU8tlg15uuIQAAQACAYIwcM9IN4m0wX+d9AGr/4OkxANiyZQsBQMT//6ZPn55u3749 Xbt2rXu5bdu29J133kkXLVqUjho1im4hfp8AAAACAFSZBu0avGsQr8G8P7gfse+IWg/ouT+6CwE2bNhACBBh4W/Fvx 8SmtmzZzfeV8eOIJ4ZAACAAABBFGsatGvwnjeo1/s+fsLH0wkTJjgxD+xbFXJ1Hty3KujyOkUIAOILAG666Sb3LBC1 /+dd2/333z/azqEywSDFPwAAIABAEMWd7Lr/rrnv02D/hRdecPsATJkyJT3kkENquw9AbCFA2WKtXQCQXfOfDQBiX0 6Sd0/EVgyq8Nd+IHXYELSb2X8AAAACAERDg/6nn37ahQB13BAwxgBAyz760a6dt+bfOkcsLLK/V2l9eD+vZVEA4L89 9Htnzpw5Dbqued1Ckn1f3Z4BBAQAAIAAAMHNCGftvvvuDcz+hfn/wY521Ova8FF7PmjZR17nR69r/vVSe0nY3/Vv6N /atGmT+7db/bcNVcHf7+uZ/Vp5fw9x7bgV/Qpw3nzzzSYPPPBAunLlynTVqlWNzQD1UveCCT0ISHr8w+8VAABAAIBK t/lqMP+zn/0s/elPf9oY6GsJgC0DsCCgDut8YxnYq7jeuXNno8jWtdOGj3mz9oMRANjb3nrrrdz7JvvfNxQBTr/b9t sFAK2+ftXvKz0DFAIcdNBBTlFQmEfdIaEfC9nLzz5BAAAAIADAsM7wd9MJsMtBuzgKASwQYClAEmwAoKMe8wp0hT/9 CgBef/31AV9fxaD+7bz/Pr1vqAKAous3FAFAq7fHWCjW+UhRAAAAAgAwGMewXPdsB0B2/b9eV+dHN/eGfb2xY8e2DA C2bt2ajh8/PjcAWLdu3aAuAxiKDoAyXz/kAEDX14wePbrxel2eK7T5AwAAAgDUzj777JPutdde6YjPj3B2/fzIWnYB hBYArF69uikAWLt27YACXcs+ug0A3njjjaYAYP369QO+/saNG9NJkyblBgCPPvooAUAg99XBBx8c7Zr/XpcK8TsCAA AQACA6l1xyiaOlAMuXL08nTJhQ66UAIQz8/RDA7wDw2/a1vKOXDgDNCtvfX3nllQHHANoZ8tniX/fQYG8CmC3AqxIA hFo8xrzmv24BIQAAqGkAoE2eav/N5qbrOAiYN29eOuLgEW5WsM6D/arfPyrItG+DneM+Yt8RTQV5rwGAZoP9DoAVK1 Y0jgHUS+0Wv99x+w34XL1vwYIFQx4AlC3a+/G1y5wAEMvzh2VGAAAAAQUAKgC6/Xx9ropA0dcKrSDsdRAe6qwwA/X6 UPHvb9748RM+7ro49Had7KDXtdljrwGAvoYfAChkWLZsWePvVfoZ79fPbJkAgJARAAAAwxoA3HTTTW4W0M557qULQA HAHnvs4Qp/nQ8dQgDQz6Kd9aAIjZZuKBB4+umnewoAZPPmzYUBgF7q3xnuAGAofv4JAAAAAFDJAGD69Omu6Nfsn83+ 64xnvc8G8mWp2Nfn2+dZCOD/WyEU/922c7c7ZoyBP6oaAEyZMsUV5woA9FIhQDdfyz8FQIV+XgBQtW6Tfm7k1qrgp/ gHAADAkAUAKvB1BNhgBwAq+O3z9HX09xkzZri/T5061f1bVWrtH4oAgAIAVWfFuV5XCGDLgHTaQydf56WXXmp8jl/8 279R1aUmRT+n3T4DCAABAAAwbAGANtZS8W8bf2WLf9sATAN0fwMwFfKdtPDr87TJVzYAsCUFs2bNcv9edrd4vX2oZv g6nbHvRwHQLgCgMECV2DIAva6jHrXJYycBgD5Hry9ZsqRy7f69FvGD+bkAAABAXwMAf4dtFf3tjgDTcV72MWUDgFWr VjXtAq6v528Cpq+XtxQg+9832AFAmWK81wCgkzXAFAuozAPn/ZMC9PqIz4/oKADQUX72817F9f4dPXS7COgIAAAAAD CsAUBe8S+TJk1K165d21Tc63XN2PsdANrVu5MAIHsOuB8otDsHfDBCgHaz/0MRAJQp9tkgDFXiBwDqBigbAjz88MNN AUCop0t0+xwI6UhIAAAA1CgAGD9+/IDZfWvh9wOATjsA/E3AsoGCvU3BgwKIsv+tdQgAhjME4MxuFNn18yPdrP68ef PafuyIg0ekDz30ULCz/mV/pvv1sbF3kfBMAQAAqFAAMHny5AGz+9bC78/Yb9iwoaMAwP/47NfzQwIFEFUPALqZxSvz +VUMAHbs2JFu2bKlaeCep1XxJyG3fPfj+x5j8ac9O3RtywQAjzzySHRFX6dLAGL/haR9YaTVc0LPEj1TYgwAyjwrCI IAAEDlAgANzN55553c4ryfAUBel0H23x2OAKBVcT4UAUCn/61DNWOn62d07d544w33UmGR6Jx3/V2bvYlmh9X2rZnf GIq/pMc/MRd97T6myrv8D0UIEHvBp+VcRp1d6hZTwKvngfjPjhhn/3kOAACAIAIAK6yzRfWYMWPSRYsWpbNnz07333 //RhHodwX0IwDwv57+Hf17+nf175f57xysGZuiAdtgBgDtBolVGDz6s3hayiHa08FeNzrqTbu9q+gzdR7wM+hHHWb+ 99hjjwHPAns+xN72z88/AAAIJgAoMmrUqKYZehVxeTP21hrernDMfpx1AFhbuP1d/24VWzl7PaavTFFftSKfHzAAnb T+1/WZQ6EPAACCDwD8gVnRjL+tDy8TAGQ/Lq8joOoDwMEIACr3/7GDNf++XQ7axVGgs2LFCnfOu3Z6tx3j6zKYZ/YP dTRnzhzX+q8Q4KCDDnLKPjti2BOgl597nhMAAKAyAUCrFv68kKBMkNDu64W+1nc4v95gr/m3tf6vv/66s379+vSVV1 5xBb8vltb/pA9/eEihTh0ACgGMvyeA7Qeg50eMewLwjAAAALUJAKry9QgABnc5gBXzefyCP7Zj3spcKwb0wAdmzJjh OgKKnhnZt8e8H0CIz30AAEAA0PGa/6H6OiGHAAwCAQAAAACVDgD6sVazX1+HAGBoOwF23X/X3PdpRu/QQw+NvguAdf 9Aa9OnT0+nTp2azpo1yz0Tss94nfZSp9MACH4BAEDQAUDZNf9D8TUwtNdc63Z1TGNeS6/O/F62bFlj07+Y23pZAgC0 pmeFyT4r9AzJniZTpyUAPCMAAEBwAQDqScczbtq0KX3rrbfc8o2tW7emGzdudIP5/Y7bL4pN/zqd5fcH8wzsgQ9MmD DBdQPo+bB27Vr38p133kkXLVpUmaNeh/uZAQAAQACAShs5ZqQr8CdPnpyOHz8+nTRpkmvzreMPHYN5oD09H/Sc0PNC z44xY8bU9lnBEgAAAEAAAAAAAAAACAAAAAAAAAABAACggnQKQO1/MXMfAAAAAgDEZty4cbU79i9vjS/3AtBs586d7v nAs4F7AQAAEAAg0GI/a/ny5emCBQtqNaBnV2+g3PPCQgBf3QIAnhUAAIAAAEEP6HUM4Lp169JHH320VoN6AgCgu2eG qVtHAM8KAABAAICougDq2tbLYB7o/JlR56UAPC8AAAABAAAAAAAAIAAAAAAAAAAEAAAAAAAAEAAAQCf23Xdfp7bfgw +eqgAAAAABAIC4AwCd7lDbEKD5yQoAAAAQAACINwB477330qeeeqqeIcDApysAAABAAACAAIAAAAAAACAAABB4CPDA Aw8QAhACAAAAgAAAQOwBwLJly+oZAuQ/ZQEAAAACAADxLgOoZQhQ/KQFAAAACAAAEALE3wVACAAAAAACAAA1CAAmTp xIAMC9AQAAAAIAALEFANu2batvCFD4tCUEAAAAAAEAgIgDgNqFAC2fuIQAAAAAIABAwFTU1arFewAKuzJdAHLBBRcQ AnCvAAAAgAAAIQcAO3furHEIkLiajsKufRdAbUKAtk9e7hUAAAAQACDQAECFXX1DgIQQoEUI8Itf/GLAUoB6dAIQAn TTSfSxj32s5p1E3BcAAIAAAAQABACBBgBvv/12um7dukYIYAFA/CFAmSdw+PfLnnvu6fSjiyjIZ8gHv0177iLiGQIA AAgAEEwAoGKPAIDBe3ZGd8uWLem7777bFABkQ4Aygp3RLRUClFHdAODNN9/sOgiw4n/evHlhzv4P/K3awxIinh8AAI AAAAEUejfddFONuwCS2ocAeQX7tGnTXBeAAgAtA7AuAAsAbr755qYQwF4vUu2goKBoL/0k7qfhCQCuv/769MEHH+wo BLDiX8+OaAKAjkKAbPFPAAAAACoaANhsT6+tn8HqacYnrsLvxBNPrHEAkNQqACgqunUPyMyZMxsOP/zwpgBASwE2bt zYCACuueaadPbs2a64nzJlSqPQv+qqqzqie2/o2sc7LMaHKAAY7vZxCwEWLlzYUQhgAYCu4YwZM9KTTjqpZiFAXgBA CAAAACoaAGjAZ62ftQ4AAg4BVKD5egkAggwB+tC+W6cQwJ+xNXbtZf78+el1113nfOUrX2kEAGvWrEnvvPNOxwKC88 47zwUAp59+ejp9+vSmLgC/uC9i95rdb0NzzxUVbD0GAGk/Cv/hvee6CQH8AEAdI8EGAF2HAAQAAAAgoCUAGuCp7dNf /1mrMKD4uxpUAKDWbB3XJp2GARrAq5hT4RdFANDFDF4duwCs8Na+D9kg4Pbbb3fmzp3b2APg29/+dvqHP/wh/d3vft e4177whS+kxx9/vAsBRCHAIYcc4gIAfX61Cv+BRdvA4rt1CDDgzT2EAFUq/LMBwA9/+MP0tttuS5955pmWvw/8MEnX 9eyzz06PO+649Nxzz42nC6Dlc6RdmMQABQAAVDAA0EyPZnysG6BWHQE9F4/VCQFsgzYrzrJhQFEgYAGAZnytaIsqBG h7TZPahgDGivG8IEDF/Oc+9zlX/H/0ox9tYveZ3v/Vr37VfawfAGRDAPv6w1f4F+/70C4IyCv6c4OAksV/FYtEPwDQ 74VvfvOb6fr16wuDYT8AUICo6x5lAFD4/CAAAAAAgQUA2RBAAz/pZUfo+Ad91V4KoLXZGpD7YYBmeSUvCIgiAOgkBB hwTesZAOSFAXlBgIUAFgD8YuHHGwGAve6HABYA2OdWZ9a/fRjQKghoagbw76P3g4AyAUAVZ/2LQgDN/isAUCeAfj8s Xry46feBX/zrOuv5oeuuJQDBBgAd/T4os5SEAQoAAKhgAOCHADbY0+Bv69at6auvvprut99+hACBdQP4IUCrIMB2et dmb1rvrZbvvBDgsAP2jCsI6KBNu04D+bwgwAp4Ffi6h7JdAGbHjh3uPrJOAD8AyM76X3nM2IreU62DgKTF/VWmgyCU wlC/D/T81++CG2+8Mb3yyivTG264Ib3jjjvc+/Q7IdoAoINnCAEAAAAINgCwQZ/N+ogFARYCRN8N0HULebVDgFZBgA bx/hIB28StKASQEybtHdGSgPbBQB2PBfSDALuHbCmACn299It/CwcUALQr/v/lhrPSO84+quKhUnGBVxQCJKW6ScK4 j/Ss13Nfz38/BJB77rkn/c53vuM+xu6NbABw4YUXxh8ApAQAAAAg8ADABn5a86lOAA36NPh75JFH3NvWrl1LCBBgCJ DtBhA70k2bu2WpmLMizi/ell51cvrcogvdyyA6Arr+iSIAyLZ5WxBgIcBrr73mXloQoJcbNmxIjz322KYAyT43+cv3 T1/rpbuudBQCVLcLYOAa7yRnz4AyxWDzHoJh3UMKfRUC6PlvIcAVV1yRXnLJJe50B3UE6PeB7fXgBwC16QJI6R4CAA CBBwD+cgDN9vghwA9+8IP0Jz/5CSFAYCGACq+8bgCdHPDuu++6MEB0zJvt9C4WBPghwIQJE9Kjjz7aSYIY3ObM8peY 1cst+PTS+1OLh8v7hXu2G0Bt/ir4NROs++Shhx5qFP+2ZMDumcR9/5L0iHH7pD978k5X/IuCgDCWluR3A/gbABZ2Cg ReACoEUPhrIYA6wy6++OL08ssvT+fMmZOecsop6Sc+8Yn0wx/+cOP4RwsALrroorADgB5DAAIAAAAQVACgDZ80w+OH AGr9vP/++9OXX37ZDQxN3tc49sCRDUlog6COC8UwZnLzQgALAtQNoPPd/Z3ebWM3CwE2btzovs6LL76Y3nrrrYFd18 6uaZkQoA4PFxXocw/7iCvWde11D4iFACr6tSTgN7/5TdPaf91X+vhTTz3V3Se6XxQAiDpIXll8XUABQPtugKJ7JfQC UL8L1Pml8FfP/+9+97uu+Bd1AigE0HU/5phjGiHAl7/85TiWAXTaRUQAAAAAQg0AbOCnDZ8UAKjtUzM/GvwpANBxTx r4aaCnwWE2BFDRv2L+rAZCgOqEAFbMZ0MAFXUKAHTGu7+7u6339gOA5557Lp1wxpXpwmXPRxcCNFq7c2Z2/QCgTg8Y FenWtm/dANu3b2/aG8D4xb/uDd0zennGGWc46hxRF4mWkiy59Kvua1uHQDD3UFJ2vf8Ht1yShts9ot8F6vzSs9+e/x YC6PeAruvpp5/eCAH0e0EWLVoUfgDQQwhAAAAAAIIKAGzgp1kfzfRY26cGfxYA5IUANpj/P//7Adfu+6vV/0QIUMEQ wPYG8OkowOwu77beW7N8KvZU+OlrqPjf8d+/D++aJiUDgIK13XUc1FsAoFl7zd5r7b7fDaB7xsIAHR/nt/2LCn51AC g4UveIQgB9HW0mqXtO68m1htz/nOrfV0lup0jR/VEcACRBdArod4E6v+z5b8W/BQBaCqBZ/09+8pONEEABchQBQJch AAEAAAAILgBQUa81vhqg24xPduZH/BDAt/mRb6avL13oAoDJkyenxx9/fFizfR2uG2+1T0CVZv4sBMgGAXkBgL/Bm4 UA1gmgQlDCmsFtHQKU2eG9bgN7BQCardesve0BoZ976wYQ3Tc///nPXSGov/9+47+k//n84nT+l/4unfDJT7vASF0j CgL0+VpWoK+re073oYUA5uabb67kPdVcxA9cBtDu3mgdAGSLx+rtB2BFv1/8WwBw4oknpscdd5wLCxQE6PfCt771LU IAQgAAABBCAGADew3mtBeABnvqBMjO/PghgNpDNUjULKBkAwFRCGBBQAitvt2EAEVniFdp/bgfAqjYuuaaa9Lzzjsv /cIXvuCKOVsCYAGAgiCt9/YDAAU825ff5kIedXxEFQJkBvx17wLQbL1m7VW8axZfs/kq5hUI+BsFysiRI9PLjzow/b e7r3L3iEIidYvYkhFR8e8vHVAAYBQAPPbYY5UPAFoX8h08YwIKAPSczz77Vfy3CwD0ueEFhQNr+m4CgKZlRQAAAFUL APwdv23Xbw3oNMDLm/kRDfzksMMOSw888EB3/NM3vvGNRhBg/LPAqzsQzJnR62akmCS5Y/sqtfv6IcDs2bMdhTNFXQ DaD0Afq/frc1XgbXn0lvTtf70jffaWOdEsB2jXBVDXZQCatVcA4Ar/9/eA0Oy+Zvk1269ZfyvytORH94YCIr9LRHS2 /KZNm5pm/K34V+F/1113VfZe6keA1zIgrPByIhXx6vRSYZ8NAPT8nz59+oAA4JZbbmkEANonQEINAjr6fVBwUkTCgA UAAFQhAPBn7/zC32iArqOe1AJeNPOj2WEFAOPHj0+POOIIN/hTCOB/HTtOzg8CKjXbn7SYve9mpNhygF+NIMAPATQ4 VwigYt9CADvrXce8aad320TQQgAV/ir2/v2efwh0dq9cCFB2rXfsIYAVb7YHhIp7zfIrDNKs/x/fWOXe/8sXHnTBkL pD9Pdt27a5teH6Orvttpt7m0IA7S+xcuVKx2b9kwi/r833S1L4mKj6/49sCGDhrx8AfOhDH2oEAFpapABAxwjatdUJ M5Ld8yGE6146BMhuHJobAAEAAAxDAOAX/X7h78/OiQbv2uVZRaIV/lb8FwUAGiBacWlfp3pBQFJ47FvXo/OkvaoEAf b9nzJlihvAKwBQ0GMz/ir0tf5f19eOedP103rv7GZvwQYABde31X1R97W9dr0VAGiWX7P9ttGnKBBSOGRLQ/wAQAWi ybt/wr6f2gcASRr2/eOHAPbsFxX/2QBAx8cqANDzxA8B/CDADwSi6QTIOS0iafNrgsEMAAAY9ADAin8VdDq+y2iX5+ uuu66JCj8LAbTbsz/rYzM/2QDg7LPPbjoeLI+FAcMTAiTti/5uRmkdfL0yG4cNVQeAXte11Osq9g8//HBHg3v/Omo5 h232predc845jdbeoAOApNx1LA6L6hkEaJZfs/2a9c+b1VUn0ObNm93rRx11VLpw4cKGSy+91O09cdppp7n36WPGjh 3beD2O71NSeBxg3p4CIRwVqBBAe77ome/zi3/9rvADAD1HLATwlwKEVPyn3v4ghSFAkh8ANIcASSYcAgAAGOQAwIr/ efPmOTNmzEinTZvWVLTnUQigAZ7N9vj8wZ/Yms+8jb6MCsmrr756GEKALor/MiFA0p3hCgH8AEAOOeSQBpvx9wMcO+ PdNnuLqgOgo+tU36I/GwBoll+z/dllIHpdR8c9+eSTLgR44YUX/rp84C+F/9133+1eKlxUAHDRRRc1hQB6GUMI4IdF MYUAtqmr9nxR6Gv84l9sE8DPfvazLiDwQ4Bgi/9Ws/9tnxcDlwMwiAEAAEMaAGhwJprVFyvm7e8+K+wVAmijJ2PtvP 7gT7vJq7j/2te+5joF9NIGhT4V/2ZoQ4AeAoCkv8X/cIYAFgAojMkLfFT0a+mGX/xrwK4N37TmW23fmvkNeg+Aioc0 oSwHyLv+9nYFAer28bsANDtsAcBll13mAgBtEKiP0esKJGPpAvAfGy3L/8zHVPH/i37m7bQXbfiqji/jF/9y3333ud 8v1iFw5JFHNgKA1atXh3t903K/P1oFABT/AABgSAMADcr8YtuCAA3ofBdeeGFuCKBiPys7+MvyNxAU+zeNBRJDW/h1 NxM8GIY7APDPYrcZf3vdwhkr6LTre94pAEGeBEDxPyQBwa677jogANBLFfu6B/V2a/+35426TGJ8YHfyp2rF/4r5sx oBgDo77HeCUfir5/2CBQvc81wdZtdee62b/VcA4HcBPPHEE2E+N0oEAElmjxlCAAAAMOx7ABQFA1kKAtSiqzBg0aJF 6R133DFg0Jct/jX4O//885vkfW0VADb4s7dVrSBsfZxf0tPn5J8lPnwBgBX9fhBgxf+pp56abty40V0vHf2m3d+1AZ zWgNtmb5rpDWsw31nbf5kVIDyU2rMWfxWQ/sy/BQB6XqiDSCcGxPrQbjXzX/UA4GdP3tkUAijQ1fIx2yRWvwPsmW8F /uOPP+6o+F+16q+nRejZY2FAuHs7lAsN85vIEp4ZAABgeAOAsqGA1naKznnWUU+azRO9zdo+s7S0YNy4ce6s+alTp7 rQwNYEV3sAWK7A7yQg8Iv94Rzk+wFAq00a/TbvCRMmuPPftQO8f8a7CgGt9w5rRq9sANBJQYCyVPCL3TN6XffR3Llz XTE5atSo6B/e/s9/KAHAr1b/UyMA0DPCP0rUlntZAKC9AfxrbPR2fY5erlmzJsjuoXIBQFGw280zBgAAYAgCgLKhgE 9tnzbIO/PMM9MDDjjAbSqnAMBOEFAIoI/5+te/HuzgL2kREJTba6C6AUC2+L/11lvdTJ9e2jnwdsSbaKd3FW9hdQF0 VvznFWXZ4IfBfG+0n4gCgJkzZ6YjRoyo5QO9qgGAfq6zywD8AED0bPcDAD3/r7/+eke/D3QigP/xsQcAZYJhnhkAAK DyAYDYTtBq4dSgTmy3Z635tBk9DfwsAMiGANYFEOo60KK1oOUDgOH9/1wUAPjHM8oR4/ZxFAA899xz6YQzrnQhgK6Z NoUUva6d3vW5Wu8degCQ5CzLyC/KvDCHZQB9CwHqGgBkQ4Aq7ungbwSon3dbLqRnSbYDQM9+oy4xFfwKf/X7wk4PWL 9+fYDLPTrtAEjaBMbsMQIAACoeAPjnOSsE0OZOttuzXtd6T73PAoATTjjB0esqKjUI9JcCZI8QCyEQaN7MKT8EKLck YHhDAD8AyBb/L911pVvzqwDg6KOPTl988UXXBZC9RnZsW3hhTrniv11hVvWz20Oz++67uyCgzg/2qt5T+vlWAKDnhB 8A6DliG77a+n8Lfu3Z/+yzzzYK/6VLl6bPP/98ussuu6SjR4+OKgD44NnRek+RZJj2fwEAAAQAPQUAfgignZ7FAgAN 9DTzo8GfXve7AfwQwA8CtDFYSAFAXqHfWRfAwJnmKgQA/3LDWS4A0MulV53s1v8rBBBdH23eppk7FWray0Fsg7c4Ao DWM7ONNt+Kr90GBuP5b8fJ6plRFACo48sCAD3/Z82alS5ZsqRxfGzYRz22X+LVScAIAABQ6QDABoGLFy9uCgEsCLDd na3VUzM/GvzpvGi/LdR31113BRUA5IUAA9eCJ6VDgGSYAwC/+NcGf3ecfZQr/uWVxdelzy260AUBcw/7SHrYAXummz ZtctfJAoC77767KQgIMQDopB3X7/IgBAABwMAAQEu9FALYM17P//vvvz/wwr8fAQAAAEDgAUC2G8A/6kmz/AoBNPOj wZ+58cYbG+69997gOgCaA4AkJwgY2BXQ+vSA4Q0A/NZ/FfiiIEBdALLk0q+mJ0za271d11WtvwoB/A4AOxEixACgs5 m55s8hAECdQ4C8AEDPfdvvRR+nTgCFAPEEAJ12eBEAAACAwAOAvC6A1atXDzjqyboArOWziLWPh3YyQFLweqfr/Yej eLQAwJ/9999vQYDR5mxiAcBrr73mrtWll16aXnfddY6CAJ0IoE0gwwwAOu0YyO8AIARA7PICADsNRsu6LATQSwIAAg AAABBZAGAvn3jiiQFHPWnDp+ymXv753yr8NfMf4rGASe7L8q3lw1k0WgCQV/znXWt9rF1XBQArV650bz/vvPMadB0l pACgfOs/AQCQfYYoQDzllFPSq6++2hX/CgHt+W5BgCgAUMdXkCe/dBACNP/sEwAAAIAIAwAr/u1tWgZguz2LdnvOG/ DZzL8VjSEOCvOOfyveFLAaM//+4N1v/293rVX0KwQwFgDo2l100UXpZZdd5sIBbRAYxrUcpACAhxNq1gWg4t8CAP3s KwSwQNdCgGwAEO9eAGnmmU4AAAAAIuwAyM7sr1mzxtE5zzrqqehraKZYQh0MJm2CgXbF5XDOFtvgvV3xXxQCPPbYYw NCHP9IwLAG790uGxjeLg6gSiGAAgD/94DfCeAHANb5FUanUKchQLuwMeV5AQAAwg0Aigo9e5+OigvvnOfBWGde3YF7 NwGAFf9+J4dm/i3QCWUJQLcBQJIX5DCwR81DALEQwP89YAGAbfhqoWEcAcAHz5Li5wkBAAAAiCAAQPiD9rLFvx8AiB 3baLN52c0ctRFgdt+HOMKZgQGAP4inGwB1fp7YJoB5zw57ZoS+7KvcEqHibjGeDwAAgAAAgSx3SNKbb745d/bfBvUn nXRSev7556dz5851qh8C9GHPhzZ/uHfAs6P5xJcQN3zt5y9ungsAAIAAAEEN5LN/16B+2rRpLgDQjuCnn35649jA3X ffvTaDekIAYOAzw2b8Qz3tpd/PB+4LAABAAIAogoGRI0e6fR9GjRqVjhgxwomtC6CbIIB7BMz+J5EdAQgAAEAAAAAA AAAACAAAAAAAAAABAAAAAAAAIAAAAAAAAIAAAAAAAAAAEAAAAAAAAAACAAAAAAAAQAAAAAAAAAAIAAAAAAAAwKD5/y xRa6dZ22y3AAAAAElFTkSuQmCC